ID: 952759216

View in Genome Browser
Species Human (GRCh38)
Location 3:36899029-36899051
Sequence CCCCATGAGCCTGAGTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 287}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952759212_952759216 4 Left 952759212 3:36899002-36899024 CCACAAAGAAACACCCAGAAAGT 0: 1
1: 1
2: 7
3: 130
4: 1146
Right 952759216 3:36899029-36899051 CCCCATGAGCCTGAGTCCCCAGG 0: 1
1: 0
2: 1
3: 24
4: 287
952759214_952759216 -10 Left 952759214 3:36899016-36899038 CCAGAAAGTATCTCCCCATGAGC 0: 1
1: 0
2: 1
3: 6
4: 90
Right 952759216 3:36899029-36899051 CCCCATGAGCCTGAGTCCCCAGG 0: 1
1: 0
2: 1
3: 24
4: 287
952759213_952759216 -9 Left 952759213 3:36899015-36899037 CCCAGAAAGTATCTCCCCATGAG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 952759216 3:36899029-36899051 CCCCATGAGCCTGAGTCCCCAGG 0: 1
1: 0
2: 1
3: 24
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952759216 Original CRISPR CCCCATGAGCCTGAGTCCCC AGG Intronic
900552743 1:3264729-3264751 TCCCATGTGCGTGAGTCCCTGGG + Intronic
900864714 1:5260189-5260211 CCCCATGTGCCTGAGCCTCTGGG + Intergenic
901440068 1:9272388-9272410 CCGCTTCAGCCTGAGTCCTCGGG - Intergenic
903293594 1:22329950-22329972 ACCCAACTGCCTGAGTCCCCAGG + Intergenic
903769285 1:25753869-25753891 CCACATAAGCCTGAGCCTCCTGG + Intronic
905474850 1:38218871-38218893 CCCCAGGAGGCTGAGGCCCCAGG + Intergenic
905524296 1:38624765-38624787 CCCCAGCAGCCTGAGCCCCACGG + Intergenic
905733118 1:40310016-40310038 CCCCCTGAGCCTGTGTGACCTGG - Intronic
906129585 1:43448170-43448192 CCCCCTGAGCCAGAGGCTCCTGG + Exonic
907221091 1:52907395-52907417 CCCCATGAGACTGAGCCCCATGG - Intronic
909303117 1:74038310-74038332 CTCCCTGGGCCTGAGCCCCCAGG + Intronic
911090513 1:94013522-94013544 CACCACGTGCCTGTGTCCCCAGG - Intronic
911092912 1:94031884-94031906 CCCCCAGAGCCAGAGTGCCCAGG - Exonic
915097191 1:153471421-153471443 CCCTATAAAACTGAGTCCCCTGG + Intergenic
916343219 1:163759124-163759146 CCCCCTAAGCCTGAGCCCCTGGG + Intergenic
917433023 1:174990491-174990513 CCTCCTGAGCCTGATTCCCAGGG + Intronic
918600430 1:186352543-186352565 CCCCAAGAGTCTGAGTCTCAAGG + Intronic
919452701 1:197789211-197789233 AGCCTTGAGCCTGAGTCCACAGG - Intergenic
921673848 1:217955512-217955534 CTCCCTGTGACTGAGTCCCCTGG - Intergenic
922226102 1:223647046-223647068 GCCAGTGAGCCTGAGTCCCCAGG - Intronic
922763956 1:228148188-228148210 CCCCCTGGGCCTCAGTCCTCAGG - Intronic
922880284 1:228975468-228975490 CCCCATGTTCCTGAGGCCCCAGG + Intergenic
1063169501 10:3494901-3494923 CGGCATAAGCCTGAGACCCCAGG + Intergenic
1067697595 10:48547259-48547281 CCCCATGGCCCTGATTCCCATGG + Intronic
1069558113 10:69411084-69411106 ACCAATGGGCCTGAGACCCCTGG + Intronic
1069587051 10:69614069-69614091 CCCCCTATGCCTGAGCCCCCAGG - Intergenic
1069603195 10:69722634-69722656 ACCCTTGAGCTTGGGTCCCCCGG + Intergenic
