ID: 952764577

View in Genome Browser
Species Human (GRCh38)
Location 3:36943859-36943881
Sequence TTTAAGAAGCAGAAAGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1202
Summary {0: 1, 1: 0, 2: 12, 3: 117, 4: 1072}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952764577_952764579 30 Left 952764577 3:36943859-36943881 CCATTCTCTTTCTGCTTCTTAAA 0: 1
1: 0
2: 12
3: 117
4: 1072
Right 952764579 3:36943912-36943934 ACTTCCATAAAAATTTTCCTAGG 0: 1
1: 0
2: 0
3: 46
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952764577 Original CRISPR TTTAAGAAGCAGAAAGAGAA TGG (reversed) Intronic
900500131 1:3000305-3000327 TTTGGGAAGCAGAGAAAGAAGGG - Intergenic
900568943 1:3348936-3348958 TTTGAGAGGCATTAAGAGAAGGG + Intronic
900762826 1:4484221-4484243 TTAAAGAAGGAGAAGGAAAAGGG - Intergenic
900926487 1:5709420-5709442 GGCAAGAAGCAGCAAGAGAAGGG - Intergenic
901932132 1:12602559-12602581 TCTAATATGCAGAAGGAGAAGGG + Intronic
903003412 1:20282494-20282516 TTTAAAAAGCTGGAAGAGCACGG + Intergenic
903210181 1:21813824-21813846 TTTCAAAAGCAGGAAGAAAAGGG + Intronic
903713119 1:25341046-25341068 TTTAAAAAGCAAAAACAAAAAGG + Intronic
903954900 1:27018597-27018619 TGTAGGAAGCTGAGAGAGAAGGG + Intergenic
904432414 1:30472976-30472998 CTGAAGGAGCAGAAAGGGAAGGG - Intergenic
904597053 1:31653529-31653551 TAGAAGAAACAGAAAGAAAAGGG + Intronic
904709765 1:32421118-32421140 TGGAAGAAGCAGAAAGGGATGGG + Intergenic
904944585 1:34189938-34189960 TGGAAGAAGGAGAAAGAGCAAGG - Intronic
904973759 1:34440270-34440292 TCTAAGAAGGAGGAAGACAAAGG + Intergenic
905849911 1:41265976-41265998 TTTACCCAGCAGAAAGAGCATGG + Intergenic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
906437300 1:45807213-45807235 TTAGAGAAGCAGTAACAGAATGG - Intronic
906542021 1:46594282-46594304 TTGAAAAAGCAGAAATAGAAAGG + Intronic
906588815 1:47004400-47004422 TGTATGAAGCAGAAAGGAAAAGG - Intergenic
906863614 1:49390884-49390906 TTTAAGGAGCTCATAGAGAATGG + Intronic
906975682 1:50569955-50569977 TTAAAAAAGAAGAAAGAGACAGG + Intronic
907510667 1:54955990-54956012 TGTATGGAGCAGAAAGAAAAGGG - Intergenic
907687460 1:56626036-56626058 ATAAAGAAGCAGAAGGACAAAGG + Intronic
907911790 1:58833671-58833693 TTTGTGGAGCAGAAAAAGAAAGG + Intergenic
908437933 1:64125072-64125094 TTTAAGATGAATAAAGTGAAGGG + Intronic
908496146 1:64696882-64696904 TTTTGGAAGCAGAAAGAATAGGG + Intergenic
908710497 1:67008902-67008924 TTTAAGAAGCAGGGAGAGGTTGG - Intronic
908885346 1:68781923-68781945 TTTATTAAGCAGCATGAGAACGG + Intergenic
908934928 1:69363316-69363338 TGTATGAAGCAGAAAGAAAAAGG + Intergenic
908997261 1:70170221-70170243 CTCAAAAACCAGAAAGAGAAGGG + Intronic
909078791 1:71084769-71084791 TATAATAAGAATAAAGAGAATGG - Intergenic
909305567 1:74071684-74071706 CTTATGAAGAAGAAAAAGAAAGG + Intronic
909548207 1:76869558-76869580 TTTATAAAGCAGATAGAGAGTGG - Intronic
910199434 1:84683480-84683502 TTCTAGAAGCACAGAGAGAAGGG - Intronic
910287421 1:85571170-85571192 TTTCAGAAGGGGAAAGAGAAGGG - Intronic
910501768 1:87900590-87900612 ATGAAGAAGGAGAAAGAGATGGG - Intergenic
911263418 1:95714731-95714753 TTTAAAAAGTAAAAAGAAAAAGG + Intergenic
911483872 1:98480929-98480951 TTTAACTAGGAGAAAAAGAAGGG + Intergenic
911853185 1:102844001-102844023 TCCAAGAAGCAGCAAGAGAATGG + Intergenic
911931287 1:103907272-103907294 TTTAAGAATAAAAATGAGAAGGG - Intergenic
912972397 1:114296050-114296072 TTTACAAAACAGAAAGATAAGGG + Intergenic
914705040 1:150163272-150163294 GTAAGAAAGCAGAAAGAGAAAGG - Intronic
915199810 1:154219113-154219135 CTAAAGAAGCAGAATGAGAGTGG + Intronic
915454419 1:156030057-156030079 ATAATGAAGAAGAAAGAGAATGG + Intergenic
915641453 1:157230309-157230331 CTCAAGAAGAAGAAAAAGAAAGG + Intergenic
916105195 1:161424539-161424561 TTTAGGAGGAAGAAAGAAAAAGG - Intergenic
916396189 1:164390041-164390063 TTTATGATGCAGAAAAAGAGAGG - Intergenic
916483890 1:165240518-165240540 TTTTAGTTGCAGAAAAAGAAAGG - Intronic
916517233 1:165530887-165530909 TGGAAGAAACAGAAAGAGTATGG + Intergenic
916581137 1:166110270-166110292 ATTAAAAAAAAGAAAGAGAATGG + Intronic
916960695 1:169885650-169885672 AATAAAATGCAGAAAGAGAAAGG + Intronic
916991762 1:170251895-170251917 TTTATGAAGAAGAAAGAACATGG - Intergenic
917090937 1:171352534-171352556 TACAAGATGCAGAGAGAGAAAGG - Intergenic
917261112 1:173171174-173171196 TAGAAGGAGCAGACAGAGAAAGG - Intergenic
917334870 1:173916505-173916527 CTGAAGAAGCAGAGAGAGAGAGG + Intronic
917434262 1:175002839-175002861 TTTATCTAGCAGAATGAGAAAGG - Intronic
917615392 1:176738309-176738331 TTAAAGAAGGAGAGAAAGAAGGG + Intronic
917818988 1:178741839-178741861 TTTAAGAAGCAGAAATGGGCTGG + Intronic
918325511 1:183406292-183406314 CTTGTGAAGCCGAAAGAGAAGGG + Intronic
919156500 1:193772711-193772733 TGAAGGAAGCAGGAAGAGAAGGG + Intergenic
919178457 1:194050384-194050406 TTTCAGAAGAAAAAAGAGAAGGG + Intergenic
919233204 1:194802873-194802895 AATATGAAGAAGAAAGAGAAAGG + Intergenic
919345877 1:196377647-196377669 CTTTGCAAGCAGAAAGAGAAGGG + Intronic
919481639 1:198097213-198097235 AGTAAGAAGCTGAAAGACAAAGG + Intergenic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
920070411 1:203298577-203298599 TTTTTAAAGCAGAAAAAGAAGGG + Intergenic
920363317 1:205434476-205434498 TTTAAGAAAGAGAAAGAGCCAGG - Intronic
920965632 1:210698521-210698543 AATAAGAAACAGCAAGAGAAAGG + Intronic
921482885 1:215683711-215683733 GTGAATAAGAAGAAAGAGAAAGG - Intronic
921518555 1:216129294-216129316 TTAAAAAAGCAAAAACAGAATGG - Intronic
921545716 1:216472733-216472755 TGTAAGAGTGAGAAAGAGAAAGG - Intergenic
922095495 1:222439800-222439822 TTGAAAAAGCAGAAAGTGAAAGG + Intergenic
922483251 1:225954114-225954136 TTTAAAAAACAGCAAGAGAAGGG - Intergenic
923226253 1:231941339-231941361 TTTATAAAGCAGAAAAAGGAAGG - Intronic
923352710 1:233125314-233125336 TTTAAGAAGCAGGTAGAGGAAGG - Intronic
923580827 1:235210839-235210861 TTTAAATAGCAGGAAGGGAAAGG - Intronic
923918403 1:238535561-238535583 TTTAAGAATTAGAAAAAAAAGGG - Intergenic
924062011 1:240184950-240184972 TATAGGAGGGAGAAAGAGAAGGG - Intronic
924062018 1:240184978-240185000 TATAGGAGGGAGAAAGAGAAGGG - Intronic
924062025 1:240185006-240185028 TATAGGAGGGAGAAAGAGAAGGG - Intronic
924062033 1:240185035-240185057 TATAGGAGGGAGAAAGAGAAGGG - Intronic
924062040 1:240185063-240185085 TATAGGAGGGAGAAAGAGAAGGG - Intronic
924062048 1:240185092-240185114 TATAGGAGGGAGAAAGAGAAGGG - Intronic
924062056 1:240185121-240185143 TATAGGAGGGAGAAAGAGAAGGG - Intronic
924062063 1:240185149-240185171 TGTAGGAGGGAGAAAGAGAAGGG - Intronic
924062070 1:240185178-240185200 TATAGGAGGGAGAAAGAGAAGGG - Intronic
924100284 1:240595867-240595889 TTTTAGAGGCAGACAGAAAAAGG + Intronic
924177119 1:241402548-241402570 TTTACGGAGCAGAAACAAAATGG - Intergenic
924506219 1:244687233-244687255 TTTAATAAGGAGAATGAAAAGGG - Intronic
924526993 1:244862331-244862353 TTTTAAAAGCAGGAAGATAATGG - Intronic
924675742 1:246176020-246176042 ATTCAAAAGCAGAAAGATAATGG + Intronic
1063228446 10:4039682-4039704 AATAAGAAGAAGAAAGAGGAGGG - Intergenic
1063422351 10:5923423-5923445 TTCATGAAGCAGAAAGCGCAAGG - Intronic
1063745220 10:8871644-8871666 CTTAAAATGGAGAAAGAGAACGG + Intergenic
1064076222 10:12270926-12270948 CTTAAGAAGCAGAAGTAGAGAGG - Intergenic
1064111764 10:12545828-12545850 TTTGCCAAGCAGAAAGAAAAAGG + Intronic
1064363616 10:14687705-14687727 TTTTAGAGGCAGAAATGGAATGG - Intronic
1064391873 10:14949444-14949466 TTTAAGTGGCAGAAAGTGAATGG - Intronic
1064464945 10:15569548-15569570 AGTAAGAAGCAGACAGAGGATGG - Intronic
1064882976 10:20077938-20077960 TCAAAGAAGAAGAAAAAGAAGGG - Intronic
1065044930 10:21738659-21738681 GTTAAGATGAAGAATGAGAAGGG - Intronic
1065460275 10:25954961-25954983 TTTAAGAAGGATAAAGTAAATGG + Exonic
1066162596 10:32750152-32750174 TTTAAAAAGCAAGATGAGAAAGG - Intronic
1066345732 10:34584239-34584261 TTTAGGAAGCAGTAAGGGATAGG - Intronic
1066424023 10:35289362-35289384 AGTAAGAAGAAGAAAAAGAAAGG - Intronic
1066526201 10:36282679-36282701 TTTAAGAGTCAGAAAGAGTAGGG - Intergenic
1066627940 10:37428347-37428369 AAGAAGAAGAAGAAAGAGAAAGG + Intergenic
1066976047 10:42368448-42368470 TTTAAAAAGTAGAAAGAAATAGG + Intergenic
1067211974 10:44266897-44266919 TTTAGAAAGAGGAAAGAGAAAGG + Intergenic
1067361407 10:45583194-45583216 TTTAAGATACAGAAAAATAAGGG + Intronic
1067408829 10:46047169-46047191 TGTAAGAGGCAGCAAGAGCATGG - Intergenic
1067841910 10:49687909-49687931 TTTAAGAAGGAGAAATGGCAGGG + Intronic
1068066772 10:52141797-52141819 TTTAAGAAGGAGAAGTAAAAGGG + Intronic
1068168778 10:53365891-53365913 TTTGAGAAGCAGAATGGGAATGG + Intergenic
1068221769 10:54054322-54054344 TTTAAGGAGCAAACAGATAAGGG + Intronic
1068268546 10:54687783-54687805 TTAAAGGAGCAGAGAGAGATTGG - Intronic
1068324571 10:55467564-55467586 TTTAAGTTCCAGTAAGAGAATGG + Intronic
1068684669 10:59857552-59857574 ATTAAGCATAAGAAAGAGAACGG + Intronic
1069053722 10:63821795-63821817 TGTGAGAAGCAGAAAGAGGCAGG - Intergenic
1069659153 10:70112225-70112247 TTTAAGAAAAAGAAAATGAAAGG + Exonic
1070074512 10:73122153-73122175 TCTAAGAAACAGAAAGGGGAAGG - Exonic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1071187486 10:83060973-83060995 TTTAAGACACAGAAAGAGGGTGG - Intergenic
1071539997 10:86473083-86473105 TTTCATAAGCAGAAAGGGACAGG + Intronic
1071577560 10:86740533-86740555 TTAAACAAGCAGAAGGAAAAAGG - Intergenic
1072033470 10:91542823-91542845 TTTAAGAAGCAGAATGTGGCCGG + Intergenic
1072429331 10:95356842-95356864 TTAAAGAACCAGAAACACAAAGG + Intronic
1072512471 10:96141353-96141375 TATAAGAAGCAGAATTTGAAAGG + Intronic
1072649028 10:97279017-97279039 TTGAAAAAGCAGTAAGAGAGAGG - Intronic
1072825749 10:98604526-98604548 TAGAAGGAGAAGAAAGAGAAAGG + Intronic
1073388098 10:103144772-103144794 TTTAGGGAGCAGAAAGAGCTAGG + Intronic
1073464848 10:103688645-103688667 TTTAAGGAGCAGAAGGTGACTGG + Intronic
1073575424 10:104618789-104618811 TTTCTGAAGCACAATGAGAATGG - Intergenic
1073637076 10:105210179-105210201 TACAGGAAGCAGAAAAAGAAAGG + Intronic
1073667059 10:105545377-105545399 GTGAAGAACCAGAAAGAAAATGG - Intergenic
1073685199 10:105745058-105745080 TTGAAGAATGAGAGAGAGAAGGG + Intergenic
1073737956 10:106371607-106371629 TCTAAGCAGCAGAAATACAATGG + Intergenic
1073889292 10:108080290-108080312 ATTAAGTAGCACACAGAGAAAGG + Intergenic
1073949334 10:108787798-108787820 TTTAGGAAGAAGAAAGAGAAAGG - Intergenic
1074089457 10:110235050-110235072 TCTAAGAAGCAGAAATTGGATGG - Intronic
1074415386 10:113262858-113262880 TTTCAGCAGCACAAGGAGAATGG + Intergenic
1074671878 10:115800431-115800453 GGAAAGAAACAGAAAGAGAAGGG + Intronic
