ID: 952762848

View in Genome Browser
Species Human (GRCh38)
Location 3:36930341-36930363
Sequence GACTCACTCATGTTGTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952762848_952762854 -10 Left 952762848 3:36930341-36930363 CCTGCCAACAACATGAGTGAGTC 0: 1
1: 0
2: 2
3: 19
4: 133
Right 952762854 3:36930354-36930376 TGAGTGAGTCTGGAAGCAGGGGG 0: 1
1: 0
2: 2
3: 34
4: 345
952762848_952762856 13 Left 952762848 3:36930341-36930363 CCTGCCAACAACATGAGTGAGTC 0: 1
1: 0
2: 2
3: 19
4: 133
Right 952762856 3:36930377-36930399 TCTTTGCAGACTTTCCCGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 83
952762848_952762855 9 Left 952762848 3:36930341-36930363 CCTGCCAACAACATGAGTGAGTC 0: 1
1: 0
2: 2
3: 19
4: 133
Right 952762855 3:36930373-36930395 GGGGTCTTTGCAGACTTTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952762848 Original CRISPR GACTCACTCATGTTGTTGGC AGG (reversed) Intronic
901637493 1:10677087-10677109 GACTCACTCATCTTGGAGGCGGG - Intronic
903170653 1:21550830-21550852 GATTCATTCATGTTGTTGTGAGG + Intronic
903419806 1:23210517-23210539 GACTCCCTCATGATGCTGACAGG + Intergenic
905247240 1:36623721-36623743 GCCTCACACATGTGGTGGGCAGG + Intergenic
905434875 1:37949325-37949347 AACTCACTGATCTTGTGGGCAGG - Intergenic
905470601 1:38188830-38188852 AGCTCACTCAGATTGTTGGCAGG + Intergenic
907170148 1:52455576-52455598 GTCTCACTCCTGTTGCTGCCCGG - Intronic
908903694 1:68984543-68984565 GGCTCATTCAGGCTGTTGGCTGG + Intergenic
909876006 1:80804408-80804430 AAATCACTCATGTTATTGGAGGG - Intergenic
912264949 1:108148026-108148048 AGCTCACTCATGTTGCTGCCAGG - Intronic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
917145332 1:171884632-171884654 GACTCACTCATATGGTTGGCTGG + Intronic
921971297 1:221152143-221152165 GAGTCACTCATATTGTTAGAGGG + Intergenic
924186177 1:241493822-241493844 GTCTCACTCATTCTGTTGCCTGG + Intergenic
1064462618 10:15550020-15550042 GACTCCCACATGTTGTGGGTGGG + Intronic
1066258669 10:33706922-33706944 GACTCAGTCATGAAGTTGGCTGG + Intergenic
1072281483 10:93869706-93869728 GGCTCACTCATGTGGCTGGTGGG - Intergenic
1072624363 10:97101526-97101548 GACTCACGCAGCTTGTTAGCTGG + Intronic
1072846368 10:98835648-98835670 GACTCATTCCTGTACTTGGCAGG - Intronic
1073737074 10:106361124-106361146 AACTTACTCATGTAGTTGGCAGG + Intergenic
1075017145 10:118918198-118918220 GCCTCACTCAAGTTGCAGGCTGG - Intergenic
1078672434 11:13377057-13377079 CACTAACTCCTGTGGTTGGCAGG + Intronic
1079132284 11:17754044-17754066 GCATCACTCATGTTCATGGCTGG + Intronic
1080930044 11:36800401-36800423 AGCTCACTCATCTTGTTGGCAGG - Intergenic
1081635016 11:44715342-44715364 GATTCCCACATGTTGTGGGCAGG - Intergenic
1084880855 11:72170521-72170543 AATTCACTCATGTTGTGGGAGGG + Intergenic
1084977360 11:72809436-72809458 GGCTCACTCATTTGGCTGGCAGG - Intergenic
1085651658 11:78273774-78273796 GATTCCCACATGTTGTTGGAAGG + Intronic
1090750400 11:129741860-129741882 AACTTTCTGATGTTGTTGGCAGG - Intergenic