1070897324 10:79995983-79996005 CTCCATCAGCCTGAGAACCCAGG + Intergenic
1073038064 10:100578218-100578240 CCCCATGAGCCCTAGCCCCAGGG - Intergenic
1075015476 10:118907457-118907479 GCCCATGATCCTGGGGCCCCTGG + Intergenic
1075719596 10:124576919-124576941 CGCCATGATCCTGAGTGCACAGG + Intronic
1075724522 10:124604595-124604617 CCCCAGGAGCCCAAGACCCCCGG - Intronic
1075725395 10:124608279-124608301 CCCCACCAGCCTGTGTGCCCAGG + Intronic
1075737964 10:124675696-124675718 CCCCATGTGCATCAGTCCTCTGG + Intronic
1076357709 10:129865087-129865109 CCACATGCCCCTGAGTCCCTTGG - Intronic
1076542856 10:131225004-131225026 ACTCATGAGCCTCAGTGCCCAGG - Intronic
1076588669 10:131568855-131568877 GCCCATGAGGCTGAATCCCCGGG + Intergenic
1076588684 10:131568889-131568911 GCCCATGAGGCTGAATCCCTGGG + Intergenic
1076588706 10:131568954-131568976 GCCCATGAGGCTGAATCCCGGGG + Intergenic
1076588715 10:131568986-131569008 CACCATGAGGCTGAATCCCCGGG + Intergenic
1076698201 10:132257130-132257152 GCCCATGAGGCTGGGTCCTCAGG + Intronic
1077117078 11:890031-890053 CCCCATGGCCTTGGGTCCCCTGG + Intronic
1077334312 11:1996711-1996733 CCCCATGCCCTTGACTCCCCTGG + Intergenic
1077407745 11:2390231-2390253 CCCCATGCTCCTGACTCCCGGGG + Intronic
1077636633 11:3846243-3846265 CCCAAGAAGGCTGAGTCCCCTGG - Intergenic
1078146469 11:8724974-8724996 CCCCTTGTGCCTAAGTCCCATGG - Intronic
1079334863 11:19562368-19562390 CCCCAAAAGCTTGAGGCCCCAGG - Intronic
1079935229 11:26608589-26608611 CTCCCTGGGCCTGGGTCCCCAGG - Intronic
1080700089 11:34637320-34637342 CCCCATGCGCCTGCTTCTCCAGG - Intronic
1081594813 11:44451916-44451938 CCCCATCAGCCTGTGGCCCCTGG + Intergenic
1082000823 11:47393058-47393080 CCCCATCAGTCTGAGCTCCCGGG - Intergenic
1082771899 11:57214292-57214314 CCCCTTGTGCCTCAGTCCCCTGG + Intergenic
1083314009 11:61802997-61803019 CCCCAGGACCCTGCTTCCCCAGG + Intronic
1083629925 11:64090184-64090206 CCCGAACAGCCTGAGTCCACAGG + Intronic
1083890946 11:65595541-65595563 CCCCATGGGCCTGGGTGGCCAGG + Exonic
1084719133 11:70892874-70892896 CCCCAGGGGCCTGAGCCTCCGGG + Intronic
1087607268 11:100392141-100392163 CTCCATAAGCTTGAGTCCCGGGG - Intergenic
1088004868 11:104927554-104927576 CTCCCTGAGCCTGAGCCCCTAGG + Intergenic
1088167588 11:106956928-106956950 CTCCCTGGGCCTGAGTCCCTAGG - Intronic
1089757093 11:120695151-120695173 CCCCATGCTCCTGGGTCCCAAGG - Intronic
1090202260 11:124865361-124865383 CCCCTAGTGCCGGAGTCCCCTGG - Intergenic
1202817295 11_KI270721v1_random:51893-51915 CCCCATGCCCTTGACTCCCCTGG + Intergenic
1093930657 12:24952055-24952077 CTCCATGAGGCTGAGTCCTGGGG + Intergenic
1094646794 12:32332561-32332583 CCCCAGGAGGCTGAGTCTTCTGG - Intronic
1096743674 12:53712199-53712221 ACCCATGTGCCTGGGTTCCCAGG + Intronic
1097516790 12:60616956-60616978 GCCCTTGAGCCTGAGTCCACAGG - Intergenic
1099502656 12:83432651-83432673 CTCCTTGAGCCTGAGTCCCTAGG - Intergenic