1074723367 10:116283241-116283263 TTCTAGAAGCAGAGATAGAAAGG + Intergenic
1074735661 10:116430026-116430048 GTAAAGCAGGAGAAAGAGAAGGG + Intronic
1074863006 10:117527069-117527091 CTTAGGAAACAGACAGAGAAAGG + Intergenic
1074889903 10:117726833-117726855 TTTATGAAGCAAAAAGAGCTGGG - Intergenic
1075246488 10:120827053-120827075 TTGAAGAAGAAGAAAAAAAAAGG + Intergenic
1075762969 10:124870629-124870651 TTTAACAAAAAGAAAGAGACTGG + Intergenic
1075875545 10:125803070-125803092 TTTTAGAAGCACACAGAGCAAGG + Intronic
1075964014 10:126594794-126594816 TTCAAAAGACAGAAAGAGAAGGG + Intronic
1076309192 10:129491957-129491979 TTTAATAATAATAAAGAGAAGGG - Intronic
1076413779 10:130270714-130270736 CTTAAGATGCAGGAAGGGAAAGG + Intergenic
1076757574 10:132580620-132580642 TTTAAGAATCAAAAATAAAAGGG - Intronic
1076765090 10:132628854-132628876 TTTAAAAAGCAAAAAGAAATAGG + Intronic
1077128904 11:959443-959465 GTAAAGAAGCAGAAATAAAAAGG + Exonic
1077792027 11:5451328-5451350 TAAAAGTAACAGAAAGAGAAGGG - Intronic
1078277494 11:9864060-9864082 TAGCAGGAGCAGAAAGAGAATGG + Intronic
1078313486 11:10270695-10270717 TTTAAGAAGTAAAATGAGGACGG + Intronic
1079119099 11:17666941-17666963 CTTAAAAAACAGAAAAAGAAGGG + Intergenic
1079414776 11:20223562-20223584 TGTAATAAGCAGAAAGACAAGGG - Intergenic
1079422633 11:20308312-20308334 ATAAAGAAACAGACAGAGAAAGG + Intergenic
1079687070 11:23372808-23372830 AATGAGAAGAAGAAAGAGAAGGG + Intergenic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1079950116 11:26791388-26791410 TCTAAGTAGCAGAAAGAAAATGG + Intergenic
1080103632 11:28488701-28488723 TTAAAGGACCAGAAACAGAAGGG - Intergenic
1080139215 11:28895035-28895057 TTTAGGAAAAAAAAAGAGAATGG + Intergenic
1080147120 11:28999760-28999782 TGTAACCAGAAGAAAGAGAATGG - Intergenic
1080515800 11:33018647-33018669 TTTTAAAAGTAGAAAGAAAAGGG - Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081041813 11:38223087-38223109 TTGGGGAAGAAGAAAGAGAAAGG + Intergenic
1081201639 11:40223295-40223317 TTTAAAAATCAGTAGGAGAAAGG + Intronic
1081294264 11:41366054-41366076 CTTAAGAGGCAGAAAAAAAAAGG - Intronic
1081619931 11:44613407-44613429 TTTACAAAGCAGGCAGAGAAGGG - Intronic
1081835469 11:46149919-46149941 TAAAAGGAGCAGAAAAAGAAGGG - Intergenic
1082251762 11:49990170-49990192 TCTGAGGAGCAGAAAGAGAAAGG - Intergenic
1082877362 11:58001849-58001871 AGTAAGAAGCAGTAAGAGACAGG - Intergenic
1083427638 11:62596871-62596893 TTTAAGGAGCAGGAAGGGAGTGG - Intronic
1084104773 11:66974279-66974301 TTTAAGAAACAGAAGGAAACAGG - Intergenic
1085008877 11:73121375-73121397 CTTAAAAAGGAAAAAGAGAAGGG + Intronic
1085075964 11:73592588-73592610 TAAAAGGAGGAGAAAGAGAAGGG + Intronic
1085468228 11:76738662-76738684 AACAAGAAGCAGAAAGAGAGGGG + Intergenic
1085859037 11:80210755-80210777 TTTTAGAAGCAAACAGAGCAGGG - Intergenic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086017570 11:82184842-82184864 TTTAAGAAGGAGACAAGGAATGG + Intergenic
1086290308 11:85301231-85301253 TTAGAGAAGGACAAAGAGAATGG + Intronic
1086568613 11:88256911-88256933 TTCAGGAAGCAGAAGGTGAATGG + Intergenic
1086572537 11:88302056-88302078 TTGAAGGAGCAGAGAGAGAGAGG - Intronic
1087394631 11:97581872-97581894 TATCAGAAGAAGAAAGAGAATGG + Intergenic
1087792944 11:102426367-102426389 TTTAGGAAGCAGTAATAGAAGGG + Intronic
1087821458 11:102717389-102717411 TTCAAGAAGAAGAAAGGGAATGG - Intronic
1087826837 11:102774463-102774485 TTGATGAAGAAAAAAGAGAAAGG + Intronic
1087977596 11:104569007-104569029 TTAAAGAAGAAAAAAGAGTATGG + Intergenic
1088102980 11:106175463-106175485 TGTAAGGAGCAGAAAGGAAAAGG - Intergenic
1088591716 11:111409055-111409077 TTTCAGAAGGAGGAAGAGATGGG + Intronic
1088723649 11:112616152-112616174 TTTCAGAAGAAGAGAGACAAAGG + Intergenic
1088778893 11:113114440-113114462 TTTAAGCAGCAGGAAAAGAAAGG + Intronic
1088850373 11:113699030-113699052 TTAGAGAAGAACAAAGAGAAAGG + Intronic
1089419363 11:118319588-118319610 TTAAAAAGGCAGAGAGAGAAAGG - Intergenic
1089843480 11:121439867-121439889 TTTAAAAATCAGTAAGACAAGGG + Intergenic
1089898894 11:121960773-121960795 TTTATGAGGCAGAAGGAAAAAGG + Intergenic
1089945804 11:122472009-122472031 GTGAAGATGCAGAAAGAGAAAGG - Intergenic
1089961644 11:122622212-122622234 TTTAAGAAACAGAGAGAGCAGGG + Intergenic
1090500498 11:127256216-127256238 TCAAAGGAGGAGAAAGAGAAAGG - Intergenic
1090685021 11:129106881-129106903 TCTAAGAATGAAAAAGAGAATGG + Intronic
1091107148 11:132933413-132933435 TATAACAAGCAGGCAGAGAAAGG + Intronic
1091249621 11:134131890-134131912 TTTGAGGAGCAAAAAGAAAAAGG + Intronic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091681803 12:2532772-2532794 TTTAAGACTCAGAAGGAGACAGG + Intronic
1091703104 12:2677156-2677178 TTCAAGAAGCGCAAAGAGCAGGG + Exonic
1091917198 12:4278202-4278224 TTTGAGCAGCAGAGAGATAAAGG + Intronic
1092034005 12:5315006-5315028 TTTAAAAAGGGGAAAGAGGAAGG - Intergenic
1092067425 12:5603493-5603515 TGGTAGAAGAAGAAAGAGAAAGG + Intronic
1092428435 12:8391352-8391374 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092429516 12:8397504-8397526 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092519551 12:9253850-9253872 TGTAAGATGAATAAAGAGAAAGG - Intergenic
1092966202 12:13645864-13645886 TTTAAGTAACAGAAAGAGAAGGG + Intronic
1093196184 12:16132044-16132066 TTGACCAAGCAGAGAGAGAATGG - Intergenic
1093725424 12:22502939-22502961 AATAAGAAGTAGAAATAGAAAGG + Intronic
1093894094 12:24557791-24557813 TTTAAGAAATAGAAAATGAATGG + Intergenic
1094208700 12:27867665-27867687 TATAGGAAGAAGAAAGAGAAGGG - Intergenic
1094228049 12:28068577-28068599 TTCTGAAAGCAGAAAGAGAAAGG + Intergenic
1094235378 12:28159479-28159501 TTTAAGAAGCAAAAATTGAAAGG - Intronic
1094244421 12:28272369-28272391 TTCCAGAAGGAGAAAGAGAATGG - Intronic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095264140 12:40133751-40133773 TCTAGGAATCAGAAGGAGAATGG - Intergenic
1095315783 12:40759465-40759487 TCTAAAAAAGAGAAAGAGAAAGG - Intronic
1095328219 12:40924046-40924068 TTTGAGAAGGAGCAAGAGATTGG + Intronic
1095489538 12:42718593-42718615 TTTAAGGAGGAGAGAGAGAAAGG - Intergenic
1096939879 12:55331671-55331693 TGGAAGAAGGAGAGAGAGAAAGG + Intergenic
1097634576 12:62106990-62107012 TTCCAAAAGCAGAACGAGAAAGG + Intronic
1097715842 12:62965159-62965181 TGCATGGAGCAGAAAGAGAAGGG + Intergenic
1098086902 12:66855514-66855536 TTTCTAAAGCATAAAGAGAAAGG - Intergenic
1098113093 12:67145019-67145041 TTGCAGAAGAAGAAACAGAAAGG - Intergenic
1099209937 12:79771933-79771955 TTTAAAAAGCTGAAGGAAAAGGG - Intergenic
1099250014 12:80242932-80242954 TCTTAGAAGCAGAAACAGGACGG - Intronic
1099559781 12:84157086-84157108 TTTAAAAAAGAGAAAAAGAAGGG - Intergenic
1099623238 12:85031430-85031452 TCTGTGAAGAAGAAAGAGAATGG + Intronic
1099837596 12:87927011-87927033 TTTAAGAAGAAGAGGGAGCATGG - Intergenic
1099844359 12:88010721-88010743 TATCAGAAGGAGAAAGAGATAGG + Intronic
1099930695 12:89070992-89071014 TTTAAGAATCTGGAAGAGAATGG - Intergenic
1099935987 12:89125969-89125991 TTAAAAAAGAGGAAAGAGAAAGG - Intergenic
1100093054 12:90995452-90995474 CAGAAGAAGCAGAAAAAGAATGG + Intronic
1100370157 12:93961772-93961794 TTAAAGATTCAGAAGGAGAAGGG + Intergenic
1100779718 12:98011062-98011084 TTAAAACAGGAGAAAGAGAATGG + Intergenic
1100918432 12:99454857-99454879 GTTAAGAAAATGAAAGAGAAAGG + Intronic
1101078642 12:101158437-101158459 TTCAAAAAACACAAAGAGAAAGG + Intronic
1101168079 12:102060241-102060263 TTTAAAAAGCCAAAAGAGGATGG - Intronic
1101300201 12:103471826-103471848 TTTAAGAAAGAGAAATAGAATGG - Intronic
1101468501 12:104972955-104972977 ATTAAAAAGCAGAAAGTAAAAGG - Intergenic
1101629432 12:106478578-106478600 TTGATGAAGCTGTAAGAGAAGGG - Intronic
1102663342 12:114548664-114548686 TGTCAGAATGAGAAAGAGAAAGG - Intergenic
1102791846 12:115653110-115653132 TTACAGAAGCAGAAATAGAAGGG - Intergenic
1102858868 12:116318346-116318368 CTTCAGAAGAAGAAAAAGAACGG - Intergenic
1103038621 12:117676462-117676484 ACTAAGAAGGAGAAAAAGAAGGG + Intronic
1103130156 12:118461095-118461117 TTTAGGGATAAGAAAGAGAAAGG + Intergenic
1103383254 12:120511625-120511647 AATAAAAAGCAAAAAGAGAAAGG + Intronic
1103481737 12:121254477-121254499 TTTAACAAGCAGAAGCAGAAAGG + Intronic
1103680663 12:122690966-122690988 AATAACAAGCAGAAAGAGGAAGG - Intergenic
1104713155 12:130999054-130999076 TTTAAGAAGTAGAATAAAAAAGG - Intronic
1105416827 13:20220699-20220721 TTAAAAAAGGAGAGAGAGAATGG + Intergenic
1105899394 13:24742541-24742563 TTCAAGAAGCAGCAAGAGGGAGG - Intergenic
1106063282 13:26317050-26317072 TATGAGGAACAGAAAGAGAAAGG + Intronic
1106392610 13:29350120-29350142 TTTAAGAAAAAGAAAGGGAAAGG - Intronic
1106683643 13:32033916-32033938 TTTGAGCAGCAAAGAGAGAAAGG + Intronic
1106767041 13:32923518-32923540 TTGAAGTAGGAGAAAGAAAATGG + Intergenic
1106849824 13:33777957-33777979 TTTTAGAAGATGAAAAAGAAAGG + Intergenic
1106916748 13:34524071-34524093 TTGAGGAAGCAGAAGCAGAATGG + Intergenic
1107107448 13:36660448-36660470 CTTAAGAAGCTGAGAGAGAATGG + Intergenic
1107160578 13:37222597-37222619 TTGAAGATGCAGAAAAAGAATGG - Intergenic
1107626008 13:42284867-42284889 TTGAAGCAGCAGCATGAGAAAGG - Intronic
1107780053 13:43890341-43890363 TAAAAGAGGAAGAAAGAGAAAGG - Intronic
1108216920 13:48194519-48194541 TTAAAGAGTCAGAGAGAGAAGGG - Intergenic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1109637548 13:65142607-65142629 TTAAAAAAGCAAAAAGTGAAAGG - Intergenic
1109711669 13:66168639-66168661 CTTTAGAAGCAGAAAAGGAAAGG - Intergenic
1109730439 13:66406122-66406144 TCTAAGAGGAAAAAAGAGAAGGG + Intronic
1109765362 13:66888571-66888593 TTTAAAAAGAGGAAAGAAAATGG + Intronic
1109775774 13:67039326-67039348 ATTAAGAGGCAGATACAGAATGG + Intronic
1109831785 13:67800242-67800264 TTTATGTAGCAAAAAGAAAATGG + Intergenic
1109836758 13:67868889-67868911 TTTAAAAAGAATAAAGAGAAAGG - Intergenic
1109861807 13:68209439-68209461 TTTGAGAAGAATAAAGAAAAGGG - Intergenic
1110077016 13:71258768-71258790 TTCAAGAAGCAGAAAAATAACGG - Intergenic
1110565097 13:76949824-76949846 TTTTAGGGGCAGAAAGAGAGAGG - Intronic
1111147710 13:84206082-84206104 TTTGAGAAGAAGAATGGGAAAGG + Intergenic
1111477489 13:88771515-88771537 TTGAAGTAGAAGGAAGAGAAGGG - Intergenic
1111961635 13:94816912-94816934 TTTTAAAAGCTGAAGGAGAAAGG - Intergenic
1112057188 13:95700574-95700596 GTTTAGAAGGAGAAAGAGCAAGG + Intronic
1112094848 13:96121180-96121202 TTTTAAAACCAGAAAGGGAAAGG - Intronic
1112165208 13:96910815-96910837 TATAAGAACCAGGAAAAGAAAGG - Intergenic
1112597362 13:100820194-100820216 TTTAAGAAGGGGAAATAAAAGGG + Intergenic
1112706230 13:102072167-102072189 TATAAGAGGCAGAGATAGAAGGG + Intronic