1096865103 12:54557972-54557994 GACTCATTTGTGTTCTTGGCTGG + Intronic
1102817284 12:115877314-115877336 AGCTCACTTATGTTGTTGGCAGG + Intergenic
1103546336 12:121704284-121704306 GACTCACCCATGTTGAGGCCAGG - Intergenic
1103638150 12:122326230-122326252 GTCTCACTGATTTTGTTGGTTGG - Intronic
1104129789 12:125882305-125882327 GACTCACTTGTGTGCTTGGCAGG - Intergenic
1105988853 13:25597599-25597621 GCCTTCCTCAGGTTGTTGGCAGG - Intronic
1106664229 13:31835007-31835029 GTCTCACTCTGGTTATTGGCTGG + Intergenic
1106711122 13:32334230-32334252 AACTGTCTCAAGTTGTTGGCTGG - Intronic
1115385187 14:32788930-32788952 GACTCCAGCCTGTTGTTGGCTGG - Intronic
1117628058 14:57660758-57660780 GACCCACTCATGTTGGTGAGAGG - Intronic
1117628638 14:57666448-57666470 AACTCATTCAGGTTGTTGGCAGG - Intronic
1119210257 14:72826098-72826120 AACTCTTTCAAGTTGTTGGCAGG - Intronic
1129191858 15:73942048-73942070 GCCTCCCTCAGGTTGGTGGCCGG + Intronic
1129889401 15:79061179-79061201 GGCTCGTTCTTGTTGTTGGCAGG - Intronic
1137890124 16:52151794-52151816 GACTCATTCATATTGTTGCATGG - Intergenic
1138653941 16:58479558-58479580 CACACACTCATGCTGCTGGCTGG - Intronic
1138726033 16:59140285-59140307 AACTCTTTCATGTTGTTGGTAGG - Intergenic
1140956090 16:79867447-79867469 GATCCACTCAAGCTGTTGGCTGG + Intergenic
1141404374 16:83778933-83778955 TATTCACACATGTTGGTGGCAGG - Intronic
1143666218 17:8362702-8362724 GGCTCACTCACATGGTTGGCAGG + Intergenic
1145953142 17:28836012-28836034 GTCTCCCTCTTGTTGTTGCCCGG + Intronic
1150968135 17:69995437-69995459 AACCGACTCAGGTTGTTGGCAGG + Intergenic
1151785550 17:76273287-76273309 GACTCACTAAAGGTCTTGGCAGG - Intergenic
1153063694 18:1020909-1020931 AACTCACACATATTTTTGGCAGG + Intergenic
1154311922 18:13273625-13273647 GACTCACTCCAGCTGGTGGCTGG - Intronic
1157665334 18:49481441-49481463 GGCTCACTCATATGGCTGGCTGG - Exonic
1158882092 18:61789925-61789947 GACTCACTCATACTTTTGGCTGG - Intergenic
1164172404 19:22736689-22736711 AAATCACTCATGTGGTGGGCAGG + Intergenic
1167419625 19:49395277-49395299 GACTCACCCATGTAGTTGACAGG - Exonic
926613854 2:14975100-14975122 GGTTCATTCAGGTTGTTGGCAGG - Intergenic
928359810 2:30654117-30654139 GCCTCAGTCATGTGGCTGGCAGG + Intergenic
930545694 2:52764801-52764823 CAAACACTAATGTTGTTGGCTGG + Intergenic
931128573 2:59305357-59305379 AACTCACTCATGTGGTTGTTGGG + Intergenic
931557537 2:63521169-63521191 GATTCTGTCATGTTGTTAGCTGG - Intronic
932444179 2:71763495-71763517 CACTCATTCATGTGGTTGGCAGG + Intergenic
932544764 2:72696730-72696752 GAATCACTCATGTTCCTGGCTGG - Intronic
932665632 2:73696272-73696294 GACTCACTCTTGGTGGTGGTGGG + Intergenic
933254701 2:80067858-80067880 GGCTCACTCACATGGTTGGCTGG - Intronic
933608087 2:84405241-84405263 AGCTCACTCAGATTGTTGGCAGG - Intergenic
936428202 2:112436809-112436831 GACTCAGTCAGGGTCTTGGCAGG + Intergenic
938624645 2:133094972-133094994 AGCTCATTCATATTGTTGGCAGG - Intronic
942487871 2:176458168-176458190 GACTCACTCATATTGTTCCTTGG - Intergenic
