ID: 952756845

View in Genome Browser
Species Human (GRCh38)
Location 3:36876493-36876515
Sequence TTTGTCAATCTCAGTCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952756845_952756849 9 Left 952756845 3:36876493-36876515 CCTCTTTGACTGAGATTGACAAA 0: 1
1: 0
2: 0
3: 13
4: 142
Right 952756849 3:36876525-36876547 AGTAAGCCTGAAGGTTCTGGTGG 0: 1
1: 1
2: 45
3: 290
4: 475
952756845_952756847 0 Left 952756845 3:36876493-36876515 CCTCTTTGACTGAGATTGACAAA 0: 1
1: 0
2: 0
3: 13
4: 142
Right 952756847 3:36876516-36876538 TTGGCAGAAAGTAAGCCTGAAGG 0: 1
1: 0
2: 3
3: 19
4: 167
952756845_952756848 6 Left 952756845 3:36876493-36876515 CCTCTTTGACTGAGATTGACAAA 0: 1
1: 0
2: 0
3: 13
4: 142
Right 952756848 3:36876522-36876544 GAAAGTAAGCCTGAAGGTTCTGG 0: 1
1: 0
2: 2
3: 13
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952756845 Original CRISPR TTTGTCAATCTCAGTCAAAG AGG (reversed) Intronic