1112839174 13:103554504-103554526 TTTAAGCAGAAGGAAGAGATGGG + Intergenic
1113321833 13:109240839-109240861 TTTAAAAAGAAGGAAGAAAAGGG + Intergenic
1114392226 14:22322368-22322390 AAGAAGAAGGAGAAAGAGAAAGG + Intergenic
1115188606 14:30721684-30721706 ATTAAGAAGCAGCTAGAAAAGGG - Intronic
1115358067 14:32470806-32470828 TTTAAATAGAAGAAAGAGATGGG - Intronic
1115440523 14:33429742-33429764 TTTAAGAAACAGAACTAAAAAGG + Intronic
1115841666 14:37478346-37478368 TTGCAGAAACAGAAAAAGAATGG + Intronic
1115879141 14:37895144-37895166 TTAAGGAAGCAGCAAGAAAAAGG - Intronic
1115881352 14:37922912-37922934 TTTAAGGAGCAAATAAAGAAGGG + Intronic
1116041316 14:39689554-39689576 TTAAATAAATAGAAAGAGAAAGG + Intergenic
1116113289 14:40614169-40614191 TTTATGCAGGCGAAAGAGAAGGG + Intergenic
1116120416 14:40716576-40716598 TTTATGAAGCAGCATGAAAATGG + Intergenic
1116201890 14:41808147-41808169 GTTAAGAAGCATAAAGAAAGTGG + Intronic
1116300735 14:43178810-43178832 TATAAGAAGCATAATAAGAATGG + Intergenic
1116327611 14:43551315-43551337 TTTAAAAACTAGAAATAGAAGGG - Intergenic
1116386228 14:44333901-44333923 TTTAGCAGGCAGAAAGAGACTGG + Intergenic
1116551993 14:46252224-46252246 ATTTAAAAACAGAAAGAGAATGG - Intergenic
1116712755 14:48389954-48389976 TCTATGAGGCAGAAGGAGAAAGG + Intergenic
1116726036 14:48562390-48562412 TTCAAACAGCAGAAAGAGGATGG + Intergenic
1116780086 14:49227564-49227586 TTTAAGAAAGAGAGGGAGAATGG - Intergenic
1117218200 14:53573879-53573901 TTCAAGGAGGAGAGAGAGAATGG + Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117266679 14:54095540-54095562 TTAAAGAAGCTGAAAGAAGATGG - Intergenic
1117387483 14:55230638-55230660 TTTAAAAAGCAGGGAGGGAAGGG + Intergenic
1117587762 14:57229416-57229438 TTCAAGAAAAAAAAAGAGAATGG + Intronic
1117609314 14:57465848-57465870 TTTAAGAAGCAGAAATCGGTTGG + Intergenic
1117723981 14:58654469-58654491 GAAAAGAAGGAGAAAGAGAAAGG - Intergenic
1118180134 14:63484103-63484125 AGTTAGAAGCAGAAAGATAAAGG + Intronic
1118412189 14:65492704-65492726 TTTCAGGAGAAGGAAGAGAAAGG + Intronic
1118979477 14:70704688-70704710 TAAAAGACTCAGAAAGAGAAAGG + Intergenic
1119218392 14:72886717-72886739 TTTTGCAAGCATAAAGAGAAGGG - Intronic
1119651283 14:76385451-76385473 TTTAAGAAGGATTAGGAGAAAGG + Intronic
1119982459 14:79097380-79097402 CTTGGAAAGCAGAAAGAGAATGG - Intronic
1120281305 14:82441889-82441911 TTTTAGGAGCAGAATGAGTAAGG - Intergenic
1120500196 14:85287814-85287836 TTTAGGAAGCATTAAGAGTAAGG + Intergenic
1120540245 14:85742218-85742240 TTTCAGAAGCAGAGAGAGAGAGG - Intergenic
1120549861 14:85857507-85857529 GTTAAAAAGTAGACAGAGAATGG - Intergenic
1120689605 14:87577874-87577896 TTGCAGAAGCAGAGAGAAAATGG + Intergenic
1120698811 14:87675177-87675199 TTTAATAATCAGAAAGAGTGAGG - Intergenic
1120736651 14:88060552-88060574 TTTAAGAAGGAAAAAGGGGAGGG - Intergenic
1120802578 14:88708483-88708505 TTGAAGAAAGAGAAAAAGAAAGG + Intronic
1120867532 14:89308742-89308764 TTTAAGGAGGAGGTAGAGAAAGG + Intronic
1121242551 14:92440840-92440862 TTTAGCAAGCAGAGAGGGAAGGG + Intronic
1122459142 14:101880793-101880815 TTTAAGAGGAAAAAAGAAAAGGG + Intronic
1122802085 14:104236266-104236288 TTTGAGAAGAAACAAGAGAAGGG - Intergenic
1123695039 15:22872978-22873000 AACAAGAAGCAGAAACAGAATGG + Intronic
1123868362 15:24546051-24546073 TTTATTTAGCAGAAATAGAATGG + Intergenic
1124073348 15:26416218-26416240 CAGAAGGAGCAGAAAGAGAATGG + Intergenic
1124165592 15:27323014-27323036 TTTAAGATGCAGTATGAGATCGG - Intronic
1124397909 15:29320933-29320955 ATTAAAAGGCAAAAAGAGAATGG + Intronic
1124565447 15:30808350-30808372 TTTGAGAGACAGAGAGAGAATGG - Intergenic
1124832950 15:33167072-33167094 GTTAAGAAGGAGAAAGAAAGAGG + Intronic
1125182604 15:36894914-36894936 TTTAAAAAGAAAAAAGAAAAAGG + Intronic
1125688271 15:41576667-41576689 TTTAAAAAAAAAAAAGAGAAAGG + Intronic
1125994031 15:44139143-44139165 TTTAAAAAGCGGAACTAGAAAGG + Intronic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1126181217 15:45787069-45787091 TTTAATAAGCAACAAGAGGAGGG - Intergenic
1126451852 15:48817099-48817121 TTTAAGAAACAAAAATGGAATGG - Intergenic
1126515991 15:49538560-49538582 TTTCAGATGAAGAGAGAGAAAGG - Intronic
1126740786 15:51774294-51774316 TTTAAAATGCAGATAGAAAAAGG + Intronic
1127300877 15:57652288-57652310 TTTAATAAGCATGAAGAAAATGG - Intronic
1127358362 15:58223482-58223504 TTCTAGAAAAAGAAAGAGAAAGG - Intronic
1128109101 15:65065275-65065297 TGCAAGAAGCAGAAAGAGGTTGG + Intronic
1128305053 15:66592955-66592977 TTGGAGTAGCAGGAAGAGAAAGG - Intronic
1128622967 15:69167450-69167472 TTTAAGAAAGAAAAAGAGGAAGG - Intronic
1129055273 15:72815117-72815139 TTTATGAATCTGAATGAGAATGG + Intergenic
1129499987 15:76026621-76026643 TATACAAAGGAGAAAGAGAAAGG + Intronic
1129750788 15:78061820-78061842 TGTAAGAGGCAGAAAGAGACAGG - Intronic
1130145762 15:81272742-81272764 GTTCAGAAGCAGAAAGTGATTGG + Intronic
1130537946 15:84800271-84800293 GCTGTGAAGCAGAAAGAGAATGG - Intronic
1130614651 15:85393166-85393188 TTTAACAAGCTGGAAGAAAATGG + Intronic
1130873098 15:87987717-87987739 TTTAAGTAACATAAAGGGAAAGG - Intronic
1131076318 15:89496967-89496989 TTTCATAATCAGAAAAAGAAAGG - Intergenic
1131363895 15:91821010-91821032 TAAAAGAAGCAGAAATGGAAGGG + Intergenic
1131600413 15:93842081-93842103 TTTAAGAACAAGAAAAATAAAGG + Intergenic
1131804758 15:96109805-96109827 TTTAAGATGCAGAGAGGGAGAGG + Intergenic
1131830286 15:96350342-96350364 TTAAAGAAGGAAAGAGAGAAAGG - Intergenic
1132324193 15:100953313-100953335 TTAAAGAAGCCGAGAGTGAATGG - Intronic
1132471298 16:104904-104926 GTTAACAAGGGGAAAGAGAAAGG + Intronic
1133382849 16:5345627-5345649 TTTAAGAAGCCCAACGAGCACGG - Intergenic
1133526597 16:6611774-6611796 CTTGGGAAGCAGAGAGAGAAGGG - Intronic
1133540906 16:6752743-6752765 GTGAAGAAGCAGTAAGGGAAAGG - Intronic
1133563520 16:6971395-6971417 TTTGGGGAGCAGAAAGGGAAGGG + Intronic
1133733630 16:8597109-8597131 TCTAAGAAGCAGACACAGACAGG + Intergenic
1134276536 16:12781387-12781409 TTTAAGAAAAGGAAAGCGAATGG - Exonic
1134306046 16:13033452-13033474 TTAGAGAAGCAGAAAAAGAAAGG - Intronic
1134915147 16:18063016-18063038 TTCAAGCAGCAGAAAGAAAGAGG - Intergenic
1135175508 16:20224524-20224546 TATAAGAAGAAGAAAGTGGACGG + Intergenic
1135749288 16:25044141-25044163 TTTTACAAGGAGAATGAGAAAGG + Intergenic
1136679390 16:31947390-31947412 TTTAAAAAGCAGCAAGAGAAAGG + Intergenic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1137257265 16:46786613-46786635 ATTTTGAAGCAGCAAGAGAAAGG + Intronic
1137405891 16:48189076-48189098 TTTTAGAGGCAGAAAAAGCAAGG - Intronic
1137788987 16:51158573-51158595 TTTATGAAGCAGAAAATGGAGGG - Intergenic
1137938806 16:52660869-52660891 TATACAAAGGAGAAAGAGAAAGG + Intergenic
1138411428 16:56843433-56843455 TTTCAGAAAAAGAAAGAAAAAGG - Intronic
1138424014 16:56918391-56918413 TTTAGGAGGCAGAATGAAAAAGG + Intergenic
1138644011 16:58409648-58409670 TTGAAAAAGCAGATACAGAAAGG - Intergenic
1138869185 16:60860546-60860568 TTTAAGAGGAAGAGTGAGAAAGG + Intergenic
1139877879 16:70160933-70160955 TTTGAGAACCTGAAATAGAAGGG + Exonic
1140583321 16:76256685-76256707 TTTGAGAAAGAGAAAGTGAATGG + Intergenic
1140740270 16:77935533-77935555 TTTAAGAGGCAGAGAGAGATGGG + Intronic
1140970495 16:80007802-80007824 TTTTAGCAGCAGAAGGCGAATGG - Intergenic
1141326488 16:83064488-83064510 TTTAAAAAGTAAAAAGAAAAAGG + Intronic
1141431537 16:83972722-83972744 TTAAAGAGGCTGAGAGAGAAAGG - Intronic
1141539242 16:84706123-84706145 TTTAGGAAGCTGAAGCAGAAGGG - Intronic
1142256965 16:89018709-89018731 TTTAAGGAGCAGGCAGAGAATGG + Intergenic
1142882844 17:2894893-2894915 TGCAAGCAGCAGAGAGAGAACGG - Intronic
1142950542 17:3475536-3475558 TTTCACAATCAGAAACAGAAGGG - Intronic
1144071693 17:11679706-11679728 TTCGAGAAGTAGAACGAGAATGG + Intronic
1144126874 17:12211026-12211048 TCTGAGAAGCAGAGAGAAAATGG + Intergenic
1144216309 17:13058564-13058586 TTTAAGAAACAGTAAGAGTCAGG + Intergenic
1144247972 17:13386556-13386578 TTTAGGAAGGGGAAAGAGGAGGG - Intergenic
1144290178 17:13818699-13818721 AAAAAAAAGCAGAAAGAGAATGG + Intergenic
1144471244 17:15543294-15543316 CTAAACCAGCAGAAAGAGAAGGG + Intronic
1144870679 17:18368579-18368601 TACAAGAGGCAGAAAAAGAATGG - Intergenic
1144925222 17:18801399-18801421 CTAAACCAGCAGAAAGAGAAGGG - Intronic
1145886640 17:28386507-28386529 TTTATGAAGCAGAAAGACAAGGG - Intronic
1146111777 17:30096235-30096257 GATAAGAAACATAAAGAGAATGG - Intronic
1146217072 17:30985812-30985834 TTTGAGAGGCAGACAGAGATGGG - Intronic
1146711751 17:35048090-35048112 TTTAAAAAGCAGATAGATAGAGG - Intronic
1147499973 17:40953619-40953641 TTGGAGAAGGAAAAAGAGAAAGG + Intergenic
1147886112 17:43685429-43685451 ATCAGGAAGTAGAAAGAGAATGG - Intergenic
1148530237 17:48383211-48383233 TTTGAGAAGGAGGAAGTGAATGG + Intronic
1148978789 17:51552993-51553015 TTTAAAAAGCATAAAGAAACAGG - Intergenic
1149022725 17:51988534-51988556 TTTAAAAGGTAGAAACAGAATGG - Intronic
1149586383 17:57790404-57790426 TTTGTGAAACAGAAAGAGATTGG + Intergenic
1149841434 17:59968410-59968432 TTCAAGAAGAAGAATGAGATTGG + Intronic
1150124764 17:62628710-62628732 AATAAGGAGCAGGAAGAGAATGG - Intronic
1150302731 17:64059798-64059820 TTTATGAAGCAGACAGAGAGTGG - Intronic
1150854385 17:68736817-68736839 TTTACAAAGAAAAAAGAGAAAGG + Intergenic
1150984229 17:70177259-70177281 TTTAAGAGGAAGAAGAAGAAAGG + Exonic
1151023818 17:70653454-70653476 ATTAGGAAGGAGAAAAAGAAGGG + Intergenic
1151075211 17:71264239-71264261 TTTAAAAAATAGCAAGAGAAGGG + Intergenic
1151514591 17:74584633-74584655 TTTATTAGGTAGAAAGAGAAGGG - Intronic
1151962085 17:77410904-77410926 TTTAGGATGAAGAAAGGGAAAGG - Intronic
1152431323 17:80249598-80249620 TTTAGGAAACAAAAAGAGACAGG + Intronic
1153016764 18:589720-589742 TCTAACATGCAGAAAGGGAAAGG - Intergenic
1153175053 18:2362335-2362357 TTTGAGAAACAAAAAGAAAAAGG - Intergenic
1153398900 18:4659785-4659807 TCTAAGAAGAAGAGACAGAAGGG + Intergenic
1153495869 18:5698978-5699000 TTTTAAAAGAAGACAGAGAAAGG - Intergenic
1153547348 18:6221342-6221364 TTTAATAAGCAGCAATAAAAGGG + Intronic
1153956192 18:10098415-10098437 TTTAGGAAGCAGAGGCAGAAGGG - Intergenic
1153975034 18:10261752-10261774 TTTATGAAATAGAAAGAGAGTGG - Intergenic
1154005155 18:10521063-10521085 TTTGAAAAGGAGAAAGAGAACGG - Intergenic
1154053569 18:10988233-10988255 TTTTGGAAGCAGAAAGACCAGGG + Intronic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1154477250 18:14774351-14774373 TTTAAAAAGGTGAAAGAGGAGGG - Intronic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155714557 18:28925466-28925488 ATAAAGAAAAAGAAAGAGAAAGG + Intergenic