942605831 2:177689697-177689719 CATTCACTCAGGTTCTTGGCAGG - Intronic
943206672 2:184907035-184907057 AGCTTACTCATGTTGTTGGCAGG - Intronic
943988789 2:194659090-194659112 AGCTCATTCATGTTGTTGGCAGG - Intergenic
1169694038 20:8367270-8367292 TACTCACTCATGTTGTTATAAGG - Intronic
1170554792 20:17506202-17506224 GTCTCATTCAAGTTCTTGGCAGG - Intronic
1172768965 20:37366678-37366700 GATTCACTCATGTTGTAGCATGG + Intronic
1173685930 20:44923686-44923708 CACTTACTCATGTTGGTGCCAGG - Intronic
1174492992 20:50916223-50916245 GATTCACACATGTTGATGGAAGG - Intronic
1174839715 20:53890454-53890476 GATTCATTCATGTTGTTGCATGG - Intergenic
1174880758 20:54277013-54277035 AACTCAGTCATGTGGTTGGTAGG - Intergenic
1176374049 21:6078402-6078424 GACTCAGTCAGGGTCTTGGCAGG - Intergenic
1177270251 21:18839100-18839122 GATTCTGTCATGTTGTTAGCTGG + Intergenic
1179446194 21:41432483-41432505 GACTGAATCATGATGTGGGCAGG - Intronic
1179749428 21:43459841-43459863 GACTCAGTCAGGGTCTTGGCAGG + Intergenic
950892055 3:16412895-16412917 GCCTCCCTCAGTTTGTTGGCAGG - Intronic
950960995 3:17107492-17107514 GAGTCACTCATGTTTGTTGCAGG - Intergenic
951137538 3:19121117-19121139 GATTCACTGATGTTTTTGGAGGG - Intergenic
952762848 3:36930341-36930363 GACTCACTCATGTTGTTGGCAGG - Intronic
954910285 3:54100314-54100336 GATTCATTCATGTTGTTTGTTGG + Intergenic
956040755 3:65142733-65142755 GACTTGCTCAGGTTGTTGGAAGG - Intergenic
956767914 3:72499816-72499838 GGCTCACTCATATGGCTGGCAGG + Intergenic
962305093 3:134278999-134279021 GACTCACTCATCTGCATGGCTGG - Intergenic
965902071 3:173653976-173653998 GACTCACTCATGTGGCTATCCGG - Intronic
968681934 4:1927099-1927121 CTCTCACTCATGCTGCTGGCAGG + Intronic
968771512 4:2510563-2510585 GACACACTCATGCTACTGGCAGG - Intronic
969809679 4:9638377-9638399 AATGCACTCATGTTGTTGGTTGG - Intergenic
972434148 4:39015741-39015763 AACTCCCTCATGTTGTGGGAGGG + Intronic
974554805 4:63432303-63432325 GTTTCACTCATGTTGTTACCTGG - Intergenic
974846165 4:67353001-67353023 GATTCCCTCATGTTGTGGGAGGG - Intergenic
975367186 4:73543823-73543845 GCCTGGCTCATGATGTTGGCTGG + Intergenic
975742920 4:77447871-77447893 GGCTCACTCTGGTGGTTGGCTGG + Intergenic
976375062 4:84337102-84337124 GACTCTGTCCTGTTGTTAGCTGG + Intergenic
978937552 4:114396462-114396484 CACTCACTCAAGTTGTTGTCAGG - Intergenic
984054517 4:174910378-174910400 GCCTCCCTCATGGTGCTGGCTGG + Intronic
986821203 5:11468785-11468807 GACTCACTCATCTTGTCACCTGG + Intronic
986866142 5:11990107-11990129 GACACACTCAGGTTGAAGGCTGG + Intergenic
987180730 5:15365380-15365402 AACTCACTCATTTTCTTTGCAGG - Intergenic
988722620 5:33893022-33893044 GATTAACACATGTGGTTGGCTGG - Intergenic
989554300 5:42774359-42774381 AATTCCCTCATGTTGTTGGCTGG + Intronic
990907564 5:60820188-60820210 AGCTCATTCAGGTTGTTGGCAGG - Intronic
991145493 5:63297884-63297906 GGCTCATTCAGGTTGTTGGCAGG - Intergenic
994911221 5:105910764-105910786 GACACAAGCATGGTGTTGGCCGG - Intergenic
