ID: 952756847

View in Genome Browser
Species Human (GRCh38)
Location 3:36876516-36876538
Sequence TTGGCAGAAAGTAAGCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952756845_952756847 0 Left 952756845 3:36876493-36876515 CCTCTTTGACTGAGATTGACAAA 0: 1
1: 0
2: 0
3: 13
4: 142
Right 952756847 3:36876516-36876538 TTGGCAGAAAGTAAGCCTGAAGG 0: 1
1: 0
2: 3
3: 19
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952756847 Original CRISPR TTGGCAGAAAGTAAGCCTGA AGG Intronic