1155849207 18:30749717-30749739 TTTAAGAAATAGAAATAGAAGGG + Intergenic
1155998275 18:32356103-32356125 TTTAAGGAGCAAAATGAGAAAGG + Intronic
1156028190 18:32681385-32681407 TTTTAGTAGAAGAAATAGAAAGG + Intronic
1156055778 18:33000570-33000592 TCTTAAAAGCAGCAAGAGAAAGG + Intronic
1156127856 18:33929078-33929100 TTTCAGAAGCAAACAGACAATGG - Intronic
1156236912 18:35214496-35214518 TTTGAGAAACAGAAAGAAAAAGG - Intergenic
1156264843 18:35478402-35478424 TTTTAGAAAAAAAAAGAGAAGGG - Intronic
1156417802 18:36916270-36916292 TCTAAGAAACAGAAAGACAAAGG - Intronic
1156542719 18:37931039-37931061 TTTACCAAGCAGAAAAAGAAAGG - Intergenic
1156696132 18:39770484-39770506 TTTAAAAGACAGGAAGAGAAGGG - Intergenic
1156705357 18:39875057-39875079 TTTAATATGAAGAAAGAAAAGGG - Intergenic
1157100437 18:44724330-44724352 TGTAAGATGCAGAAATAAAATGG - Intronic
1157299400 18:46468771-46468793 TTTAAGGAGCAGTTAGAGACTGG + Intergenic
1157534148 18:48446307-48446329 TTTAAAAAGAAAAAAGAAAAAGG - Intergenic
1158000905 18:52617691-52617713 TTTAAAAAAAAGTAAGAGAACGG - Intronic
1158102901 18:53850744-53850766 TTTAAGAAAAAGAAAAAAAAAGG - Intergenic
1158272250 18:55729180-55729202 GTTAAGCAGAAAAAAGAGAAAGG - Intergenic
1158605325 18:58890833-58890855 TTTAAGAAGGAAAAAAAAAAAGG - Intronic
1158744722 18:60187136-60187158 TATAATAACAAGAAAGAGAAAGG - Intergenic
1158834573 18:61316815-61316837 TTTGGAAAGCAGAAAGAGACAGG - Intergenic
1159071529 18:63628169-63628191 TTTCTGAAGAAGAAAGAAAAAGG + Intergenic
1159251448 18:65883038-65883060 TTTTAAAAGCAGAAAAAGCAGGG - Exonic
1159270028 18:66137006-66137028 TTTTAGAAGCAGACAGAGCTGGG - Intergenic
1159375653 18:67589191-67589213 TTTAAAAAACAGGAAGAGAAAGG - Intergenic
1159620177 18:70628344-70628366 TTTAAGAGTGAGAAAGAGAGAGG - Intergenic
1159824203 18:73186436-73186458 TTTAAGAAGCAGATTGAAATTGG - Intronic
1159866305 18:73709521-73709543 TTTAAGAAAAAGAAAAAAAAGGG - Intergenic
1160049579 18:75420275-75420297 TTCAAGAAGGAAAAGGAGAAAGG + Intronic
1160164819 18:76501342-76501364 TTTAAGAAAAAGAAAGAAAGTGG + Intergenic
1160170015 18:76545005-76545027 TTTAAGAAGAATAAGTAGAAAGG - Intergenic
1161747030 19:6066964-6066986 TTTCAGAAGCCCTAAGAGAAAGG + Intronic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1162991276 19:14303980-14304002 TTTAAACAGCAGAGAGATAAGGG - Intergenic
1163276081 19:16285185-16285207 AGAAAGAAGAAGAAAGAGAAGGG + Intergenic
1163629184 19:18408394-18408416 TTAAAGAGGCAGGAAGGGAAGGG - Intergenic
1164578848 19:29422002-29422024 TTTAAAAAGCAGAACCAGTAGGG - Intergenic
1164768883 19:30792762-30792784 GTTCAGAAGCAGTAAGAGCATGG - Intergenic
1164903115 19:31945082-31945104 TGAAAAAAGCAGAAAGAGAGAGG + Intergenic
1165008966 19:32829484-32829506 TTTTAGAAGCATAGAGACAAAGG - Intronic
1165122690 19:33571196-33571218 TTACAGAAGAAGGAAGAGAAAGG + Intergenic
1165184561 19:34006571-34006593 TTTAAGAGGGAGAGAGAGAGGGG - Intergenic
1165520917 19:36313151-36313173 TTTAAGGAGCACAAACAAAAAGG + Intergenic
1165675037 19:37715200-37715222 TTTAAGAAACAGAAAGTGGCTGG - Intronic
1165726446 19:38116211-38116233 ATTAAGAAACATAAAGAGACCGG + Intronic
1166002637 19:39886902-39886924 TATAAGAGCCAGAAAGAAAAAGG + Intronic
1166005424 19:39903154-39903176 TATAAGAGCCAGAAAGAAAAAGG + Intronic
1166333228 19:42090645-42090667 TTCCAGAAGGTGAAAGAGAAAGG - Exonic
1166584030 19:43929514-43929536 GTCAGGAAGCAGACAGAGAAAGG - Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167438222 19:49492201-49492223 TTCTAGAAGCAGAAATAGACTGG + Exonic
1167678244 19:50902715-50902737 TTTATGAAGAAGAAAGGGCAAGG - Intergenic
1167735049 19:51289181-51289203 TTCAACAAGCTCAAAGAGAAAGG + Intergenic
1168108066 19:54176316-54176338 TTGAAGAACCAGAAAGCCAATGG - Intronic
925183630 2:1832519-1832541 TTTAGGAAACAGAATGAGCAGGG - Intronic
925197263 2:1936217-1936239 TTTAAGATGCAGGTAGAGGACGG - Intronic
925259148 2:2515094-2515116 ATTAAGAAGAAGAAGAAGAAAGG - Intergenic
925386886 2:3468186-3468208 TTGCACAAGCAGAAAGAGAAGGG - Intronic
925467770 2:4124715-4124737 GTTAAGATACAGATAGAGAAAGG + Intergenic
925539177 2:4948368-4948390 TTTAAGAAAAGGGAAGAGAAGGG - Intergenic
925601262 2:5610897-5610919 TTTAATAAGCAGCAAGAGAGAGG - Intergenic
925633531 2:5919196-5919218 TATGAGACCCAGAAAGAGAAAGG + Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926662822 2:15487089-15487111 TTTAAAAAACAGAAAGCCAAGGG + Intronic
926732112 2:16043372-16043394 TTTAGGAACCAGACAGATAAAGG + Intergenic
927322852 2:21768642-21768664 ATTATGAAGCAGATAGAGAGAGG + Intergenic
927335854 2:21923301-21923323 TTTAAGAAGTATTAATAGAATGG + Intergenic
927360970 2:22232990-22233012 ATGAAAAAGCAGAAACAGAAAGG + Intergenic
927405733 2:22764264-22764286 TCACAGAAGCAGAGAGAGAATGG - Intergenic
927543246 2:23930715-23930737 TTTAAAAAAGAGAAAGAAAAAGG + Intronic
927876059 2:26655856-26655878 TTTAAGAAACAGCAAAAGGAAGG - Intergenic
928312474 2:30222349-30222371 TTTAAAAAGAAGAAAGTAAATGG - Intergenic
928358632 2:30644911-30644933 TTTAAGCAAAAGGAAGAGAAGGG + Intergenic
928541401 2:32287423-32287445 TTTAATAAGCAACAAGAGCAAGG - Intronic
928638775 2:33276033-33276055 TCTAGGAAGCAGAAAGAGCTTGG - Intronic
928948863 2:36796788-36796810 TTTAAAAAGCAAAAATATAAAGG - Intronic
929205817 2:39291587-39291609 TTTTAGAAACAGAAAGAGGCTGG + Intronic
929546641 2:42859585-42859607 TTTAAAAAGGAAAAAGAGACAGG - Intergenic
929610783 2:43269278-43269300 TTTCAGAAGCAGCAAGAGTCAGG + Intronic
929611277 2:43272568-43272590 CTTAAGTAGGAGTAAGAGAAGGG + Intronic
930077431 2:47418320-47418342 TTTATGGAGCTGACAGAGAAGGG - Intronic
930360388 2:50370668-50370690 GTTAAGGAGTAGAAAGGGAAAGG + Intronic
930368783 2:50477679-50477701 TTTAAAAAGCATACAGAAAAAGG + Intronic
930441533 2:51414140-51414162 TTTAAGAGGCTGGTAGAGAAAGG + Intergenic
931131425 2:59340882-59340904 AGTAAGAAGCAGAATGAGACAGG + Intergenic
931290169 2:60865703-60865725 CTTTAGAAGCAGTATGAGAACGG + Intergenic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931553647 2:63475308-63475330 TTAGGCAAGCAGAAAGAGAAAGG - Intronic
931707103 2:64956031-64956053 TTTAAGGAGCAGAAAATTAAGGG - Intergenic
931848420 2:66228706-66228728 GTTAATAAGCAGAAATAAAAGGG - Intergenic
932007930 2:67946277-67946299 GGTTAGAAGCAGAAAGAAAATGG - Intergenic
932147806 2:69339127-69339149 TTTGAGAAGTGGAAAGAGCATGG + Intronic
932741425 2:74293736-74293758 TTGGGGAAGCAGAGAGAGAAGGG - Intronic
933009846 2:77046696-77046718 TTTAAAAAGCATAGAGAAAAAGG + Intronic
933555388 2:83824299-83824321 CTTAAGAAGCATAAGGGGAAAGG - Intergenic
933656300 2:84889744-84889766 TTTAAAAAAGAGAAAGAAAAAGG + Intronic
933838431 2:86264809-86264831 TATAAAAAGCAGACAGAGACTGG + Intronic
934053154 2:88227090-88227112 TATATGAAGCAGTTAGAGAAAGG + Intergenic
934101976 2:88661746-88661768 TTTAATAGGCAGAATTAGAAAGG - Intergenic
935029081 2:99304755-99304777 TTTATGAAAAAGAAAAAGAAAGG + Intronic
935255244 2:101304427-101304449 CTTAGGAAGCATAAAGAAAAGGG - Intronic
935443462 2:103131217-103131239 ATAAAGAAGCAAAAAGAAAAGGG + Intergenic
935559545 2:104545736-104545758 TCTAAGAATCACAGAGAGAAAGG - Intergenic
935734893 2:106098541-106098563 TTTAAGGAATAGAAAGATAAAGG - Intronic
935746038 2:106191191-106191213 TGTAAGGAGGAGAAGGAGAAAGG + Intronic
936112136 2:109673736-109673758 TGGAAGAAGGAGAAAGAGAGAGG + Intergenic
936162305 2:110093865-110093887 TTTAAGGAGAAAAAAGAAAAGGG + Intronic
936182355 2:110277501-110277523 TTTAAGGAGAAAAAAGAAAAGGG - Intergenic
936466447 2:112755713-112755735 TTTAAGAAATTGAAACAGAATGG - Intronic
936469238 2:112783846-112783868 TTCAGGAAGCACAAAGAGGAGGG - Intronic
936869769 2:117122004-117122026 GTAAAGAAGGAGAAAGAAAAAGG + Intergenic
937386330 2:121436774-121436796 TTTAAGAAGAAGAGGGAGAATGG - Intronic
937420321 2:121748955-121748977 TTTCTGAAGAAGAGAGAGAAGGG + Intronic
937627973 2:124065140-124065162 TTTAAAAAGCAGCCAGGGAAGGG + Intronic
938052509 2:128187551-128187573 TTTCAGAAGGAGAAAGAAACGGG + Exonic
938545189 2:132322496-132322518 TTTAAGAAGGATAAAAAGATAGG + Intergenic
938594745 2:132776590-132776612 ATGAAGAAGCAGCAAGAAAATGG + Intronic
938863242 2:135391994-135392016 ATTAAGTAGCAGAAAAACAAGGG + Intronic
939232134 2:139442130-139442152 TTTAAGTAACAGGATGAGAAAGG - Intergenic
939483213 2:142776288-142776310 TTCTAAAAGCAGTAAGAGAAAGG - Intergenic
939535036 2:143417031-143417053 TCTAAGAAGCAAAAAAGGAAAGG - Intronic
939664062 2:144928719-144928741 TCTTAGAAACAGAAAGAAAAAGG - Intergenic
939904225 2:147890923-147890945 TTTCATAAGTAGAAAGAAAATGG - Intronic
939954627 2:148517282-148517304 GTTAAGAAGCAGTAAGAGGCTGG - Intronic
940024739 2:149193999-149194021 TTAAATAAGCAGAGAGAGATGGG - Intronic
940046453 2:149415589-149415611 TTAACGAAGGAGAGAGAGAAGGG + Intronic
940125780 2:150322519-150322541 TTAAAAAAGAAGAAAGATAAAGG - Intergenic
940357766 2:152764246-152764268 TTTAAGAAGGACAAAAAGATGGG + Intergenic
940812172 2:158257304-158257326 TTTAGGGAGAAGACAGAGAAAGG - Intronic
941202774 2:162533476-162533498 TTTAAAATACAGAAAGAAAATGG + Intronic
941304004 2:163838592-163838614 TTTAAGGATTAGAAAAAGAAAGG - Intergenic
941369801 2:164650762-164650784 TTTCAGAAGAAGAGAGAGACTGG - Intergenic
941441716 2:165545756-165545778 TTTAAGAAACACAAATAAAAGGG - Intronic
941521865 2:166555049-166555071 CTTTTGAAGTAGAAAGAGAAGGG - Intergenic
941784286 2:169480585-169480607 TTTAAGAAGATGAAAGAGAAAGG + Intronic
942069318 2:172301183-172301205 TGGAAGAAAAAGAAAGAGAAGGG - Intergenic
942430171 2:175902204-175902226 TAAAAGAAACAGAAAGAGAGAGG - Intergenic
942831801 2:180245333-180245355 TTTAAGAAGAAGCTGGAGAACGG - Intergenic
942860665 2:180606937-180606959 TATAAGAAAAATAAAGAGAATGG - Intergenic
942998166 2:182290697-182290719 TCTAAGCAGAAGAATGAGAAAGG - Intronic
943202843 2:184851370-184851392 ACTCAGAAGCAGAAAGAGAATGG - Intronic
943352227 2:186809108-186809130 TATAAGAAGCATAAAGAAGAGGG + Intergenic
943394397 2:187314726-187314748 TTGAAGAAAGAGAAAGAGAGAGG - Intergenic
943427731 2:187757928-187757950 TTGATCAAGCAGAAAAAGAAAGG - Intergenic
943492822 2:188577907-188577929 TTAAAGATGGAGAAAGAAAATGG - Intronic
944253332 2:197599499-197599521 TGTGAGAAGGAGAAAGAGGAAGG + Intronic
944473686 2:200082718-200082740 TTTAAAAAATTGAAAGAGAAGGG - Intergenic
945435344 2:209811020-209811042 TTTAAGAAGGAGAAATGGGATGG + Intronic
945709743 2:213280700-213280722 TTTAAAAAGCAAAACCAGAAAGG - Intergenic
945837931 2:214854397-214854419 ATTTAGAAGGACAAAGAGAAAGG - Intergenic
945911663 2:215656844-215656866 TTTGAGGAGCAGAAAGAGAGGGG - Intergenic
946039391 2:216770845-216770867 TTTACTAAGCAGAAAGAAAGTGG + Intergenic