1100091552 12:90978114-90978136 CCCCAGGAGCCTGAATTCACAGG - Exonic
1103905245 12:124324302-124324324 CCACATCCGCCTGAGTCACCAGG - Intergenic
1104256374 12:127142983-127143005 CTCCCTGGGCCTGAGCCCCCAGG - Intergenic
1104737029 12:131141616-131141638 CCCCGGGAGCCTGTGTCCCAGGG + Intergenic
1104747532 12:131219642-131219664 CTCCATGGCCCAGAGTCCCCGGG - Intergenic
1105280853 13:18961843-18961865 GCCCAGGAGGCTGAGTCCCAAGG + Intergenic
1105585400 13:21738585-21738607 CCCCATGAGCCTGTCTGCACAGG + Intergenic
1105981993 13:25526866-25526888 CCCCATCATCTTGAGTTCCCTGG - Intronic
1108567958 13:51719920-51719942 CACCATGAGCATGAGGACCCTGG - Intronic
1113669849 13:112168944-112168966 CCCCATAAGCCTGTGTCACACGG + Intergenic
1114521561 14:23341771-23341793 GCCAAAGAGCCTGAGTCCCTTGG + Intergenic
1118397915 14:65353353-65353375 GCCCATGAGGCTGAGTCACAAGG - Intergenic
1118482041 14:66176977-66176999 CTCCATTAGCCTTAGTCCCTTGG + Intergenic
1119543691 14:75456907-75456929 CCTCTTGGTCCTGAGTCCCCAGG + Intronic
1119953284 14:78768139-78768161 CTACATGAGTCTGAGTCCCTTGG + Intronic
1121097603 14:91228700-91228722 CCCCATGTGGCTGAGTTCTCAGG - Intergenic
1121957767 14:98229551-98229573 CTCCATCAGCCTGAGTCTTCAGG - Intergenic
1121988956 14:98536125-98536147 CCCCATTAGCCTGAGAGCTCTGG + Intergenic
1122023663 14:98859265-98859287 CCCCAGCAGCCTGGGTCACCAGG - Intergenic
1122578156 14:102754958-102754980 TTCCATGAGCCTGAGCGCCCTGG - Intergenic
1122586038 14:102807265-102807287 CCCCAGGAGCCTGCCTGCCCAGG + Intronic
1122786060 14:104163767-104163789 GCCCGTGTGCCTGAGACCCCTGG + Intronic
1122923190 14:104888338-104888360 GCCCATGGGCCTGAGGCCCTAGG + Intronic
1123009125 14:105338734-105338756 CCCCATGCCACTGGGTCCCCAGG + Intronic
1123015022 14:105369434-105369456 CTCCAAGAGCCTGAGCCCCGTGG - Intronic
1124026625 15:25972819-25972841 CCCCCAGAGCCAGACTCCCCTGG - Intergenic
1124432256 15:29617819-29617841 CCCGCTGAGCCTGAGGCCCAGGG + Intergenic
1125719570 15:41838897-41838919 AGCCATGAGACTGAGTCCTCAGG - Exonic
1128000089 15:64183149-64183171 CCCCATGACCCAGAGTCACCAGG - Intronic
1128435581 15:67644622-67644644 GCCCATGAGACTGAGTCCAGAGG + Intronic
1128660560 15:69497890-69497912 CCCCATCAGCATGAGGCCCCAGG + Intergenic
1128737378 15:70060826-70060848 TCCCCTGAGACTGAGTCCCCGGG + Intronic
1129191684 15:73941334-73941356 CCCCATGAGGCCCAGGCCCCAGG + Intronic
1129332443 15:74834587-74834609 CTCCAGCAGCCTCAGTCCCCAGG + Intergenic
1129661353 15:77554721-77554743 CCTCTTCAGCCTGAGCCCCCAGG - Intergenic
1129951487 15:79596139-79596161 CCCCATCAGCTTTACTCCCCCGG + Intergenic
1130062194 15:80578105-80578127 CCCCATGAACATGAGCACCCAGG - Intronic
1132623693 16:880114-880136 CCCCAAGAGCCGGGGTCCACAGG + Intronic
1132806536 16:1777622-1777644 TCCCAGAAGCCTGAGGCCCCAGG - Intronic
1133059517 16:3165340-3165362 CCCCAGGAGACTCAGTCCCAGGG + Intergenic
1134008385 16:10833552-10833574 TCCCATGAGCGGAAGTCCCCTGG - Intergenic