995727838 5:115201423-115201445 GACTCACTTTTGGTTTTGGCAGG - Intergenic
996607753 5:125344048-125344070 GGCTCATTCAAGTTGTTGGCAGG - Intergenic
996876458 5:128245831-128245853 GACTAAATCAAGGTGTTGGCAGG + Intergenic
997381735 5:133443411-133443433 AACTCATTCATGGTGTTGGGAGG + Intronic
997962739 5:138335066-138335088 GACTCATACATGTTGTTGCCAGG + Intronic
998082576 5:139289076-139289098 GCTTCCCTCATGATGTTGGCCGG - Intronic
999824076 5:155257675-155257697 GCCTCACTCCTGTTGCTGGAGGG + Intergenic
1001947513 5:175792554-175792576 GATTCATCCATGTTGTTGCCTGG - Intergenic
1006479682 6:34281888-34281910 AACTCCCTCATGTTCTTGGGAGG + Exonic
1007085808 6:39144180-39144202 AATTCCCACATGTTGTTGGCAGG - Intergenic
1011166875 6:84458442-84458464 GACTCACTCCTGTTTTCTGCAGG + Intergenic
1012044444 6:94252097-94252119 GGCTCACTCACATAGTTGGCAGG - Intergenic
1012230241 6:96752290-96752312 GAGTCCCTCATGGTGATGGCAGG - Intergenic
1013690946 6:112642547-112642569 GATTCACGCATGTTGTTGCATGG + Intergenic
1013737716 6:113247448-113247470 GGTTCACTCATGTGGCTGGCAGG + Intergenic
1017147999 6:151251970-151251992 GTCTCACTCACGCTGTTGCCCGG - Intronic
1017181701 6:151559306-151559328 GAATAATTAATGTTGTTGGCTGG - Intronic
1017647409 6:156551797-156551819 GGCTCATTCAGGTTGTTGGCAGG - Intergenic
1018862108 6:167718637-167718659 GATTCCCTCATGTTGTGGGAGGG + Intergenic
1020676117 7:11186784-11186806 AACTCACTCAGGTTGTCAGCAGG - Intergenic
1022115199 7:27254820-27254842 GGCTCACTCATGTGGTTGTTTGG + Intergenic
1022138512 7:27471886-27471908 GACTGGCTCATTTAGTTGGCTGG + Intergenic
1022716322 7:32901847-32901869 AACTCGCTCAAGTTGTTGGTTGG - Intergenic
1032475537 7:132209117-132209139 GACTAACTCATGCTGTTGTCTGG + Intronic
1035832163 8:2708250-2708272 GACCCATTCATGATGATGGCAGG - Intergenic
1036616953 8:10395594-10395616 GACTCATTCATGATGCTGCCTGG - Intronic
1036718422 8:11148862-11148884 GATTCATTCATGTTGTTGTGTGG - Intronic
1038874377 8:31532119-31532141 GACAGAGTCTTGTTGTTGGCTGG + Intergenic
1039681619 8:39744463-39744485 AACTCACTCATGTCCTTTGCAGG + Intronic
1040092170 8:43409405-43409427 GACTCACTGCTTTTCTTGGCTGG + Intergenic
1040400457 8:47044972-47044994 GACTCACTGCTTTTCTTGGCTGG - Intergenic
1057573536 9:96221386-96221408 GAATCACCCATGTTGTTGGCCGG - Intergenic
1059399057 9:114057383-114057405 CACTCACTCACCTTGATGGCAGG - Intergenic
1061759189 9:132838200-132838222 TACTGACTCATGTTATGGGCAGG + Intronic
1187021898 X:15392130-15392152 GGGTCACTCATGTGGCTGGCAGG - Intronic
1187606321 X:20887173-20887195 GAATCACTCATGTTATTGCATGG + Intergenic
1188970627 X:36611332-36611354 GACTCACACAGGTTGGTAGCCGG - Intergenic
1191162031 X:57340120-57340142 GACTCACACAAGTGGTTTGCCGG - Intronic
1199432945 X:147781235-147781257 GGCTCATTTAGGTTGTTGGCAGG + Intergenic
1201352664 Y:13061919-13061941 GATTCATTCATGTTGCTTGCTGG - Intergenic
1201437672 Y:13977030-13977052 AACTCTCCCATGTTGTTGGTGGG + Intergenic
1201949199 Y:19545066-19545088 GTCACACTCATATGGTTGGCTGG + Intergenic