946220860 2:218225483-218225505 TTTAATATGCTTAAAGAGAAAGG - Intronic
946508893 2:220333292-220333314 TTCTAAAAGCAGCAAGAGAAAGG - Intergenic
946538809 2:220661179-220661201 GTTGAGAAACAGCAAGAGAAAGG - Intergenic
946541460 2:220688732-220688754 TTAATGAAGCAGGAAGCGAAAGG - Intergenic
946610239 2:221449943-221449965 TTAAAGAAGGAGAAAAAGAATGG - Intronic
946656656 2:221955782-221955804 TTTGAGAATCAGAAAGACACGGG + Intergenic
946765148 2:223033603-223033625 TGAAAGTAGCAGAAAAAGAAAGG - Intergenic
947772983 2:232685652-232685674 TTTAAAAAGAAGGAAGAGAATGG + Intergenic
947904197 2:233747884-233747906 CATAAGGAGCAGAAAGAGCATGG - Intronic
948729976 2:239956668-239956690 TTTAGGAAGCACGAACAGAAAGG - Intronic
1168784544 20:526653-526675 TTTAAGAAAAAAAAAAAGAAGGG + Intronic
1168822763 20:786830-786852 TTCAAACAGCAGAAAGAGGATGG - Intergenic
1168930431 20:1619078-1619100 TTTAAGACACAGAGAGAAAATGG + Intronic
1169045621 20:2532613-2532635 GTTAAATAGTAGAAAGAGAAAGG + Intergenic
1169353488 20:4889091-4889113 TTCACGCAGCAGAAACAGAAGGG - Intronic
1169382639 20:5121491-5121513 TTTAAGAGGCTGATACAGAAGGG - Intronic
1169474750 20:5921056-5921078 TTTAAAAAGTAAAAAGAGACAGG + Intronic
1169495671 20:6112759-6112781 TTGAAGAAACAGAAGGGGAAAGG + Intronic
1169718636 20:8647874-8647896 TTGGAGAAGCAGAAAAACAAGGG - Intronic
1169740167 20:8884694-8884716 TTTAAGAAGAAAAAAAAGATAGG + Exonic
1169859630 20:10137701-10137723 TTGAATTAGCAGAAAGACAAGGG + Intergenic
1170132733 20:13039995-13040017 TTTAAGAAGCTGGAAAGGAAAGG + Intronic
1170283181 20:14674599-14674621 GTTACGAAGTAGAAAGAGGATGG - Intronic
1170337464 20:15286083-15286105 TTTAAAATGCTGAGAGAGAAAGG + Intronic
1170503993 20:17005019-17005041 TTTAAATAGCAGATGGAGAAAGG - Intergenic
1170518609 20:17159473-17159495 TTTTAGGAGCAAAAAGAGACAGG - Intergenic
1170753423 20:19172933-19172955 TTTAAGAAGCTCAAAGGCAATGG + Intergenic
1170772814 20:19348865-19348887 TATAAGAAGCAGATACACAATGG - Intronic
1171076880 20:22136545-22136567 TTTAAGAAAAAGAAAAAGACTGG + Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1171874042 20:30555279-30555301 TTTAAGAAGGATAAAAAGATAGG + Intergenic
1172219049 20:33259834-33259856 TTTAAGAACAAGAGAGAGCAGGG - Intergenic
1172776737 20:37411784-37411806 TTTACGAAGGAGCAAGTGAAAGG - Intergenic
1172783257 20:37449836-37449858 TTTCAGACGCAGAAGGAGATTGG - Intergenic
1173089035 20:39952544-39952566 GGAAAGAAGGAGAAAGAGAAAGG + Intergenic
1173411922 20:42818926-42818948 CTGAAGTAGCAGAAAGAGATGGG + Intronic
1173708534 20:45134627-45134649 TTTAAGAAGAAGAGACAAAAAGG - Intergenic
1174159471 20:48540764-48540786 GTTGAGCAGGAGAAAGAGAAGGG - Intergenic
1174703837 20:52635967-52635989 TCCAGGCAGCAGAAAGAGAAAGG - Intergenic
1174794906 20:53513909-53513931 TCTAATCAGCAGAAAGAGAATGG - Intergenic
1174853810 20:54023571-54023593 TTTGATAAACAGAGAGAGAAAGG + Intronic
1174975932 20:55333916-55333938 TACAAGAAGCAGATGGAGAAAGG - Intergenic
1176031125 20:63012574-63012596 TTTAAGAAGGAAAAACAGGATGG - Intergenic
1176272637 20:64244371-64244393 TTTAAGAAGGACAGAGGGAATGG - Intergenic
1177261708 21:18737808-18737830 CTTGGGTAGCAGAAAGAGAAAGG + Intergenic
1177751499 21:25290524-25290546 TTTAACAAACAGTAAGAGAATGG + Intergenic
1177757325 21:25362816-25362838 TTCTAGAAGCAGAAATAGACTGG + Intergenic
1177760080 21:25393175-25393197 AATAAGAAGCAAGAAGAGAAAGG + Intergenic
1178054224 21:28781035-28781057 TTTAGGAACCAGAGAGAGAAAGG - Intergenic
1178319389 21:31593729-31593751 TTTAAAAAGTAAAAAGAGACAGG - Intergenic
1178477636 21:32951216-32951238 TTTAAGAAGCACAGAGAACACGG - Intergenic
1178545836 21:33492148-33492170 TTTAACAAGGAAAAAGAAAAAGG + Intergenic
1178672089 21:34600464-34600486 TCTAGGAACCAGAGAGAGAAGGG + Intronic
1179258753 21:39740137-39740159 ATTCAGAAGAAGAAATAGAATGG - Intergenic
1179340915 21:40508356-40508378 TTTATAAATCAAAAAGAGAAGGG + Intronic
1179675713 21:42980399-42980421 TGTAAATAGCAGAAATAGAAAGG + Intronic
1179876378 21:44270758-44270780 TTTAAAAAGAGGAAAGAGACTGG - Intergenic
1180021735 21:45132879-45132901 TAGACGAAGAAGAAAGAGAAGGG + Intronic
1181684961 22:24522080-24522102 TGGAGGAAGCAGACAGAGAAGGG - Intronic
1182274237 22:29175463-29175485 TATCAGAAGAAGAAAGAGAAAGG - Intergenic
1182692445 22:32173531-32173553 TGTGAGCAGCAGAGAGAGAATGG - Intergenic
1183179718 22:36251990-36252012 CTTATGAGGCAGGAAGAGAATGG - Intergenic
1183834791 22:40443478-40443500 TATATGAAGCAGAAAAAAAAAGG - Intronic
1184637648 22:45847708-45847730 GTTAAGCAGGAGAAAGAGCAGGG - Intergenic
1184931468 22:47684277-47684299 TTTGAGAAGCAGAAAAAATAAGG - Intergenic
949200680 3:1375323-1375345 TTTCAGTAGCAGAATGAGACTGG + Intronic
949399859 3:3654777-3654799 CTTGAGAAGCAGAAAACGAATGG + Intergenic
950039262 3:9909323-9909345 TGTAGGAGACAGAAAGAGAAAGG - Intronic
951041594 3:17994100-17994122 TTTATGGTGGAGAAAGAGAATGG + Intronic
951109193 3:18781793-18781815 TAAAAGAAACACAAAGAGAAAGG - Intergenic
951369198 3:21824632-21824654 TTTAAGAACCTGATAAAGAAGGG + Intronic
951569346 3:24045851-24045873 CTTAAGAAGCAGAAAATTAAGGG - Intergenic
951738469 3:25894194-25894216 TCCAAGGAGCAGAAAGAGGAAGG + Intergenic
952516944 3:34114011-34114033 ATGAAGAAGAAGAAAAAGAAAGG - Intergenic
952588356 3:34920506-34920528 ATTAAGAAGGAGAATGAGAATGG - Intergenic
952764577 3:36943859-36943881 TTTAAGAAGCAGAAAGAGAATGG - Intronic
952773531 3:37023025-37023047 TCTAAGAAGCAGAAAGATGGTGG - Intronic
952773710 3:37024671-37024693 TAAGAGAAGGAGAAAGAGAAGGG - Intronic
953090329 3:39718481-39718503 TATAAGGATCAGAATGAGAATGG + Intergenic
953735459 3:45490433-45490455 TTCAATAAGTAGAAGGAGAATGG + Intronic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954475398 3:50739675-50739697 TTTCAGAAGTATAAAGAGAATGG + Intronic
954571471 3:51644558-51644580 TTTAAAAAGTAGAAAGTGCAAGG + Intronic
954864816 3:53719282-53719304 ATCATGAAGCAGACAGAGAATGG + Intronic
955609460 3:60741676-60741698 GATAAGAAGGAGAAGGAGAAAGG - Intronic
955621519 3:60869430-60869452 ATTGAGAAGCAGAGATAGAAGGG - Intronic
955994406 3:64664870-64664892 TTCAAGAAGAAGCAAGAAAATGG - Intronic
956004868 3:64768115-64768137 TTCCAGAAGGAGAAAGAGATGGG + Intergenic
956356345 3:68397129-68397151 TTTAAAAAAAAGAAAGAAAACGG - Intronic
956367655 3:68522456-68522478 TTACTGAAGCAGAAAAAGAAAGG + Intronic
956544813 3:70389091-70389113 TGGAAGAAACAGAAAGGGAATGG - Intergenic
956562967 3:70602583-70602605 TCCAATAAGCAGAAAGAGATAGG + Intergenic
956887565 3:73575626-73575648 GTTCAGAAGAAGAAAGAGAAGGG + Intronic
957348571 3:78993945-78993967 TTAAAGGAAAAGAAAGAGAATGG + Intronic
957700475 3:83704044-83704066 TTTAAGAAGATCAAAGAGAATGG + Intergenic
958052079 3:88361520-88361542 TTTTAAAAGCAGCAAGACAAAGG - Intergenic
958098797 3:88982021-88982043 GTTAAGGAGATGAAAGAGAAGGG + Intergenic
958123636 3:89326828-89326850 TTAAAAAAACAGAAAGAGGATGG - Intronic
958530333 3:95321599-95321621 TTTCAGAAGAAGAAATTGAAGGG - Intergenic
958557755 3:95702451-95702473 TGCAAGAAGGAGAGAGAGAAGGG - Intergenic
958672541 3:97223058-97223080 TTAAAGCAGGAGAAAGAGCATGG + Intronic
958779894 3:98528216-98528238 TTGAAGATGAAGACAGAGAAAGG - Intronic
958801558 3:98762113-98762135 GTTGAAAAGCTGAAAGAGAAGGG + Intronic
959128543 3:102321553-102321575 TTTAAAAAACAGACAAAGAAGGG - Intronic
959139454 3:102467964-102467986 CATAAGAATCAGAAAGAAAATGG + Intronic
959297963 3:104561422-104561444 TTAAAGAATCAGAAAGTGACTGG + Intergenic
959333490 3:105035794-105035816 TTTTAGAAGCTGAGAGAGCAAGG - Intergenic
959341219 3:105134444-105134466 TTAAAGCAGAAGAAAGAAAAAGG + Intergenic
959404974 3:105950367-105950389 TCCCAGAAGAAGAAAGAGAATGG - Intergenic
960079134 3:113522534-113522556 TTTAAAAAAAAAAAAGAGAAAGG - Intergenic
960280029 3:115771085-115771107 TGTAAGAACCTGAAAAAGAAAGG - Intergenic
960436772 3:117635757-117635779 TTTTAGAAGCAGTAACAGATGGG - Intergenic
960581864 3:119287557-119287579 TTTTAAAAGGAGCAAGAGAAAGG - Intergenic
960878164 3:122317222-122317244 TTTAAGATGAAGAAATAGAATGG - Intergenic
960922712 3:122763958-122763980 TTTAACAGGCAGAAATTGAAGGG - Intronic
961659081 3:128458847-128458869 TTTAACAAGCCGAAGGAGATGGG + Intergenic
961878119 3:130039691-130039713 TTTAAAAAGCAAAGAAAGAAGGG - Intergenic
962210287 3:133471898-133471920 TTTCAGCAGCAGAGGGAGAAGGG + Intronic
962409100 3:135125876-135125898 TTCAAGAAGCAGAAGCAGACAGG - Intronic
962481665 3:135803301-135803323 TTTCAGAACCAGTAAGACAAAGG - Intergenic
963174706 3:142285514-142285536 CATAAGCAGAAGAAAGAGAAAGG - Intergenic
963489727 3:145984467-145984489 TTTCTGAAGGAGAAAGAGAACGG + Intergenic
963949708 3:151185469-151185491 TTCAACAAGCAGAAAGAAAATGG - Intronic
964215088 3:154271072-154271094 TTTAAGAACCAGAAAAAAAAAGG + Intergenic
964395383 3:156240247-156240269 TTTAAAAAGGAGAAAGACAAAGG - Intronic
964426142 3:156555528-156555550 TTGAAGAAGAAAGAAGAGAAAGG + Intergenic
964483813 3:157166657-157166679 TGTAAAAAGCAGGCAGAGAAGGG + Intergenic
965430653 3:168583787-168583809 ATTAACAAGAAAAAAGAGAAGGG + Intergenic
965811941 3:172600291-172600313 TTTAAAAAACTGAAAGAAAAGGG + Intergenic
965863040 3:173170148-173170170 TTAAAGAAGCAGGAAGGGAAGGG + Intergenic
966185913 3:177227088-177227110 TTTAAGAAGTCGAAGGGGAAGGG - Intergenic
966236019 3:177702435-177702457 TTTGAGAAGCAGAAACACCAAGG + Intergenic
966434779 3:179870952-179870974 TTTCAGAATCACAAAGAAAATGG - Intronic
966755309 3:183364646-183364668 CTTAAGAAGAAAAAAGAGAAGGG + Intronic
967162729 3:186753445-186753467 TGTAAGAACAAGAAAAAGAAAGG - Intergenic
967335970 3:188345176-188345198 TTTAAGAACTAGGAAGTGAAAGG - Intronic
967428729 3:189357561-189357583 TTTAAATAGCCAAAAGAGAAAGG - Intergenic
967490391 3:190083979-190084001 TTTAAAAAACATAATGAGAATGG - Intronic
967929681 3:194681702-194681724 TTAAAGAAGCAAAAAGAAATAGG + Intergenic
967967962 3:194977039-194977061 TGGAAAAAGCAGAAATAGAAGGG - Intergenic
968128035 3:196174702-196174724 TTTATGAAGCAGAAAAATGAGGG + Intergenic
968313550 3:197703713-197703735 TTGAGGAAGCAGAAAGGGAGAGG + Intronic
968684087 4:1944738-1944760 TTTTAGAAGCAGATATATAAAGG - Intronic
969658635 4:8512869-8512891 TTTAAGAAACAAAAACACAATGG - Intergenic
969990031 4:11252805-11252827 TGTAGAAAGCAGAAAGTGAAGGG + Intergenic
970358779 4:15285287-15285309 TATAAAAAGCAGAAAAAGAATGG + Intergenic
970708485 4:18833916-18833938 TGTAAGAAGGTGAAAGTGAAGGG + Intergenic
970916093 4:21337030-21337052 TTTAAGGAGAGGAAAGAGCATGG + Intronic
971226825 4:24761825-24761847 CTGAAGAAGGAGAAAGATAAAGG + Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971704385 4:30020748-30020770 TTTAATAATTAGAAAGAGAGAGG - Intergenic
971977158 4:33705085-33705107 TTTTATTAGCAGCAAGAGAATGG + Intergenic