1134102082 16:11459723-11459745 CCCCATGACCCCATGTCCCCAGG - Intronic
1134195328 16:12155158-12155180 CAACAAGAGCCAGAGTCCCCTGG - Intronic
1134232151 16:12437667-12437689 CCCCAGGACCCAGAGTCCCTGGG + Intronic
1134631023 16:15756302-15756324 TCCCCTGAGACAGAGTCCCCTGG + Intronic
1136247370 16:28983739-28983761 ATCCATGAGGCTGACTCCCCTGG + Intronic
1136636069 16:31524067-31524089 GGCCAGGAACCTGAGTCCCCCGG - Intergenic
1136666361 16:31816438-31816460 GGCCAGGAACCTGAGTCCCCCGG - Intergenic
1137472819 16:48777036-48777058 ACCCTTGAGCCTGAGTCTACAGG + Intergenic
1137489198 16:48916956-48916978 CAACATGAGGCTGAGCCCCCTGG + Intergenic
1139484726 16:67249075-67249097 ACCCAGAAGCCAGAGTCCCCGGG + Exonic
1139964660 16:70738679-70738701 TCACCTGAGCCTGAGGCCCCCGG - Intronic
1141141070 16:81497172-81497194 CCCCAAGCTACTGAGTCCCCCGG - Intronic
1142433043 16:90040794-90040816 CGCCAGGAGGCTGAGTCCACAGG + Intronic
1142489625 17:269940-269962 CCCCATGAGGCAGACTGCCCTGG + Intronic
1143332987 17:6151382-6151404 GCCCATGAGCTTGAGTCTCAAGG - Intergenic
1143772029 17:9175027-9175049 CCCCTGGAGCCAGAGTCCTCAGG + Intronic
1145123916 17:20284822-20284844 CACCATGAGCCTGAGACAGCTGG + Intronic
1145255865 17:21322020-21322042 CCCCAGCAGCCTTCGTCCCCAGG - Intergenic
1145320756 17:21765926-21765948 CCCCAGCAGCCTTCGTCCCCAGG + Intergenic
1145998580 17:29118234-29118256 CCCCATGAGGCTGGGCCCTCAGG + Intronic
1146305772 17:31728835-31728857 CCCCAGGTGCAGGAGTCCCCAGG - Intergenic
1147421098 17:40322563-40322585 CCCCCGGAGCCTCTGTCCCCTGG + Intronic
1147734281 17:42625098-42625120 CCCCATCAGCCTGGGCCCCAAGG + Intergenic
1147892486 17:43727148-43727170 CTCCTTGATTCTGAGTCCCCAGG + Intergenic
1147968698 17:44207896-44207918 CCCCCAGAGCCTGTCTCCCCAGG - Exonic
1148693250 17:49545019-49545041 CCCAATGAGTCTGAATCTCCAGG - Intergenic
1150196484 17:63304731-63304753 CTCCCTGGGCCTGAGTCCCTAGG - Intronic
1151472163 17:74325365-74325387 CCCCAGGAAACTGAGGCCCCAGG + Intergenic
1151955734 17:77379284-77379306 CACCGAGAGCCTGAGCCCCCAGG + Intronic
1152757285 17:82092321-82092343 CACCAGGAGCCTCTGTCCCCCGG - Intronic
1152806455 17:82359155-82359177 TCCCATGAGCCTCAGTTTCCAGG - Intergenic
1152942100 17:83178173-83178195 CCCCATGGACCTGGGCCCCCGGG + Intergenic
1153811959 18:8759911-8759933 CCCCATGAGCATGAGCCCCTGGG - Intronic
1160156825 18:76441193-76441215 CCCCCTGAGCCTGGGATCCCAGG + Intronic
1160843619 19:1157153-1157175 CCCCATGGTCCTGAGCCCTCCGG + Intronic
1161040766 19:2109778-2109800 GCCCAGAAGCCTCAGTCCCCGGG + Intronic
1161473430 19:4472538-4472560 CCCCATGAACCCCAGACCCCCGG - Intronic
1161495160 19:4582339-4582361 CCCCATGAATTTGAGACCCCAGG + Intergenic
1161959036 19:7513081-7513103 ACTCAGGAGGCTGAGTCCCCAGG + Intronic
1162413377 19:10519263-10519285 ATCCTGGAGCCTGAGTCCCCAGG - Intergenic
1163203164 19:15782582-15782604 CCCCTTCAGCCTGAATCCCCTGG - Intergenic
