ID: 952760342

View in Genome Browser
Species Human (GRCh38)
Location 3:36907978-36908000
Sequence CGCTGTGGCCACGGAGTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952760337_952760342 -1 Left 952760337 3:36907956-36907978 CCTTAGTGCCCGGCGGGGTGTGC 0: 1
1: 0
2: 0
3: 0
4: 66
Right 952760342 3:36907978-36908000 CGCTGTGGCCACGGAGTAAATGG 0: 1
1: 0
2: 0
3: 8
4: 59
952760340_952760342 -10 Left 952760340 3:36907965-36907987 CCGGCGGGGTGTGCGCTGTGGCC 0: 1
1: 0
2: 0
3: 9
4: 177
Right 952760342 3:36907978-36908000 CGCTGTGGCCACGGAGTAAATGG 0: 1
1: 0
2: 0
3: 8
4: 59
952760339_952760342 -9 Left 952760339 3:36907964-36907986 CCCGGCGGGGTGTGCGCTGTGGC 0: 1
1: 0
2: 0
3: 12
4: 190
Right 952760342 3:36907978-36908000 CGCTGTGGCCACGGAGTAAATGG 0: 1
1: 0
2: 0
3: 8
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952760342 Original CRISPR CGCTGTGGCCACGGAGTAAA TGG Intronic
902808937 1:18877455-18877477 CGCTGTGGCCGCAGATCAAAGGG - Exonic
902896694 1:19484878-19484900 GGCTGAGGCCACGGAGAAGAGGG + Intronic
909166578 1:72233927-72233949 AGCTGTGGCTACAGAGAAAAGGG - Intronic
913722004 1:121605842-121605864 CCCTGTGCACACAGAGTAAATGG + Intergenic
913741788 1:121853424-121853446 CCCTGTGCACACAGAGTAAATGG + Intergenic
1064472920 10:15655649-15655671 AGCTGTGTCCACAGATTAAATGG - Intronic
1077483895 11:2830173-2830195 GCCTGTGCCCACGGTGTAAAGGG - Intronic
1077547836 11:3183551-3183573 CTCTCTGGCCAGGGAGTAAAGGG + Intergenic
1082894784 11:58178568-58178590 AGTTGTGGTCACGGAGAAAAAGG + Intronic
1087158952 11:94930529-94930551 AGGTGTGGCCATGGAGTAAAGGG + Intergenic
1090832600 11:130429428-130429450 GGCTGTGGCAACGCAGTGAAAGG - Intergenic
1096001509 12:48134296-48134318 CGCTAGGTCCACGGAATAAATGG - Intronic
1103985193 12:124762260-124762282 CACTGTGGCCCCAGAGCAAAGGG + Intergenic
1106072484 13:26425933-26425955 AGCTGTGGCCCGGGAGAAAATGG + Intergenic
1106395772 13:29379517-29379539 CACTGTGGCCGTGGTGTAAAAGG + Intronic
1110443248 13:75548927-75548949 CACTGTGGCTGCAGAGTAAAGGG - Intronic
1121084305 14:91133774-91133796 CGGTGAGGACACGGAGTAACTGG - Intronic
1122534022 14:102449690-102449712 TGCTGTGGCCACCGAGTGAGTGG - Exonic
1135852864 16:25980447-25980469 CGCTGTGGTCAGGGAGTACAGGG - Intronic
1139532019 16:67547067-67547089 GGCTGTGGCCTGGGAGCAAAGGG + Intergenic
1141320753 16:83006559-83006581 GGCTGTGGACAAGGAGCAAATGG - Intronic
1142246062 16:88970595-88970617 CCCTGTGGCCCCGGAGGGAAGGG - Intronic
1146936126 17:36813659-36813681 TGCTGTGGCCACGGAGGGGAAGG - Intergenic
1148075350 17:44932483-44932505 TGCTGTGTCCAATGAGTAAATGG - Intronic
933278199 2:80304539-80304561 GGCTGTTTCCGCGGAGTAAAAGG - Exonic
935127626 2:100238523-100238545 GGCAGTGGCCAGGGAGAAAAAGG - Intergenic
944505789 2:200409105-200409127 GGCTGTGGCAATGAAGTAAAAGG + Intronic