971978957 4:33729717-33729739 ATTTTGAAGAAGAAAGAGAACGG + Intergenic
972808967 4:42561995-42562017 TATAAAAAGCAGAAAGATGAGGG - Intronic
973189740 4:47373244-47373266 TGGAAGAAGCAGAAAGAAAAAGG - Intronic
973196763 4:47453372-47453394 TTTGAAGAACAGAAAGAGAAAGG + Intronic
973222345 4:47742802-47742824 TTTAAGAAGAACAAAGATAGAGG + Intronic
973919607 4:55671897-55671919 TTCTAAAAGCAGCAAGAGAAAGG - Intergenic
974064773 4:57067502-57067524 TTATAGAAGCAGACACAGAATGG + Intronic
974244163 4:59291859-59291881 TTTAAGAGAATGAAAGAGAAAGG + Intergenic
974479790 4:62428322-62428344 TGTATGGAGCAGAAAGAAAAAGG + Intergenic
974642910 4:64654863-64654885 TTTCAGAAGCAGGAAGACAATGG - Intergenic
974853060 4:67426958-67426980 TTTCAGAATCAGTAAGAAAATGG - Intergenic
974908961 4:68092092-68092114 TTTAAAATGCAGTAAGAGATTGG - Intronic
975436859 4:74363888-74363910 TTTAAAAAGTAGAAATAAAAAGG + Intergenic
975453568 4:74560029-74560051 TTTTGAAAGCAGCAAGAGAAAGG + Intergenic
975608225 4:76177758-76177780 TTTAAAAAGCAGACACAGAAGGG + Intronic
976176599 4:82360305-82360327 TTTAAAATGCAGAAAGTGATGGG + Intronic
976194714 4:82521624-82521646 TGTAAGATGCTGAAAGGGAATGG + Intronic
976423086 4:84868233-84868255 ATTAAGAAGAAGAAAGAAAAAGG - Intronic
976720894 4:88167670-88167692 TTTAAAAGGCAGAAAGAGCCTGG - Intronic
976807260 4:89062389-89062411 TTTGAGTACCAGAAGGAGAAGGG - Intronic
977440585 4:97061916-97061938 TTTAGAAAACAGCAAGAGAAAGG + Intergenic
977482906 4:97600988-97601010 TATCAGAAGAAGAAATAGAAGGG + Intronic
977751900 4:100619847-100619869 TTTAAGAAAATGAAAGAGAATGG - Intronic
977839021 4:101678600-101678622 TCTCAGAACTAGAAAGAGAAGGG - Intronic
977922879 4:102665118-102665140 TTTTAGAAAGAGAAAGAAAAGGG + Intronic
978470555 4:109062460-109062482 TGTAATAATCAGAAATAGAATGG + Intronic
978521295 4:109618439-109618461 ATAAAGCAGGAGAAAGAGAATGG - Intronic
978894597 4:113871844-113871866 TTCAGGAAGGAGAAAAAGAAAGG - Intergenic
979014474 4:115415893-115415915 TTTAAGAAACAGAGAAAGAAGGG - Intergenic
979069775 4:116187235-116187257 CTGATGAAGCAGAAAGAGATAGG - Intergenic
979149373 4:117290066-117290088 TTGAAGCTGCAGAAAGTGAAAGG - Intergenic
979204443 4:118020658-118020680 TTTAAAATGCAGAATAAGAAAGG - Intergenic
979227514 4:118305837-118305859 TTATGGAAGCAGAAATAGAATGG - Intronic
979350034 4:119632745-119632767 GTGAAGAGGCAGCAAGAGAATGG + Intergenic
979634934 4:122945896-122945918 TTTAAGAGTCTGTAAGAGAAGGG + Intronic
979660531 4:123248658-123248680 GGTAAGAAGCAGGGAGAGAAGGG + Intronic
979802139 4:124923406-124923428 TATAGAAAGCAGAAAGATAAAGG + Intergenic
980173284 4:129314723-129314745 TTTAAAAAGCAAAAACAAAAAGG - Intergenic
980279477 4:130700891-130700913 TTGATGAAGCAGGAAGAAAACGG + Intergenic
980458088 4:133070854-133070876 TGTTTGAAGCAGAAAGAAAATGG - Intergenic
980508099 4:133748906-133748928 TTTAAACACCACAAAGAGAAAGG - Intergenic
980699951 4:136412524-136412546 TTTAAGAAGCTGAAAGTGGAAGG + Intergenic
981330256 4:143500002-143500024 TTCAAGCACCAGAATGAGAAGGG - Intergenic
981595793 4:146420335-146420357 TTCAAGAAACATAAAGAGACTGG - Intronic
981637862 4:146900672-146900694 TTTAAAAATCAGAATGAGAGGGG + Intronic
981676839 4:147352259-147352281 ATTCAGAATGAGAAAGAGAAGGG - Intergenic
981832238 4:149015617-149015639 TTTGAGAAGAAGAAATGGAAAGG - Intergenic
981892205 4:149752018-149752040 TTAAAACAGAAGAAAGAGAAAGG + Intergenic
982264460 4:153525639-153525661 ATTAAGAAACTGAAAGAAAAAGG - Intronic
982323666 4:154107284-154107306 TTCAAGAAACAAAAAGAGAGGGG + Intergenic
982554688 4:156843972-156843994 TAGAAGAAGCAGAAATAGCAAGG - Intronic
982644202 4:158002475-158002497 TCTTAGAAGCAGAAGTAGAATGG + Intergenic
982688901 4:158526397-158526419 TTTAAAAAGATGAAAGAGTATGG - Intronic
983036607 4:162874433-162874455 TTTAGGAAGCAGAAACAGCCTGG - Intergenic
983114177 4:163792067-163792089 TTTATGAAGCTGCAAGTGAAAGG - Intronic
983259978 4:165444934-165444956 TAAAATAAGAAGAAAGAGAATGG - Intronic
983950933 4:173640513-173640535 TTTATAAAGCAGAAAGAAATGGG - Intergenic
984004307 4:174290148-174290170 ATTAAGAAGAAGAAAGAGGCAGG - Intronic
984490397 4:180427318-180427340 TGTAGGAAGCAGTAAAAGAATGG + Intergenic
984510845 4:180676838-180676860 TTTAAGAGGAGGAAAGAGACCGG - Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
985145056 4:186887920-186887942 CTTAGGAAGCAGCATGAGAAGGG + Intergenic
985192061 4:187385084-187385106 TTTAAGAAAAGGAAAGAAAATGG + Intergenic
985208294 4:187564697-187564719 TTTCAGAAGAAGTAAGACAAAGG + Intergenic
985213733 4:187625876-187625898 TTTTCAAAGCAGGAAGAGAAAGG + Intergenic
985406151 4:189640195-189640217 TTTTCAAAGCAGCAAGAGAATGG - Intergenic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
985949362 5:3211406-3211428 TTCAAGTTGCAGAAAGAAAAAGG - Intergenic
986220299 5:5763060-5763082 TTAAAGAACCAAATAGAGAAAGG - Intergenic
986691399 5:10316625-10316647 GTCAAGAAGCAGAAGGAGCAGGG - Intergenic
986830827 5:11575840-11575862 TATAAGAATCACAAGGAGAATGG - Intronic
986948667 5:13055515-13055537 TTTAAGCAGCAGCAAGTGAATGG - Intergenic
987078360 5:14404360-14404382 TTTCAGAAATAGTAAGAGAAAGG - Intronic
987102115 5:14600704-14600726 ATTAAGAAGAATAAAGAGTATGG - Intronic
987468401 5:18299767-18299789 TTTATTAAGAAGAGAGAGAATGG - Intergenic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
987941219 5:24540583-24540605 TTTGAGAATCAGAAAATGAAAGG + Intronic
988202550 5:28086230-28086252 ATTCAGAAGAAGAGAGAGAAAGG + Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
988775681 5:34476234-34476256 TTTCAGAAACATAAAGACAATGG + Intergenic
990078108 5:51876297-51876319 TCTAAGAAGAAAAAAGAGAATGG - Intergenic
990153423 5:52846694-52846716 TGAAGGAAGCAGAAAAAGAATGG - Intronic
990155832 5:52876426-52876448 CTTAGGAACCAGAAAGAGTAAGG - Intronic
990190561 5:53255454-53255476 TTTAAAACACAGAAAGAAAATGG - Intergenic
990439779 5:55832881-55832903 TTGAAGAAAGAGAAAGAGAATGG + Intergenic
990647423 5:57859913-57859935 TTTAAGGAGCAGAACCAGTATGG + Intergenic
990993390 5:61707154-61707176 CTTAGGAAGCTGAAACAGAAAGG + Intronic
991170821 5:63623506-63623528 TGTAAGTAGAACAAAGAGAAGGG + Intergenic
991295724 5:65078166-65078188 AGAAAGAAACAGAAAGAGAAAGG + Intergenic
991711901 5:69416269-69416291 TTTTAGAGAAAGAAAGAGAAAGG + Intronic
992345386 5:75870754-75870776 TCTTAAAAGCATAAAGAGAACGG + Intergenic
992467595 5:77022481-77022503 GAGAAGAAGAAGAAAGAGAAGGG + Intergenic
993486596 5:88494981-88495003 TATAAGAAGAACACAGAGAAAGG + Intergenic
993784352 5:92110168-92110190 TTTAAGAAGTATAAAGGGTAAGG + Intergenic
993844815 5:92927915-92927937 GTTAATAGGCAGAAAGAGATTGG + Intergenic
993916767 5:93753636-93753658 TTTAAAAAGAAGAAAGGAAAAGG - Intronic
994744949 5:103666565-103666587 TCTCAGAAGCAGAAAGGGAGTGG - Intergenic
994784976 5:104147078-104147100 TTTAAAAAGTAAAATGAGAAAGG + Intergenic
994814782 5:104571307-104571329 TTTAAGAAACAGGCAAAGAACGG - Intergenic
995219681 5:109634024-109634046 TTTTAGAAATAGAAAGAGAGAGG + Intergenic
995288872 5:110426117-110426139 TAGAAGAAGGAGAAAGAGAAAGG - Intronic
995715539 5:115078787-115078809 TTAAGGAAGCAGAGAGAGAAGGG + Intergenic
996171583 5:120299259-120299281 ATTATTAAGCAGAAAGAGAGTGG + Intergenic
996840747 5:127844967-127844989 TCAAAGAACCACAAAGAGAAGGG - Intergenic
996852805 5:127971521-127971543 TTTAATAAGAAGAAAGAGAAAGG - Intergenic
996886271 5:128357517-128357539 TCTATGAAGCATAAAGTGAATGG + Intronic
996931687 5:128896557-128896579 TTTTAGAAGAGGAGAGAGAAGGG - Intronic
996937723 5:128967169-128967191 GATAAGAAGAAGAAACAGAAAGG - Intronic
996939290 5:128984507-128984529 TTTAAGGTTCAGAAAGAAAAAGG - Intronic
997038260 5:130219253-130219275 TTAACAAAGAAGAAAGAGAAAGG + Intergenic
997362207 5:133302318-133302340 CTTGATAAGCAGGAAGAGAAAGG - Intronic
997487089 5:134240386-134240408 TTTCAGAAGCTGAGCGAGAAGGG + Intergenic
997743198 5:136275884-136275906 TGTTGAAAGCAGAAAGAGAATGG + Intronic
997906467 5:137822359-137822381 TTTAGGCAGCACAAAAAGAAGGG + Intergenic
998524714 5:142831849-142831871 TGCAAGGAGCAGAGAGAGAAAGG - Intronic
998848336 5:146332141-146332163 TAAAAGAAGAAGAAAAAGAAAGG - Intronic
998895180 5:146791301-146791323 TATAAGAAGCAGAAAAAGATTGG - Intronic
999014549 5:148086421-148086443 TTAAAAAAGGAGAAAGAGATGGG + Exonic
999442157 5:151610517-151610539 TTTAAAAAGCAAAAAGAAACAGG + Intergenic
999530977 5:152463454-152463476 TTCAAGAAGCAGACAGGGGAGGG - Intergenic
999601817 5:153274828-153274850 TATAAGAAGAAGAAGAAGAAAGG - Intergenic
999669818 5:153949195-153949217 TTTAGGAAATAGAAAGACAATGG + Intergenic
999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG + Exonic
999880107 5:155853251-155853273 TGTAAGAAGCTAAATGAGAAGGG - Intergenic
1000254342 5:159523694-159523716 TTTAAAAAAGAGAGAGAGAATGG - Intergenic
1000687667 5:164272647-164272669 GCTGAGAGGCAGAAAGAGAAAGG + Intergenic
1000742815 5:164991343-164991365 TATATGAAGCATAAAGAGAATGG - Intergenic
1000781033 5:165481390-165481412 TTTAGGAATAAGAAAGATAAAGG + Intergenic
1001735887 5:174000765-174000787 TTTAAGAAGGAGAATGAGGTGGG + Intronic
1002408680 5:179056007-179056029 TTGCTGAAGCAGAAAGAAAAGGG - Intergenic
1002692603 5:181060596-181060618 TTTAAAAAGGAGAAACAGGAAGG + Exonic
1002797678 6:488028-488050 TTAGAGAAGCAGCAAGAAAAAGG + Intronic
1002838270 6:883908-883930 CTTTAGAAGCCGAAAGAGAGAGG + Intergenic
1003096990 6:3149957-3149979 TAGAAGAAGCAGAATGAAAAAGG + Intronic
1003127362 6:3366023-3366045 TGTCAGCATCAGAAAGAGAAGGG + Intronic
1003317799 6:5027571-5027593 TTTTATCAGCAGAAAGAAAAAGG - Intergenic
1003482967 6:6549963-6549985 TTTAAAAAGCAAAAAGAAACTGG - Intergenic
1003837656 6:10088963-10088985 GTTTAGAAGCTGAAGGAGAAAGG - Intronic
1003841802 6:10128324-10128346 TTCAGGAAGGAGAAAGATAAGGG + Intronic
1004005130 6:11631422-11631444 TTTAAGAAAAAGAAATAAAAAGG - Intergenic
1004068661 6:12276282-12276304 TTCCAGTAGCAGAAAGAGAAAGG + Intergenic
1004804305 6:19185346-19185368 TTGAAGAAGCACACTGAGAAAGG + Intergenic
1004815566 6:19308550-19308572 TTTAATAAGCATTAATAGAATGG + Intergenic
1004842966 6:19607892-19607914 TAAAAGAAGAAGAAAGAGAAAGG + Intergenic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1005489490 6:26334043-26334065 TTTGACCAACAGAAAGAGAAAGG - Intergenic
1006876862 6:37305268-37305290 TTTAAAAAGCAGAAAAGGAATGG - Intronic
1007256007 6:40529165-40529187 TGGAAGAAGCAGAGAGAGCAGGG + Intronic
1007447675 6:41919770-41919792 TTTAAAAAAAAGAAAGAGCAAGG + Intronic
1007506500 6:42339227-42339249 TGTAAGTAGCAGAAAAACAAAGG - Intronic
1007619050 6:43200577-43200599 TCTAAGGAGCAGGAAGGGAAGGG - Intronic