1163223322 19:15937204-15937226 GGCCAGGAGCCTGAATCCCCTGG - Intergenic
1163371310 19:16902778-16902800 CTCCAGGAGCCTGAGGCCCAGGG - Exonic
1163628302 19:18403551-18403573 CCCCAGGATCCTCAGGCCCCAGG - Intergenic
1163628316 19:18403583-18403605 GCCCAGGACCCTCAGTCCCCAGG - Intergenic
1163628337 19:18403647-18403669 CCCCAGGACCCTCAGGCCCCAGG - Intergenic
1164163835 19:22650564-22650586 CTCCCTGGGCCTGAGTCCCTAGG - Intronic
1164629836 19:29754867-29754889 CCCCACGGGCCTGAGTCCTGGGG + Intergenic
1165951469 19:39475995-39476017 AGCCCTGAGCCTGTGTCCCCTGG + Intronic
1166282163 19:41801303-41801325 CATCATGAGCCAGTGTCCCCAGG + Intronic
1166871329 19:45872774-45872796 GCCCCTGAGCCTGAGGCCCAGGG + Exonic
1167744637 19:51343315-51343337 CTCTCTGAGCCTAAGTCCCCTGG - Intergenic
1168148066 19:54430500-54430522 GGCCATGAGCCTGGGCCCCCAGG - Intronic
1202649717 1_KI270706v1_random:169447-169469 CCACAGAAGGCTGAGTCCCCTGG + Intergenic
925139911 2:1543036-1543058 ACACATGAGCCTCAGACCCCAGG + Intronic
925390427 2:3490443-3490465 CCCCATGAGCCTGGCGCCCCAGG + Intergenic
932471262 2:71960970-71960992 CCCCATATAACTGAGTCCCCTGG + Intergenic
932884789 2:75539903-75539925 GCCCAGGAGCCAGAGTCACCAGG + Intronic
933806676 2:86003299-86003321 CCTCATTGGCCTGATTCCCCAGG - Intergenic
934494775 2:94787806-94787828 CCACAGAAGGCTGAGTCCCCTGG + Intergenic
934504551 2:94880281-94880303 GCCCATGAGCCTCAGTCCAGCGG - Intergenic
934559740 2:95306963-95306985 CCCCAGCAGCCTGAGGGCCCAGG + Intronic
934772197 2:96914137-96914159 CCCCATGAGTATGAGCTCCCTGG - Intronic
938332104 2:130455158-130455180 CCACAGAAGGCTGAGTCCCCTGG + Intergenic
938434459 2:131274284-131274306 CCACAGAAGGCTGAGTCCCCTGG - Intronic
938434781 2:131276274-131276296 CCACAGAAGGCTGAGTCCCCTGG - Intronic
942924102 2:181411578-181411600 CTCCCTGGGCCTGAGCCCCCAGG + Intergenic
944500066 2:200350061-200350083 ACCCAAGAGGCTGAGACCCCAGG - Intronic
945439728 2:209864506-209864528 CCCCCTGGGCCTGAGACCCTGGG - Intronic
946699971 2:222402723-222402745 CTCCATTGGCCAGAGTCCCCTGG - Intergenic
948347955 2:237314935-237314957 CCCCCTCAGCCTCAGTCCCTTGG - Intergenic
949037038 2:241820734-241820756 CCACATGGGCCTCAGACCCCGGG + Intergenic
1169226711 20:3861478-3861500 ACCCAGGCGCCAGAGTCCCCAGG + Exonic
1170492054 20:16887000-16887022 CCCCATAATACTGAGTCCCTTGG + Intergenic
1170550830 20:17474616-17474638 CCCCATGAGCGTGGGGCTCCTGG + Intronic
1171155303 20:22866922-22866944 CCCCATAAGGCTGGGTCTCCAGG - Intergenic
1171166273 20:22974737-22974759 GCCCAGGTGCCTGAGTCCTCAGG + Intergenic
1171881651 20:30621820-30621842 CCACAGAAGGCTGAGTCCCCTGG - Intergenic
1172853382 20:37982718-37982740 CCCCATGAACCTGGCTTCCCTGG - Intergenic
1174215355 20:48912138-48912160 GCACCTGAGGCTGAGTCCCCAGG + Intergenic
1175791990 20:61745681-61745703 CCCCATGGGACAGGGTCCCCAGG - Intronic
