ID: 952756848

View in Genome Browser
Species Human (GRCh38)
Location 3:36876522-36876544
Sequence GAAAGTAAGCCTGAAGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952756845_952756848 6 Left 952756845 3:36876493-36876515 CCTCTTTGACTGAGATTGACAAA 0: 1
1: 0
2: 0
3: 13
4: 142
Right 952756848 3:36876522-36876544 GAAAGTAAGCCTGAAGGTTCTGG 0: 1
1: 0
2: 2
3: 13
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952756848 Original CRISPR GAAAGTAAGCCTGAAGGTTC TGG Intronic