1007624790 6:43238841-43238863 TTTAAGAAGCAAAAACAGGCCGG - Intergenic
1008302503 6:49858714-49858736 TTTGAGCATTAGAAAGAGAAAGG - Intronic
1008440329 6:51525440-51525462 ATTCAGAATGAGAAAGAGAAGGG + Intergenic
1008646939 6:53524120-53524142 TTAAATAAGCATAATGAGAAAGG + Intronic
1008713748 6:54262786-54262808 TTTAAGAAAAAGAAGGAGGAGGG + Intronic
1008741888 6:54618540-54618562 TATAAGAGGAAGGAAGAGAATGG - Intergenic
1008864910 6:56198645-56198667 ATTAAGAAACAAAAAGTGAAAGG + Intronic
1008900442 6:56608586-56608608 TTGAAGAAGCTGTCAGAGAAGGG - Intronic
1009636098 6:66266274-66266296 TTTAATACGCTGAAAGAGATGGG - Intergenic
1009661521 6:66618140-66618162 TTTGAGAAACAAAAAGAAAATGG - Intergenic
1009715218 6:67384203-67384225 TTTTAAAAGCAGAAACAAAAAGG + Intergenic
1009828249 6:68896635-68896657 CTTGAGAAGCAGAAAGCGTATGG + Intronic
1009863407 6:69365286-69365308 TTCCAAAAGCAGAAAGAGTAAGG - Intronic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010086160 6:71920829-71920851 GCTAAGAACAAGAAAGAGAAAGG + Intronic
1010406286 6:75509593-75509615 TTCAAGAAACATAAAGACAATGG + Intergenic
1010650240 6:78445937-78445959 TTTAACAAGCAGATAAAGACTGG + Intergenic
1011118473 6:83923027-83923049 TTTAAGGAGAAAAAAAAGAAAGG - Intronic
1011159662 6:84374757-84374779 TTGAAGAAGCTGAAGGAGATGGG - Intergenic
1011167687 6:84468083-84468105 TGTACGTAGCAGAAAGAGTATGG - Intergenic
1011456604 6:87557083-87557105 TTTAAGAAGCATAAAGTGCTAGG + Intronic
1011717764 6:90124937-90124959 TTTAAGTATCAGATAGACAAAGG - Intronic
1011833316 6:91400874-91400896 TTTAAAAAAAAGAAAAAGAAAGG - Intergenic
1012139286 6:95602044-95602066 TTTAACAAGGAAAAAGAAAAAGG - Intronic
1012140828 6:95624777-95624799 TTTAAGAAGCAGTGAGATAATGG - Intergenic
1012521885 6:100131181-100131203 TTTTAGAAGGAGAGCGAGAAAGG - Intergenic
1012756397 6:103237274-103237296 TTTAAAAAGCTGGAAAAGAAAGG + Intergenic
1012832749 6:104226287-104226309 TTTAAAAAGAAAACAGAGAAGGG + Intergenic
1012877640 6:104746999-104747021 TTCAAGAAGAAGAAAAAGAAAGG + Intronic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013723785 6:113066327-113066349 TTTTGGAAGAAGAAAGAGAGGGG + Intergenic
1013932874 6:115555947-115555969 TTTAAGAAGCATAAAAGAAATGG + Intergenic
1014092670 6:117422018-117422040 TCTAAGAAACAAAAACAGAAAGG - Intronic
1014149803 6:118041647-118041669 TTAAAGAGGGAGATAGAGAAAGG + Intronic
1014189571 6:118478040-118478062 TTAAGGAAGTAGAAAGTGAAGGG + Intronic
1014588585 6:123232513-123232535 TCTGAGAAGCAGAAAGGGCAAGG + Intronic
1014595886 6:123338281-123338303 TTAGAGAAACAGAGAGAGAATGG + Intronic
1014627804 6:123751037-123751059 TTTAAAAAGCAAAAAGAAATAGG + Intergenic
1014701560 6:124695254-124695276 TTTCAGAAGCAGAGGCAGAAAGG - Intronic
1015178830 6:130339718-130339740 TTTAGAAAGGAGAAAGAGCATGG - Intronic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1016012403 6:139151478-139151500 ATTAAGTAGCAGAAAAAGCACGG - Intronic
1016087671 6:139934371-139934393 TTACAGAAGAAGAAAGAGCATGG + Intergenic
1016092300 6:139994498-139994520 TTTGAGAGGCAGAAAGAGAATGG + Intergenic
1016280207 6:142408474-142408496 CTCAATAATCAGAAAGAGAAGGG + Intronic
1016731850 6:147436038-147436060 TTGCAGAAGGACAAAGAGAAGGG - Intergenic
1016872099 6:148828043-148828065 ATTAAGATTCAGAAAGTGAATGG - Intronic
1016923948 6:149321884-149321906 TTTATGAAGCATAAAGGTAAGGG - Intronic
1016932504 6:149425011-149425033 TTTTAGAGGCACAGAGAGAACGG + Intergenic
1017142067 6:151200084-151200106 TTTAATAAGAAGAAAAAGATTGG - Intergenic
1017372321 6:153726866-153726888 TTTAAGAAGCATAATATGAAGGG + Intergenic
1017389279 6:153922025-153922047 TTTAAAAAGAGGAAAGAAAAGGG - Intergenic
1017676428 6:156819180-156819202 TTTAAGAAGGAGAAATAATATGG - Intronic
1017747836 6:157462690-157462712 TTTAAGGAGCAGACAGCTAAGGG - Intronic
1018101840 6:160447099-160447121 TCTAAAGAGCAGAAAAAGAAAGG + Intronic
1018519658 6:164633277-164633299 TTTCAAAAAAAGAAAGAGAATGG - Intergenic
1018520692 6:164647117-164647139 TATAAAAATGAGAAAGAGAAAGG + Intergenic
1019401910 7:859642-859664 GTTACGAAGCAAGAAGAGAAAGG + Intronic
1019745455 7:2697774-2697796 TTTATGAAGCAAAAAGATACAGG + Intronic
1019769580 7:2875281-2875303 TTCCAGAAGCAGGAAGAGACAGG - Intergenic
1019863763 7:3685658-3685680 TTTTAGAAGTAGAAAAGGAAAGG + Intronic
1020485948 7:8720925-8720947 GTAAAGAACCAGAAATAGAAGGG + Intronic
1020521214 7:9189711-9189733 AATAGGAAGAAGAAAGAGAAAGG + Intergenic
1020644759 7:10801310-10801332 TGAATGCAGCAGAAAGAGAAGGG + Intergenic
1020695143 7:11404642-11404664 TTTCAGCAGCAGGAAGTGAAAGG + Intronic
1020735170 7:11939312-11939334 TTAAAGGAGCAGAGAAAGAATGG + Intergenic
1020743199 7:12048604-12048626 TTAAGGATGGAGAAAGAGAAAGG - Intergenic
1020752099 7:12155123-12155145 TTTAAACAAAAGAAAGAGAATGG + Intergenic
1020800975 7:12731623-12731645 TTTAAGGAGAAGAAAAAAAAAGG + Intergenic
1020906637 7:14071480-14071502 TTTCAGAATTAGAAAAAGAAGGG - Intergenic
1020950025 7:14663733-14663755 TTTATGAGACAGAGAGAGAAAGG - Intronic
1021827277 7:24567938-24567960 TTTATGAAGCAGAATAGGAAAGG + Intergenic
1022183136 7:27941269-27941291 TTTATGAAGGAAAAAGGGAAGGG - Intronic
1022260484 7:28699704-28699726 TTTTAGAAACAGAAATAGTAGGG + Intronic
1022270668 7:28804548-28804570 GTTAAGAAGGAGAATAAGAAGGG - Intronic
1022280396 7:28902881-28902903 TTAAAGAAGCCAAAAGACAATGG - Intergenic
1022364211 7:29695047-29695069 TTTTAGAGGCAGACATAGAATGG - Intergenic
1022420223 7:30213330-30213352 AGTAAGAAACAGAAAGAGGAAGG - Intergenic
1022602946 7:31778940-31778962 GTTAAGAAGCAGCAAGAGTCAGG - Intronic
1023068031 7:36398910-36398932 TCTAAGTTGCTGAAAGAGAATGG + Intronic
1023128486 7:36978546-36978568 TTCAAGAAGAAGAAAGAGTTGGG + Intronic
1023182081 7:37495007-37495029 TATAGGAAGCAGAAAAAAAAAGG + Intergenic
1024086800 7:45900093-45900115 CCAAAGAAGCAGTAAGAGAAAGG - Intergenic
1024092586 7:45957154-45957176 TTTAAAAAGTAGTAAGAGGAAGG - Intergenic
1024207934 7:47179765-47179787 GTGCAGAAGGAGAAAGAGAAGGG + Intergenic
1024368869 7:48557599-48557621 TTCTAAAAGCAGCAAGAGAAAGG - Intronic
1024625042 7:51200017-51200039 TTTTGAAAGCAGCAAGAGAAAGG + Intronic
1024695057 7:51847289-51847311 TTTAGGAAGTAGGAAGAGAAAGG - Intergenic
1024707847 7:51980627-51980649 AGAAAGAAGGAGAAAGAGAATGG - Intergenic
1024741630 7:52361576-52361598 TTTAAAAGACAGTAAGAGAAGGG + Intergenic
1025975469 7:66366099-66366121 TTTAAGAAGGAGGAAGAAATGGG - Intronic
1026015863 7:66670053-66670075 TTTAAGAAGGAGAATGAGATGGG - Intronic
1026405501 7:70061469-70061491 TTTAAGAGAGAGGAAGAGAATGG + Intronic
1026543161 7:71298525-71298547 TTTCTGAACCAGAAAGAAAAAGG - Intronic
1026892491 7:73990432-73990454 TTTAAGCAGGAGAATGAGATGGG - Intergenic
1027161806 7:75808190-75808212 TTTAAGCAGCAGACATATAAGGG - Intergenic
1027760306 7:82269436-82269458 GTTATGAAGCAGGAAGAAAATGG - Intronic
1027849177 7:83427231-83427253 TTGAAGAAAAAGAAAGAGAAAGG - Intronic
1027983602 7:85257005-85257027 TTAAAGAAGCAAGAAGAGTAGGG - Intergenic
1028015970 7:85713071-85713093 TTTTAAAATCAGAAAAAGAAAGG - Intergenic
1028217337 7:88150588-88150610 TTTCAGAGCAAGAAAGAGAAGGG - Intronic
1028493424 7:91439286-91439308 TTTAAGATGGAGTAAGAGATTGG - Intergenic
1028638225 7:93015067-93015089 TTTAAGAAGAAGAAACAGATGGG - Intergenic
1028859659 7:95634585-95634607 TTTAAGAAGTGGACAGAGAGGGG + Intergenic
1028960343 7:96741792-96741814 TTCAAGGATCAGGAAGAGAAAGG + Intergenic
1029651129 7:101892897-101892919 CTGAAGAAGGAAAAAGAGAAAGG - Intronic
1029881292 7:103813157-103813179 ATTAATATGTAGAAAGAGAAAGG - Intronic
1029941367 7:104484082-104484104 TTTAAGAGGAAGAAAGGGAAAGG - Intronic
1030379281 7:108793927-108793949 TTTAAGAAACAGAGTAAGAAAGG - Intergenic
1030523660 7:110628586-110628608 TTTAAAAAACAAAAAGAGATAGG + Intergenic
1030846664 7:114423367-114423389 TTAAAAAAGAAGAAAGAAAAAGG + Intronic
1030883497 7:114911215-114911237 TTTAAACAAAAGAAAGAGAATGG - Intergenic
1031436940 7:121743813-121743835 TTTAAAAAGAAGAAATAAAATGG - Intergenic
1031624379 7:123975240-123975262 TTTTAGAATCAGAATCAGAAAGG - Intergenic
1032006187 7:128303760-128303782 TTTAAGAAGCCATAAGAGAAAGG + Exonic
1032225182 7:130025497-130025519 TTTAAGAAGGAAAAATAGAAAGG - Intronic
1032369949 7:131338897-131338919 GCTGAGAAGGAGAAAGAGAAGGG - Intronic
1032699095 7:134363163-134363185 TTGAATAAGCAGCATGAGAAGGG - Intergenic
1032937639 7:136751780-136751802 TTACAGAAGCAGAGATAGAATGG + Intergenic
1032961588 7:137041622-137041644 ATGAAGAAGCAGCAAGAAAATGG - Intergenic
1032976330 7:137228048-137228070 TCTAAGAAGAAGAAAAAGGAAGG - Exonic
1033091120 7:138387094-138387116 TTGAACAAGCAGAATGTGAATGG + Intergenic
1033194059 7:139311643-139311665 TTTAAGAAGTAAAAAGACAGAGG - Intergenic
1033941591 7:146661536-146661558 TGAAAGAAGCAGAAATAGCATGG - Intronic
1034134564 7:148754468-148754490 TTTAAAAAACAGAAAGAGCTGGG - Intronic
1034516726 7:151586796-151586818 ATTAAGAGGCACAAAGGGAAGGG - Intronic
1034524525 7:151648852-151648874 TTTAAAAAACAGAAAGAAAGGGG + Intronic
1035017256 7:155777488-155777510 GGAAAGAAGCAGAATGAGAAAGG + Exonic
1035193346 7:157192302-157192324 GTTAAGAAATAGTAAGAGAAGGG + Intronic
1035796106 8:2358310-2358332 TAAAAGAAGAAGAAATAGAAAGG + Intergenic
1035942237 8:3914305-3914327 TTTAAGAACGAGGAAGAGAATGG + Intronic
1036100728 8:5781098-5781120 TTGAAGAAATCGAAAGAGAATGG - Intergenic
1036645605 8:10610000-10610022 TTGAAGAAACAGGAGGAGAAGGG - Exonic
1037069625 8:14627802-14627824 TTTAGGAAGCTGAAAAGGAAAGG + Intronic
1037236809 8:16730026-16730048 TTTAAGAACAATAAAGAGAAAGG + Intergenic
1037267220 8:17077228-17077250 TGGATGAAGCAGAAAGACAAGGG - Intronic
1037312184 8:17567978-17568000 ATTCACAAGCAGAAACAGAAAGG - Exonic
1037754490 8:21702312-21702334 GGAAGGAAGCAGAAAGAGAAGGG + Intronic
1038351763 8:26782412-26782434 TTTAACACGCAGAAAGGGATTGG + Intronic
1038432006 8:27507868-27507890 GTTAGGAAGCAGAAAGACACAGG - Intronic
1038679137 8:29650898-29650920 TTTAAGAAGAAATAAGAGATAGG - Intergenic
1038688473 8:29740021-29740043 TGTTAGGAGCTGAAAGAGAAAGG + Intergenic
1039874899 8:41577414-41577436 TTTAAGAACAGGAAAAAGAAAGG + Intronic
1039976565 8:42371450-42371472 TTTCAGAAGAAAAAAGAAAATGG - Intronic
1040049541 8:42999513-42999535 TTTAAGTTAGAGAAAGAGAAAGG - Intronic
1040558384 8:48501228-48501250 TTTAGAAAGCTGAAAGAAAATGG + Intergenic
1040583564 8:48717269-48717291 TTTTGAAAGCAGCAAGAGAAAGG + Intronic
1040683873 8:49847053-49847075 TTCAAGAAGCTGAAATAGGAAGG - Intergenic
1041121401 8:54590097-54590119 GTTAAGAAGGTGAAAGAGAATGG - Intergenic
1041472651 8:58228366-58228388 TGTAAGACCCAGAAATAGAAAGG + Intergenic
1041524774 8:58792936-58792958 TGGAAGAAACAGAAAAAGAAGGG + Intergenic