1176049884 20:63113106-63113128 CACCTTGAGCCTGGCTCCCCTGG - Intergenic
1176602106 21:8803100-8803122 CCACAGAAGGCTGAGTCCCCTGG - Intergenic
1178485774 21:33019569-33019591 CCACATAAGCCAAAGTCCCCAGG - Intergenic
1178512649 21:33218665-33218687 CTCCATGCTCCTGGGTCCCCTGG + Intergenic
1179478384 21:41662343-41662365 CACCATGAGCCTGGGAGCCCTGG - Intergenic
1180094646 21:45550285-45550307 TCACATGAGACTGTGTCCCCAGG + Intergenic
1180344389 22:11694651-11694673 CCACAGAAGGCTGAGTCCCCTGG - Intergenic
1180929250 22:19577763-19577785 GCCCATGAGCCGCAGTCCCCAGG + Intergenic
1181486453 22:23234702-23234724 CCTGATCAGCCTGGGTCCCCTGG - Intronic
1181585717 22:23852512-23852534 CTCCCTGAGCCTCAGTCTCCTGG + Intergenic
1182275502 22:29185869-29185891 CCAAATGAGCCTGGGTCTCCCGG + Intergenic
1183356772 22:37363955-37363977 CCCCATGAGCCTCCTTCCCAAGG - Intergenic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184241546 22:43213493-43213515 CCCCATGAGCCTTTCTTCCCAGG - Intronic
1184691882 22:46121114-46121136 CCTCCTCAGCCTGGGTCCCCAGG - Intergenic
1185325901 22:50225721-50225743 CCCCACCAACCTGAGACCCCAGG + Intronic
949826248 3:8168703-8168725 CCTCTTGAGACTGTGTCCCCCGG - Intergenic
950118124 3:10464331-10464353 TCCCCTGGGCCTGTGTCCCCTGG - Intronic
950440662 3:13008418-13008440 TCCTTTGAGCCTGAATCCCCAGG + Intronic
952759216 3:36899029-36899051 CCCCATGAGCCTGAGTCCCCAGG + Intronic
952832059 3:37573481-37573503 CCACAGGAGCTAGAGTCCCCTGG + Intronic
952933424 3:38376808-38376830 CCCCATATCCCTGGGTCCCCTGG - Intronic
953070395 3:39514393-39514415 GGCCATGAGCCTGTGTCCCGAGG - Exonic
954071015 3:48142844-48142866 GCCCAAGAACCTGAGTACCCAGG + Intergenic
954372570 3:50176516-50176538 CCCCTTGAGACTTGGTCCCCAGG + Intronic
954708522 3:52493788-52493810 AGCCAGGAGCCTCAGTCCCCAGG + Intergenic
961529695 3:127533012-127533034 CCCCAGTAGCCTGAGTCACCAGG + Intergenic
961823055 3:129585059-129585081 CCCCATGAGCCTGGGGCCAGGGG + Intronic
962327922 3:134451167-134451189 CCCCATGGGCCAGAGTCCCTTGG + Intergenic
963168128 3:142225512-142225534 CCCAATGCTCCAGAGTCCCCGGG + Exonic
966152909 3:176884384-176884406 CCCCATGAGGCAGAGACCCCAGG - Intergenic
968460230 4:721082-721104 ACCCATGAGGCTGAGGACCCTGG + Intronic
968610291 4:1554005-1554027 CCCCATGACCCACAGCCCCCTGG + Intergenic
968643755 4:1728338-1728360 GGCCATGACCCTGAGTCCTCAGG + Exonic
968967282 4:3775543-3775565 CGCCCTGAGCCTGCGTCCTCTGG + Intergenic
972770636 4:42194017-42194039 TCTCATGTGCCGGAGTCCCCAGG + Intergenic
973264554 4:48198320-48198342 CCCCATGTGAGGGAGTCCCCAGG + Intronic
973365428 4:49204907-49204929 CCACAGAAGGCTGAGTCCCCTGG - Intergenic
973395164 4:49587547-49587569 CCACAGAAGGCTGAGTCCCCTGG + Intergenic
976334542 4:83870457-83870479 TCCCATGAGGCTCAGCCCCCAGG - Intergenic
978066177 4:104405512-104405534 CCCCCTAAGATTGAGTCCCCAGG + Intergenic
980397404 4:132232421-132232443 TCCCATGGGCCATAGTCCCCAGG + Intergenic
981104297 4:140863197-140863219 CCTCATTCGCCTGAGCCCCCAGG - Exonic
985824437 5:2181961-2181983 CCCCATGTGCCTGACGCTCCAGG - Intergenic
986051756 5:4096788-4096810 CCCCAAGAGCCTGTGGCCGCAGG + Intergenic
992106409 5:73451856-73451878 CCCCGTAAGTCTGAGCCCCCAGG - Intergenic
994186529 5:96821487-96821509 TCCCATCAGCCTGAATGCCCAGG - Intronic
997651633 5:135526164-135526186 ACCCAGCAGCCTCAGTCCCCAGG + Intergenic
998162719 5:139822514-139822536 CCCCAGGAGCCTGACCACCCTGG - Intronic
1000117355 5:158166125-158166147 TGCCATGATCCTGAGTCCCTCGG - Intergenic
1001281212 5:170387813-170387835 CCCCAACAGCCTGCTTCCCCAGG + Intronic
1001639027 5:173232469-173232491 CAACATGACCCTGAGTCCCCTGG - Exonic
1002904251 6:1436128-1436150 CTCCATGAACCTGACTCCTCTGG - Intergenic
1003321949 6:5059596-5059618 CCCCATCAGACTTTGTCCCCAGG + Intergenic
1003421640 6:5963571-5963593 CTAGATGAGCCTGAGTCCCAGGG - Intergenic
1006035087 6:31205106-31205128 CCCCATGAAACTGAGGCCCTAGG - Intergenic
1006364664 6:33608339-33608361 CCCACTCAGCCTGAGTCCCCGGG - Intergenic
1006378987 6:33687077-33687099 CCTCATCAGCCTGCGGCCCCAGG + Exonic
1008625792 6:53315194-53315216 CCCCATGTCCCCAAGTCCCCAGG - Intronic
1011261231 6:85471935-85471957 CCACATGACCCTGGGTCCTCAGG + Intronic
1011712219 6:90066342-90066364 CCCCATGACCCAGAGTCACATGG - Intronic
1018831692 6:167448516-167448538 CCCCATGAGCCAGGGTCCCCGGG + Intergenic
1019540251 7:1548065-1548087 CCCCCTGAACCTCAGTCTCCTGG - Intronic
1019603445 7:1896538-1896560 CCCCAGGATCCCGAGTTCCCAGG + Intronic
1019704111 7:2489385-2489407 CCCCATGAGCCAGAGGACACTGG + Intergenic
1019849939 7:3544855-3544877 CTCCATCAGCCTGAGTCCCTGGG - Intronic
1020210722 7:6156234-6156256 TCCCATGTGCCTGAGACACCTGG - Intronic
1029446450 7:100615459-100615481 CCCCAAGTGCCTGGGTCCCCTGG - Intergenic
1029450647 7:100640478-100640500 CCCTCAGAGCCTCAGTCCCCTGG + Intronic
1033227479 7:139573070-139573092 CCCCGTGAGCATGGGCCCCCGGG - Exonic
1033761752 7:144443081-144443103 CCTGGTGAGCCTGAGTCCACGGG + Intergenic
1034278950 7:149838516-149838538 CTCCGGGAGCCTGGGTCCCCGGG + Exonic
1034417221 7:150971500-150971522 CTCCATGTCCCTGTGTCCCCGGG - Intronic
1034650248 7:152684605-152684627 GCCCATGAGCCTGAGACGCAGGG - Intergenic
1035491722 7:159285019-159285041 CTCCATGGGCCTGAGCCCCTAGG + Intergenic
1035624213 8:1059445-1059467 CTCCATGAGACAGAGACCCCAGG + Intergenic
1035757742 8:2046666-2046688 CCCAATGCGCCTGAGCCCCAGGG + Intronic
1038546680 8:28431129-28431151 CCCCTTTCTCCTGAGTCCCCGGG + Intronic
1039303932 8:36240645-36240667 CCCCATGAACCATAGTTCCCAGG - Intergenic
1039402263 8:37279727-37279749 CCCCCTGGGCCTGATTCCCTAGG + Intergenic
1039685902 8:39801662-39801684 GTCCCTGAGCCTGAGCCCCCAGG - Intronic
1042565887 8:70111419-70111441 CCACATGAGCCTCAGCCCACGGG + Exonic
1043233354 8:77830415-77830437 CTCCCTGGGCCTGAGTCCCTAGG + Intergenic
1043403341 8:79905391-79905413 CTTTATGAGCCTGACTCCCCAGG - Intergenic
1049002438 8:139834561-139834583 CTCCATGACGCTGAGTCCTCAGG + Intronic
1049313229 8:141944877-141944899 TCCCATGAGGGTGAGTCCACTGG + Intergenic
1050109762 9:2202110-2202132 CCCCTTAAGACTGGGTCCCCTGG - Intergenic
1051003609 9:12315181-12315203 CTCCCAGAGCCTGAGTCCCTAGG - Intergenic
1051112356 9:13653665-13653687 CTCCATCAGCCTGAGTCCTTCGG - Intergenic
1051813715 9:21079621-21079643 CCCCATCAGCATTATTCCCCAGG - Intergenic
1052857361 9:33415612-33415634 CTCCTTTAGCCTGAGTCCACTGG + Intergenic
1053148095 9:35725546-35725568 CCTCGTGAGTCTGACTCCCCCGG - Exonic
1053498851 9:38568752-38568774 CCACAGAAGGCTGAGTCCCCTGG + Intronic
1053662342 9:40292553-40292575 CCACAGAAGGCTGAGTCCCCTGG - Intronic
1053912795 9:42922720-42922742 CCACAGAAGGCTGAGTCCCCTGG - Intergenic
1054374471 9:64438782-64438804 CCACAGAAGGCTGAGTCCCCTGG - Intergenic
1054522268 9:66083731-66083753 CCACAGAAGGCTGAGTCCCCTGG + Intergenic
1055660758 9:78501740-78501762 TTCCAAAAGCCTGAGTCCCCGGG - Intergenic
1056126261 9:83538514-83538536 CGCCCAGAGCCTGAGACCCCCGG + Intronic
1056132073 9:83597012-83597034 CCCCAGGTCTCTGAGTCCCCTGG - Intergenic
1056695510 9:88846859-88846881 CCTCATGTGCCAGAGTGCCCTGG + Intergenic
1056754325 9:89372660-89372682 CCCTATGATCCTGAGTCCTGGGG - Intronic
1057161896 9:92895050-92895072 CCACAGAAGGCTGAGTCCCCTGG + Intergenic
1057678301 9:97153243-97153265 CCACAGAAGGCTGAGTCCCCTGG + Intergenic
1057915491 9:99052229-99052251 CCCCAAAGCCCTGAGTCCCCAGG - Intronic
1057945865 9:99327634-99327656 TCCCAGGAGACTGAGGCCCCAGG + Intergenic
1059326413 9:113506515-113506537 TGCCATCAGCCTGAGGCCCCAGG - Intronic
1059598126 9:115745044-115745066 CAACATCAGCCTGAGTCTCCAGG + Intergenic
1060408591 9:123385060-123385082 TCCCATGGACCTGAGTCCCAGGG + Intronic
1060678381 9:125537945-125537967 CCCCATGGCCTTGAGTGCCCAGG + Intronic
1061533739 9:131234835-131234857 CCTCTGGAGCCAGAGTCCCCAGG - Intergenic
1062544599 9:137055792-137055814 GGCCATGAGCCTGTCTCCCCGGG - Intergenic
1062550186 9:137082549-137082571 CACCAAGAGCCACAGTCCCCAGG - Intronic
1186682171 X:11886580-11886602 ACCCATTAGCTTCAGTCCCCTGG - Intergenic
1189200515 X:39191849-39191871 CACCATGTCCCTGTGTCCCCAGG + Intergenic
1189291346 X:39888065-39888087 CCCCATCTGCCTGAGGCCCTGGG + Intergenic
1189571907 X:42306963-42306985 CCCCCTGGGCCTGAGCCCCTAGG + Intergenic
1190706169 X:53030043-53030065 CCCCTTGAGCCTGAGCAGCCAGG - Intergenic
1193533617 X:82686469-82686491 CTCAATGAGACTGAGTCCCTGGG - Intergenic
1194596744 X:95868112-95868134 CCCCTTGGGCCTGAGCCCCTAGG + Intergenic
1195639189 X:107155212-107155234 TCCCATGAGCCTGTGTCAGCTGG + Intronic
1195816520 X:108894575-108894597 AGCCATGAGCCTGAGTCTGCAGG - Intergenic
1198334059 X:135650211-135650233 CCCCATGAGACCGAGGCCCTAGG - Intergenic
1198807138 X:140503950-140503972 CGCCATGAGCCTGGGCCCCATGG - Exonic