ID: 952756847 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:36876516-36876538 |
| Sequence | TTGGCAGAAAGTAAGCCTGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 190 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 19, 4: 167} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 952756845_952756847 | 0 | Left | 952756845 | 3:36876493-36876515 | CCTCTTTGACTGAGATTGACAAA | 0: 1 1: 0 2: 0 3: 13 4: 142 |
||
| Right | 952756847 | 3:36876516-36876538 | TTGGCAGAAAGTAAGCCTGAAGG | 0: 1 1: 0 2: 3 3: 19 4: 167 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 952756847 | Original CRISPR | TTGGCAGAAAGTAAGCCTGA AGG | Intronic | ||