1168912018 20:1455860-1455882 CACTGTGGCCCCTGAGGAAAGGG + Intronic
1172094760 20:32455196-32455218 CACTGTGGCCACAGGGTACATGG - Intronic
1176099673 20:63359202-63359224 CGCTGTGACCTCGGAGCAACAGG - Intronic
1179168966 21:38957973-38957995 GGCTGTGGGCATGGAGTAAATGG + Intergenic
949539300 3:5019941-5019963 AGCTGTGGCCAGAGAGGAAAGGG - Intergenic
952760342 3:36907978-36908000 CGCTGTGGCCACGGAGTAAATGG + Intronic
953239376 3:41135075-41135097 CTCAGTGGCCACGGTGGAAAAGG - Intergenic
953393573 3:42548691-42548713 CTCTGTGCCCAGGGAGTGAAAGG + Intronic
961144703 3:124584503-124584525 CGCTGTGGGCACGGGGCAAACGG - Intronic
962040038 3:131697380-131697402 TGCTGTGGCCACAGAATACATGG - Intronic
962417183 3:135193696-135193718 AGCTGTGGCTACAGATTAAAGGG + Intronic
969312882 4:6364323-6364345 CGCTGAGCCCAGGGAGCAAAGGG + Intronic
974826682 4:67140117-67140139 ATCTGTGGCCAAGAAGTAAAAGG + Intergenic
985912988 5:2897531-2897553 CGCTGTGGCTGCTGAGTACACGG + Intergenic
989571637 5:42951270-42951292 TGCTGCGGCCACTGAGAAAATGG + Intergenic
989584828 5:43066588-43066610 CGCTGCCGCCACCGAGAAAATGG + Intronic
989956342 5:50365221-50365243 CCCTGTGTACACAGAGTAAATGG - Intergenic
990553602 5:56909157-56909179 CTCTGGGGCCACGGAGAGAAGGG + Intergenic
1001173295 5:169442108-169442130 CACAGTGGCCAAGGAGCAAAAGG + Intergenic
1001914057 5:175544738-175544760 AGCTCTGACTACGGAGTAAATGG + Intergenic
1002629425 5:180560816-180560838 CGCTGAGGACACGGAGGACAGGG - Intronic
1006833085 6:36980762-36980784 AGCTGTGAACACGGAGAAAAAGG + Intronic
1010556887 6:77293264-77293286 AGCAGTGGCTACGGTGTAAAGGG - Intergenic
1018939493 6:168299752-168299774 CGCGGTGGCCCCGGAGCACATGG - Intronic
1019461773 7:1163003-1163025 GGCTGTGGCCACCGAGTGAACGG + Intergenic
1020140664 7:5609752-5609774 CACTGTGGCCCTGGAGGAAATGG - Intergenic
1022077742 7:26990091-26990113 CGATGTGGTCACTGAGTACAAGG + Intronic
1033963753 7:146947828-146947850 CGCTGTAGCCTCGAAGTAATAGG - Intronic
1038252908 8:25923018-25923040 CTCTGTGGCCTCTGAGTGAAGGG - Intronic
1040457450 8:47612890-47612912 CACTGCCGCCACGGAGGAAATGG + Intronic
1046988384 8:120417400-120417422 TTCTGTGGCCACTGGGTAAAAGG - Intronic
1048183644 8:132218883-132218905 CTCTGTGGCCAAGGAGAGAAGGG - Intronic
1048580886 8:135729112-135729134 GGCTGTGGGCAGGGAGGAAAGGG - Intergenic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1055404428 9:75959667-75959689 CTCTGTGGCCACGGCACAAATGG + Intronic
1187673388 X:21691155-21691177 TACTGTGGCTATGGAGTAAAGGG + Intergenic
1190100975 X:47522903-47522925 GGCTGTGGCCAGGCAGGAAAAGG - Intergenic
1196652687 X:118184686-118184708 CGGTGTGGCCACAGAGAAAAGGG + Intergenic
1196833048 X:119791346-119791368 CGCTGCGGCCGCGGATTCAAGGG - Intronic
1199936368 X:152577702-152577724 CTCTGTGGTCACAGAGTAGAGGG + Intergenic
1200037355 X:153340483-153340505 GGCTGAGGCCAAGGAGTCAATGG - Intronic