1041617069 8:59919654-59919676 TTAAAGAAGATGAAAGAAAAGGG - Intergenic
1041903883 8:63010555-63010577 TTTACAAAACTGAAAGAGAAAGG + Intergenic
1042069774 8:64918836-64918858 TTGAAGGAGGAGAAAGAGATAGG + Intergenic
1042363678 8:67911663-67911685 TTTTAGAAGCTGAGAGAGGATGG - Intergenic
1042381934 8:68125899-68125921 TTTAAGAATCATAAAAAGATAGG - Intronic
1043080421 8:75758891-75758913 TTTATGATGCAGAAAGGAAAGGG - Intergenic
1043360275 8:79464073-79464095 TTTGAGAACAAGAAAGAGGATGG - Intergenic
1043387734 8:79765288-79765310 TGGAAGGAGCCGAAAGAGAAGGG + Exonic
1043493890 8:80779124-80779146 GGAAAGAAGGAGAAAGAGAAAGG - Intronic
1043523023 8:81066717-81066739 TTTCAAAAGAGGAAAGAGAAAGG + Intronic
1043609651 8:82046211-82046233 TTGTAGAAGCAGGAAGAGAGTGG - Intergenic
1043691531 8:83159519-83159541 TTCACCAAGCAGAAAGAGAAGGG + Intergenic
1043692918 8:83179934-83179956 TTTAAGAAATAGAGAGAGACGGG + Intergenic
1044272007 8:90256274-90256296 ATTAAGAAGTAGAAAAATAAGGG + Intergenic
1044360966 8:91283233-91283255 TTAAAAATACAGAAAGAGAAGGG + Intronic
1044401958 8:91783077-91783099 TTTGAGAATCAGGAAGAGACAGG - Intergenic
1044732764 8:95244349-95244371 TTTAAGAATATGAAAGAAAAAGG - Intergenic
1044784081 8:95776449-95776471 AATAAGCATCAGAAAGAGAAAGG - Intergenic
1044891370 8:96839704-96839726 TTTATGTAGCCAAAAGAGAAGGG + Intronic
1045041884 8:98232679-98232701 TTAAAAAAGAAAAAAGAGAAAGG + Intronic
1045242534 8:100415242-100415264 TTCTTGAAGCAGAAAGAGAAGGG + Intergenic
1045290008 8:100824990-100825012 TCAAAGAGGCAGAAATAGAATGG - Intergenic
1045326387 8:101120718-101120740 TTTGAGAAGCAAAATGAAAAAGG - Intergenic
1045330398 8:101151134-101151156 TTTAAGGAACAGAAAGAACAGGG - Intergenic
1045345173 8:101287603-101287625 TTCAAGAAGAGGAAAGAGCAGGG - Intergenic
1045837031 8:106534812-106534834 TTAAAGAAGCAGAAAGAAAATGG + Intronic
1045927924 8:107592329-107592351 TTTAATATGCAGAAGGAAAAAGG + Intergenic
1046006102 8:108487325-108487347 TTAAAGAATCATAAAGAGTAGGG + Intergenic
1046156759 8:110301336-110301358 TTCAAAAAGCAGAAAGAGGCCGG + Intergenic
1046248845 8:111603479-111603501 ATTAAGCAAAAGAAAGAGAAAGG + Intergenic
1046638413 8:116698720-116698742 ATTAAGTTGCAGAAAGAGATTGG - Intronic
1046729495 8:117709825-117709847 TTTAGTAGGCAGAAAGAGAGTGG + Intergenic
1046922584 8:119748224-119748246 TTTAAAAAGGAGAAACAAAAAGG + Intronic
1047085020 8:121506530-121506552 GTCAAGAGGCAGAAAGAGAAAGG - Intergenic
1047292731 8:123543761-123543783 TTTAAGGAACAGAAAGCGGAAGG - Intergenic
1047551370 8:125876092-125876114 TTTAAGAAGGAGAAATTGCAAGG - Intergenic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1047855798 8:128910358-128910380 TTTTAAAAGCAGCAAGAGAGAGG + Intergenic
1047857752 8:128930946-128930968 TTCCAGAAGCAGACAGGGAAAGG - Intergenic
1047920297 8:129628454-129628476 TTTAAGAAGAAAAAGAAGAAAGG + Intergenic
1048080512 8:131121644-131121666 TTAAAGAAAAACAAAGAGAAAGG + Intergenic
1048225994 8:132586125-132586147 TTAGAGAAGGAGAGAGAGAACGG + Intronic
1048524840 8:135192917-135192939 TTTAAGAAGACGAAAGGTAAAGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1048804245 8:138224870-138224892 TTGTAGAAACAGAAATAGAAAGG + Intronic
1049101864 8:140585629-140585651 TTTAAGCAGCAGCAAGGGAGGGG - Intronic
1050001874 9:1085688-1085710 TTTAAGTGGCAGAAAGAGGTGGG - Intergenic
1050471443 9:5995299-5995321 TTTGAGAAGCAGGAAGTTAATGG - Intronic
1051000046 9:12270516-12270538 ATTAAGAAGCAAAAAGCAAAGGG - Intergenic
1051220123 9:14839491-14839513 TGTTAGAAAGAGAAAGAGAAGGG - Intronic
1051263893 9:15292511-15292533 TTTAATAGGTAGAAGGAGAAGGG - Intronic
1051491472 9:17671347-17671369 TTTAAGAATCAGAAAGTTACTGG + Intronic
1052129474 9:24824838-24824860 TTCAAGTAACAGCAAGAGAAAGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052695541 9:31872747-31872769 TAAAAGAACCAAAAAGAGAATGG + Intergenic
1053046559 9:34924913-34924935 TATACAAAGAAGAAAGAGAAAGG - Intergenic
1055292231 9:74794072-74794094 TTTAAGAAGCAGCAATGTAAGGG + Intronic
1055420672 9:76137894-76137916 TTTCCTAAGCAGAAAGGGAAGGG - Intronic
1055588123 9:77778486-77778508 CATAAGAGGCAGAAAGAGAGTGG + Intronic
1056187716 9:84152090-84152112 ATAAAAAAGCAAAAAGAGAAAGG + Intergenic
1056231507 9:84550198-84550220 TTTACCAGGCAGAAACAGAAAGG - Intergenic
1056554893 9:87679999-87680021 ATTAAGAGGCTGAAAGAAAATGG - Intronic
1056658531 9:88528001-88528023 TTCAAAAAGCAGGAAAAGAATGG - Intergenic
1056746168 9:89305305-89305327 TTTAGGAAGATCAAAGAGAAAGG - Intergenic
1056798921 9:89677925-89677947 CCTAAGAAGAAGAAAGAGAGAGG + Intergenic
1056819613 9:89829476-89829498 ATTAAGAAGCAGAGAGAACAGGG + Intergenic
1057383744 9:94590338-94590360 CATAAGAAGAGGAAAGAGAAGGG + Intronic
1057446985 9:95123341-95123363 TTTAAAAAGCAGAAACAGGCTGG + Intronic
1057493859 9:95544337-95544359 TTTCAGAAGCAGTAAGAGACTGG - Intergenic
1057536878 9:95918751-95918773 TTTAAAAAACACAATGAGAATGG - Intronic
1057601272 9:96459637-96459659 GTCAAGAAGCAGAAAGAGTTTGG - Intronic
1057885690 9:98828000-98828022 TCTATGATGCAGAAACAGAAAGG - Intronic
1058301643 9:103380951-103380973 TTTAAGAAAGAGTAATAGAATGG - Intergenic
1058578858 9:106433052-106433074 TTCAAGAAGTAGAAAGAACATGG + Intergenic
1058771865 9:108241849-108241871 AATAAGAACCAGAAAGAAAATGG + Intergenic
1059009120 9:110437571-110437593 TCTAAGAGGCAGGCAGAGAAGGG - Intronic
1059044990 9:110856759-110856781 TTTGAGAAGAATAAAGACAATGG - Intergenic
1059056329 9:110984962-110984984 TTAAAGAATCAAAAAGAAAAAGG + Intronic
1059521872 9:114950293-114950315 ATTAAGAAGCATTTAGAGAAGGG - Intergenic
1059743198 9:117173785-117173807 TTTAAGAAGTTAAAAAAGAATGG + Intronic
1059929361 9:119245664-119245686 TTTAGGAAGAGGAAAGAGGAAGG - Intronic
1059963228 9:119587992-119588014 TTTAAAAAAAAAAAAGAGAAAGG + Intergenic
1060146906 9:121260866-121260888 TGTAAGAAGGAGAAAGTGGAAGG + Intronic
1060290045 9:122293620-122293642 TTTAAGAAGCAGATAGACCTAGG + Intronic
1060419214 9:123455486-123455508 TTTACTAAGCAGAGAGAGTAGGG - Intronic
1061373452 9:130210778-130210800 TTTAAGAAACTGAAAAAGAAGGG - Intronic
1061774912 9:132955586-132955608 TTTAAAAAGCTGAAAGAGGCTGG - Intronic
1185772140 X:2773039-2773061 TTTAAAAAGGAGACAGAGAAAGG + Intronic
1185861154 X:3580918-3580940 TTTAGGTGGCAGACAGAGAATGG - Intergenic
1186318590 X:8398964-8398986 TATAAGAAGCAAAAAGAGGACGG - Intergenic
1186368345 X:8919397-8919419 TTGAAGATGCAGTGAGAGAATGG - Intergenic
1187061112 X:15788151-15788173 GTCAAGAAGCAGAAAGGTAAAGG + Intergenic
1187128170 X:16474150-16474172 TTATAAAAGTAGAAAGAGAATGG + Intergenic
1187557818 X:20368940-20368962 GTGAAGAAGCAGAAAGAGTGCGG - Intergenic
1187659525 X:21525476-21525498 TTAAAGAAAGAGAGAGAGAAAGG - Intronic
1187730625 X:22250280-22250302 ATTAAGTGGTAGAAAGAGAAAGG + Exonic
1187985864 X:24810316-24810338 TTTAAGAAGCGGAAACATAATGG - Intronic
1188563837 X:31501853-31501875 TTAAACATGCAGAAAGAAAAGGG + Intronic
1188829701 X:34881396-34881418 TTTAGGAGGCAGAGAGAGCAAGG + Intergenic
1188893636 X:35640270-35640292 TGAAGGAAGCAGAAAGGGAAAGG + Intergenic
1189184916 X:39046146-39046168 TTTAACAAGTAAAAACAGAAAGG + Intergenic
1189867377 X:45345143-45345165 TTTAAGAAGCAAAGAGCTAATGG - Intergenic
1190894104 X:54598910-54598932 TATGAGGAGAAGAAAGAGAATGG + Intergenic
1191592309 X:62901108-62901130 TTAAAGAAGAAGAAAAACAAAGG - Intergenic
1191724350 X:64263328-64263350 TTTAAAAAGCACCAAGAGACAGG + Intergenic
1192094086 X:68192151-68192173 TGTAAAAAACAGAAAGATAAAGG + Intronic
1192115055 X:68402153-68402175 AGTAAGAAGGAGCAAGAGAAAGG + Intronic
1192206879 X:69102188-69102210 TCTTAGAGGCAGAAAGTGAAAGG - Intergenic
1192557174 X:72099696-72099718 TTTAAAAAGTAAAAAGAAAAAGG + Intergenic
1193007983 X:76642720-76642742 TTAAAGAAGAAGAATGAGAAAGG + Intergenic
1193234997 X:79095891-79095913 TTTAAGAACAAGAAAGAGAGGGG + Intergenic
1193593863 X:83422202-83422224 TTGGAGAAGGAGAGAGAGAAGGG - Intergenic
1193649430 X:84111504-84111526 TTTAACAAGCCAGAAGAGAATGG + Intronic
1193682883 X:84542761-84542783 TTGTAGTAGCAGGAAGAGAACGG + Intergenic
1194351757 X:92829944-92829966 TGTATGAAGCAGAAAGGAAAGGG + Intergenic
1194582157 X:95687850-95687872 TATAAAGAGCAGAAAGACAAGGG + Intergenic
1194700082 X:97103405-97103427 TTAAGGAAGCAGAGAGAAAAAGG - Intronic
1194869778 X:99115015-99115037 TTAAAGAAGGATAAAGAAAAGGG + Intergenic
1195002055 X:100651340-100651362 TTTGAGAACCAGAAAGGGGAGGG + Intronic
1195070125 X:101270947-101270969 TTTAATAAGGAGATAGGGAAAGG - Intronic
1195145596 X:102012916-102012938 TTAAAGAACTAGAAAAAGAAGGG + Intergenic
1195740580 X:108061064-108061086 GATAAGAAGCAGGTAGAGAAAGG - Intronic
1196038837 X:111178397-111178419 TTGAAGAAAAAGAAAGAGACAGG + Intronic
1196100099 X:111838869-111838891 TTCAAAAAGTAGAAAGAGTATGG + Intronic
1196401233 X:115318630-115318652 TGTATGAAGCAGAAAGGAAACGG + Intergenic
1196539669 X:116892671-116892693 TTTTGAAAGCAGGAAGAGAAAGG - Intergenic
1196614864 X:117756499-117756521 ATTAGGAAAAAGAAAGAGAAAGG + Intergenic
1196642275 X:118076130-118076152 TTAAGGAAGAAGAAATAGAAGGG - Intronic
1197017530 X:121644878-121644900 TTCAGGAAACAGGAAGAGAAAGG + Intergenic
1197150048 X:123210192-123210214 TTTAGGAAGCAAAAGGAGGATGG - Intronic
1197228723 X:123980045-123980067 TTTGAGAAGCAGAAACAAAAAGG - Intronic
1198184704 X:134242183-134242205 TTCAAAGAACAGAAAGAGAAAGG - Intronic
1198473624 X:136974189-136974211 TTTTAGAAGAATAAAGAGTAAGG - Intergenic
1198778180 X:140203931-140203953 TTTGAAAAGAAGAAAGTGAAAGG + Intergenic
1198948011 X:142037107-142037129 TTTCAGTGGCAGAAAGAAAAAGG + Intergenic
1198965456 X:142224681-142224703 TTCAAGATGCTGAAAGAAAACGG - Intergenic
1199265146 X:145819877-145819899 TAGAAGAAGAAGAAGGAGAAAGG + Exonic
1199920093 X:152392009-152392031 TTTAGAAAACAGAAACAGAAGGG + Intronic
1199930134 X:152509568-152509590 TTCAAAAAGCAGAAAAGGAATGG + Intergenic
1200598184 Y:5173424-5173446 TTTCATAAGCAGACAGAAAAAGG + Intronic
1200660070 Y:5946637-5946659 TGTATGAAGCAGAAAGGAAAGGG + Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1200878458 Y:8184812-8184834 GTTAAAAAGCTTAAAGAGAAAGG + Intergenic
1200969223 Y:9132410-9132432 TTTAAGAGGTAGAAATAGAGAGG - Intergenic
1200979513 Y:9248796-9248818 TCCAAGAAGGAGAAAGAGGATGG + Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201062324 Y:10058717-10058739 TCCAAGAAGGAGAAAGAGGATGG - Intergenic
1201298505 Y:12486102-12486124 TTTAAAAAGCAGACAGAGAAAGG - Intergenic
1201412742 Y:13716981-13717003 GATAAGAAGGAGAAAGAGAATGG + Intergenic
1201986689 Y:19975955-19975977 ATTAAGAAGCATAGAGACAAAGG - Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic