ID: 952776767

View in Genome Browser
Species Human (GRCh38)
Location 3:37053907-37053929
Sequence GGAGATGACCAACAGCCACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952776767_952776772 20 Left 952776767 3:37053907-37053929 CCAGGTGGCTGTTGGTCATCTCC 0: 1
1: 1
2: 1
3: 10
4: 196
Right 952776772 3:37053950-37053972 TGCTGTTCGTAACTGGAGACAGG 0: 1
1: 0
2: 0
3: 5
4: 59
952776767_952776773 21 Left 952776767 3:37053907-37053929 CCAGGTGGCTGTTGGTCATCTCC 0: 1
1: 1
2: 1
3: 10
4: 196
Right 952776773 3:37053951-37053973 GCTGTTCGTAACTGGAGACAGGG 0: 1
1: 0
2: 1
3: 6
4: 66
952776767_952776770 13 Left 952776767 3:37053907-37053929 CCAGGTGGCTGTTGGTCATCTCC 0: 1
1: 1
2: 1
3: 10
4: 196
Right 952776770 3:37053943-37053965 TGTCCAGTGCTGTTCGTAACTGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952776767 Original CRISPR GGAGATGACCAACAGCCACC TGG (reversed) Exonic
902149636 1:14432747-14432769 GGAGAGGAACAACACACACCGGG - Intergenic
904233008 1:29092724-29092746 GGAGGGGAACAACAGACACCAGG - Intronic
905512152 1:38530155-38530177 GGAGCTGACCAAGCACCACCAGG - Intergenic
905512173 1:38530242-38530264 GGAGCTGACCAAGAACCATCAGG - Intergenic
905512179 1:38530271-38530293 GGAGCTGACCAAGCACCACCAGG - Intergenic
905512227 1:38530530-38530552 GGTGCTGACCAACCACCACCAGG - Intergenic
905512232 1:38530558-38530580 GGAGCTGACCAAGCACCACCAGG - Intergenic
905655663 1:39684579-39684601 GGGGAAGACCAACAGCAAGCTGG - Exonic
906271031 1:44478874-44478896 GGAGTGCACCAACAGCCACGGGG - Intronic
907145832 1:52230387-52230409 GGAGGTGAACAACACACACCAGG + Intronic
909698038 1:78489672-78489694 GGAGAGGAACAACATGCACCAGG + Intronic
911189720 1:94935909-94935931 AGAGATGAGCCACTGCCACCTGG - Intergenic
913426591 1:118738152-118738174 GGAGGTCACCACCAGCCACAGGG - Intergenic
915535790 1:156534595-156534617 GGAGCTGAGCCACAGCCCCCAGG + Exonic
917772545 1:178295389-178295411 AGAGGTGAACAACAGACACCAGG - Intronic
920129866 1:203723826-203723848 GGAAATGACTAACAGGCAGCTGG - Intronic
920558986 1:206925542-206925564 GGAGATGAGCCACCGCCACTGGG + Intergenic
921917166 1:220625923-220625945 GGAGATGACCAAGTACCACAGGG + Intronic
922349221 1:224722099-224722121 GGAGAAGACCCACAGCCTCTGGG + Intronic
922582209 1:226706882-226706904 GGATATGGCCAGCAGCCAGCTGG + Intronic
924686700 1:246299803-246299825 GGAGAGGAACAACAGACACTGGG + Intronic
1062929272 10:1341693-1341715 GGGGATAACCAGCATCCACCAGG + Intronic
1063634348 10:7767558-7767580 AGAGAAGACTAACAGCCAGCCGG + Intronic
1066295270 10:34048579-34048601 GTAGATGACCATCAGCTACTTGG + Intergenic
1066700835 10:38126361-38126383 GAAGATGATCAACAGGCAGCAGG - Intergenic
1069748313 10:70730067-70730089 GGAGAGCACCAACAGCCACGTGG - Intronic
1069934164 10:71903769-71903791 GGAGGGGAACAACAGACACCGGG - Intergenic
1070398138 10:76030889-76030911 ACAGGTGACCAAAAGCCACCTGG - Intronic
1070648190 10:78215969-78215991 GGAGCTGACCCACAGCCTCCTGG + Intergenic
1071470554 10:85981133-85981155 GGAACTGACCAACAGGCTCCAGG + Intronic
1072621396 10:97081740-97081762 GCAGATGACCCTCAGCCAACTGG - Intronic
1072813931 10:98486342-98486364 TAAGATAACCAAAAGCCACCTGG - Intronic
1073340308 10:102739304-102739326 GGAAATAAACAACAGCCTCCAGG - Exonic
1074782588 10:116812639-116812661 GGAGATGACCAGGACCCACAAGG + Intergenic
1077187089 11:1240197-1240219 GGACAGGACCTACAGCTACCAGG + Exonic
1078984662 11:16581419-16581441 GGAGAGGAACAACACACACCAGG + Intronic
1079751023 11:24197440-24197462 GGAGAGGAACAACACACACCAGG - Intergenic
1080592854 11:33738445-33738467 GGAGATGTCCAGCAGTCAGCTGG - Intergenic
1081096748 11:38945676-38945698 GGAGATGAACATCACACACCAGG + Intergenic
1085644054 11:78211115-78211137 GGAGGGGACCAACACCCACTAGG - Intronic
1089644582 11:119870306-119870328 GGAGGTGACCAGCAGGCAGCTGG - Intergenic
1090660788 11:128880429-128880451 GGTGATGTCCACCAGCCACGAGG + Intergenic
1090993487 11:131841926-131841948 AGAGATGCCCAACAGCCATTAGG + Intronic
1095909754 12:47414281-47414303 GGTGGTGACCAAAAACCACCAGG + Intergenic
1096885378 12:54713906-54713928 GGAGGGGAACAACACCCACCAGG - Intergenic
1097528808 12:60772868-60772890 GGAGGGGACCAACACACACCGGG + Intergenic
1100054019 12:90487336-90487358 GGAGAGGAACATCACCCACCGGG - Intergenic
1100886223 12:99073539-99073561 TGAGCTGTCCAGCAGCCACCGGG - Intronic
1101775304 12:107788120-107788142 GGAGATGTCCAACAGCCACCTGG + Intergenic
1102207673 12:111101417-111101439 GGAGAAGCCCGGCAGCCACCAGG - Intronic
1102505489 12:113381771-113381793 GAAGAGGGCCAACAGCCTCCTGG - Intronic
1104528343 12:129545969-129545991 GCAGATGTCCAAGAGGCACCTGG - Intronic
1105834848 13:24200756-24200778 GGAGGTGACCAACAGTCATGAGG - Intronic
1105865173 13:24452479-24452501 GGAGGTGCCCATCAGACACCAGG + Exonic
1107029150 13:35833218-35833240 GAAGACGACCAAGAGCCACCGGG + Intronic
1108529310 13:51314265-51314287 GGAGTGGAACAACAGACACCGGG + Intergenic
1108790059 13:53959021-53959043 GGAGATGACCAACAGGGAAAAGG + Intergenic
1110867622 13:80414490-80414512 GGAGCAGAACAACAGACACCAGG + Intergenic
1112084985 13:96020642-96020664 GGAGACTACCATCACCCACCAGG + Intronic
1112177386 13:97040008-97040030 GGAGATGAACATCACTCACCTGG - Intergenic
1112248172 13:97753458-97753480 GGAGCTGTCCAGCAGGCACCTGG - Intergenic
1113811845 13:113147497-113147519 GTAAGTGACCAACAGCCCCCAGG + Intronic
1116731670 14:48630510-48630532 GGAGAGGAACAACACACACCAGG - Intergenic
1120946726 14:90004867-90004889 GGAGCTGATCAACAGCCCCAAGG + Intronic
1121433800 14:93905764-93905786 GCAGATGGCCCACAGACACCAGG + Intergenic
1122836340 14:104432743-104432765 GGAGATGCCCAACCGGCTCCTGG + Intergenic
1125507025 15:40272904-40272926 GGAGATGTACAAGAGCTACCTGG + Exonic
1129060489 15:72856878-72856900 GGAGAAGCCCTACAGCCAGCGGG - Intergenic
1130191262 15:81738359-81738381 GGAGGGGAACAACACCCACCAGG + Intergenic
1131122319 15:89830272-89830294 GCAGATGTCCACCAGCCAGCTGG - Intergenic
1132583126 16:694337-694359 GGAGCTGACCAACTGCCCCGGGG - Exonic
1136501186 16:30670294-30670316 GGAGATGACCAACAGGGGGCAGG + Exonic
1138383078 16:56617214-56617236 GGAGATGGCCAGCAACCACAAGG + Intergenic
1141345807 16:83244716-83244738 GGCAATGACCAACAGAAACCAGG + Intronic
1142411406 16:89918948-89918970 GGACCTGAGCAGCAGCCACCAGG + Exonic
1142489758 17:270508-270530 GGAGGTGACCAGCAGCCCACTGG - Intronic
1144300999 17:13923061-13923083 GGTCATGCCCAACAGCCATCAGG + Intergenic
1147235356 17:39053125-39053147 GCAAATGACCAACAGGAACCAGG - Intergenic
1150005681 17:61467621-61467643 GAAGCTGACAAACAACCACCTGG + Exonic
1151069819 17:71196059-71196081 AGAGGGGACCAACAGCCACCAGG - Intergenic
1151878835 17:76882359-76882381 GGAGATGACGGACAGCACCCCGG - Intronic
1152223681 17:79082856-79082878 GGTGATGCCCAGCAGCCTCCAGG + Intronic
1152874235 17:82777037-82777059 GGAAAAGGCCAACAACCACCTGG - Intronic
1153497725 18:5717279-5717301 GGAGGTAACCAGCAGCCTCCAGG + Intergenic
1157011547 18:43655149-43655171 GGAGAGGAACAACACACACCGGG + Intergenic
1158313440 18:56184333-56184355 AGAAATGAACAACAGGCACCGGG - Intergenic
1159729011 18:72001734-72001756 GGAGAGGAACAACACACACCCGG + Intergenic
1159946307 18:74446977-74446999 GGAGTTGTCCAACAGCAGCCTGG - Exonic
1160422452 18:78756199-78756221 GGAGATGACAGCCAGGCACCAGG - Intergenic
1164479040 19:28597585-28597607 GGAGATGGCAAGCACCCACCAGG + Intergenic
1165902418 19:39174969-39174991 GGAGATGTACAACAGCTACCTGG + Exonic
1167117695 19:47497733-47497755 GGAGATGACCAAGTGTAACCAGG - Intronic
1168614498 19:57826819-57826841 GGTGTGGACCAACAGCGACCTGG + Intronic
925334074 2:3080331-3080353 GGGGCTGACCAACAGCCAACCGG - Intergenic
926686457 2:15702104-15702126 GGAGAGGACCCCCACCCACCAGG - Intronic
926763606 2:16302915-16302937 GGAGAGGAACAATAACCACCCGG - Intergenic
926835390 2:17013549-17013571 GGAGAAAATCAACAGCCTCCTGG - Intergenic
929996154 2:46827544-46827566 GGACTTGACCAGAAGCCACCAGG - Intronic
932793257 2:74673842-74673864 GGAGATGACAGACAGACAGCTGG - Intronic
935095811 2:99943170-99943192 GTAGAAGAGCAACAGCCCCCAGG + Intronic
937475304 2:122209717-122209739 GTAGATAACAAACAGCCCCCAGG - Intergenic
938252502 2:129826898-129826920 GGAGAGGAACAACTGACACCGGG + Intergenic
938784202 2:134610323-134610345 GGAGCTGGCCAGCAGGCACCTGG - Intronic
938989159 2:136610332-136610354 GGAGAAGAACAACACACACCAGG + Intergenic
946137601 2:217660583-217660605 GGAGTTGACCACAAGCCACAAGG - Intronic
947601708 2:231455213-231455235 GGAGGTGACCACAAGCCACAAGG - Exonic
947915153 2:233827539-233827561 GGAGAGGACCAACACACACTGGG + Intronic
949020956 2:241741124-241741146 GGAAATGACCCACAGGCAACAGG - Intronic
1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG + Exonic
1169570733 20:6902381-6902403 GGAGATGTCCAACAGGCAGTTGG + Intergenic
1170546902 20:17442131-17442153 AGAGATGGCCAACAGCCCACCGG + Intronic
1172903968 20:38355342-38355364 GAAGAGGTTCAACAGCCACCTGG - Exonic
1175764865 20:61585253-61585275 GGAAATGACCAATAGCCCCTCGG - Intronic
1177006437 21:15678182-15678204 GCAGATGACCAAAACCCCCCAGG - Intergenic
1177964107 21:27705500-27705522 GGAGAAGAACAACACACACCAGG - Intergenic
1178714572 21:34952195-34952217 GGAGAGGAACATCATCCACCGGG + Intronic
1179951484 21:44711154-44711176 AGAGCTAACCAGCAGCCACCGGG - Intronic
1181621849 22:24096594-24096616 GGAGATGACTTACAACCACAGGG - Intronic
1182317029 22:29454475-29454497 GGAGAAGACTTACAGCCGCCGGG - Intergenic
1183352850 22:37343617-37343639 GAGGATGATCAACACCCACCAGG + Intergenic
1184155741 22:42665652-42665674 TGAGATGACTGAAAGCCACCAGG - Intergenic
1184644668 22:45889472-45889494 GGAGATGACCTCCAGCCTCGGGG + Intergenic
952386476 3:32845109-32845131 GGAGCTGAACAGGAGCCACCTGG + Intronic
952776767 3:37053907-37053929 GGAGATGACCAACAGCCACCTGG - Exonic
953449832 3:42996846-42996868 GTAGATGACCTACAGCCCACGGG - Intronic
953839149 3:46374821-46374843 GGAGACCACCAACAGCCCTCAGG + Exonic
954841122 3:53512667-53512689 GGAGATGCCCAACTTCAACCTGG - Intronic
955121659 3:56065721-56065743 GGAGAGGAACAACACACACCAGG - Intronic
957769782 3:84675846-84675868 GGAGGGGACCAACATACACCAGG + Intergenic
959690931 3:109197310-109197332 GGAGAGGAACAACACACACCAGG - Intergenic
961736169 3:129003428-129003450 GGAGATGAGGAACCGCCACCCGG + Intronic
966253941 3:177897024-177897046 GGAGAGGACTCACAGCAACCAGG + Intergenic
967206309 3:187125630-187125652 GGAGTTGATCAACAGGCAGCAGG - Intronic
969611718 4:8231403-8231425 GGAGATGAACACCAGAAACCAGG - Intronic
978490303 4:109304603-109304625 GGAGATGACAAAGAGGCAACTGG - Intergenic
980277035 4:130666158-130666180 GGAGATAACAAAAAGCAACCTGG - Intergenic
982070242 4:151688018-151688040 GGAGATGACCAAGGGCCACCTGG - Intronic
983714218 4:170757123-170757145 GGAGAAGACCACCAGCAAACAGG - Intergenic
984265928 4:177497817-177497839 AGACATGACCAACAGCCACTAGG - Intergenic
984284624 4:177713591-177713613 GGAGAGGAAGAACAGCCAACTGG - Intergenic
984284803 4:177715572-177715594 GGAGAGGAAGAACAGCCAACTGG - Intergenic
987383336 5:17306583-17306605 GAAGATGTCCATCAGCCCCCTGG + Intergenic
988307813 5:29516102-29516124 GAAGATGACCGTCAGCCCCCTGG + Intergenic
990064712 5:51698178-51698200 GGAGGTGAACAACACACACCAGG - Intergenic
990488925 5:56285006-56285028 AGAGATGTCCAACAGGCACTTGG - Intergenic
990702940 5:58495257-58495279 GGAGAGGAACAACAGACACTGGG + Exonic
991648208 5:68822965-68822987 GGAGATGACCAAAAACCAGGGGG - Intergenic
994320836 5:98392702-98392724 GGAGATGGCCAACCGCAGCCAGG - Intergenic
994545446 5:101161345-101161367 GGAGAGGAACAACAGATACCAGG - Intergenic
995255035 5:110036243-110036265 GGAGTTGCACAACAGCAACCTGG + Intergenic
997096186 5:130915014-130915036 AGAGAAGAACAACACCCACCGGG - Intergenic
999939236 5:156522551-156522573 GGAGAGGAACAACACACACCGGG + Intronic
1000197248 5:158971650-158971672 GGAGATGACCAAAAGACCACAGG + Intronic
1003803027 6:9692993-9693015 GGAGGGGAACAACAGACACCAGG - Intronic
1004986892 6:21092439-21092461 GGAGAGGACCAACACACACCAGG - Intronic
1006067740 6:31474510-31474532 TGAGCTGCCCAAAAGCCACCAGG - Intergenic
1006075325 6:31528966-31528988 TGAGCTGTCCAACGGCCACCAGG - Exonic
1006339757 6:33440399-33440421 GGAGAAGAAAAACAGACACCAGG - Intronic
1006635604 6:35459317-35459339 GGAGAGGATCTACAGCCAACAGG - Exonic
1007252032 6:40502296-40502318 GGAGATGACCTACACCACCCTGG - Intronic
1013170518 6:107633999-107634021 GGTGATGACCAACCGCGGCCCGG + Exonic
1017722434 6:157253274-157253296 ACAGCTGACCAACAGGCACCAGG - Intergenic
1019224838 6:170501155-170501177 GGACATGTCCCACAGCCATCAGG + Intergenic
1022514814 7:30968914-30968936 GGAGATGCCCAACACCACCCTGG + Exonic
1022537014 7:31104663-31104685 GGACTTGACCACCAGCCACGTGG + Intronic
1026055548 7:66980624-66980646 GGAGTTGATCAACAGGCAGCAGG - Intergenic
1026598102 7:71751450-71751472 GGAGAGGAACAACACACACCGGG + Intergenic
1026722145 7:72841195-72841217 GGAGTTGATCAACAGGCAGCAGG + Intergenic
1030800650 7:113846463-113846485 GGAGATCACAAACGGCCATCTGG - Intergenic
1034233147 7:149548298-149548320 GGAGTTGGCCAACAGGCAGCAGG - Intergenic
1034646929 7:152656034-152656056 GGAGGGGAACAACAGACACCGGG + Intronic
1035620229 8:1031029-1031051 GCAGAAGACCCGCAGCCACCAGG - Intergenic
1037702394 8:21286942-21286964 CAAGAAGACCAACAGCCACTTGG + Intergenic
1041065340 8:54077310-54077332 GGAGAGGAACAACAGACACTGGG + Intronic
1041738333 8:61134069-61134091 GGAGATGTCCAGCAGGCAGCTGG + Intronic
1043924996 8:86026886-86026908 GTAGATGAACAACAGCTACTTGG - Intronic
1044698123 8:94943085-94943107 GGAGATGTCCAGCAGGCAGCAGG + Intronic
1049419383 8:142510324-142510346 GGAGATGAGCCGCAGGCACCAGG + Intronic
1051484608 9:17594459-17594481 GGAGAGGAACAACACACACCAGG + Intronic
1052263529 9:26545720-26545742 GGAGTGGAACAACAGCCACTGGG + Intergenic
1052446514 9:28568293-28568315 GGAGAGGAACAACAGACACGGGG + Intronic
1053590900 9:39513629-39513651 GCAGATGCCAAACAGGCACCAGG - Intergenic
1053848749 9:42268992-42269014 GCAGATGCCAAACAGGCACCAGG - Intergenic
1054575406 9:66851661-66851683 GCAGATGCCAAACAGGCACCAGG + Intergenic
1055326576 9:75136743-75136765 GGAGAAGCCCAACCGCCAGCAGG - Intronic
1055726146 9:79231498-79231520 GGAGAGGAACAACACACACCGGG + Intergenic
1062209158 9:135354029-135354051 GGAGATCATCACCAGCCTCCTGG + Intergenic
1062470434 9:136701189-136701211 GGACATGAACAACAGCGACAAGG + Intergenic
1062568192 9:137172552-137172574 GAAGGTGACCTACAGCCAGCTGG - Intergenic
1203774424 EBV:64826-64848 GAGGATGATCAACAGCCACGTGG + Intergenic
1189051378 X:37649423-37649445 GGAGAGGAACAACACACACCAGG + Intronic
1189395598 X:40619836-40619858 GGAGATGGGTAACAGACACCTGG + Intergenic
1189987040 X:46562634-46562656 GGAGATGGCCAAGAGCACCCAGG - Intergenic
1190607224 X:52156856-52156878 GGAGAGGAACAACACACACCAGG - Intergenic
1191763800 X:64673660-64673682 GGAGGGGAACAACAGGCACCAGG + Intergenic
1192302773 X:69923311-69923333 GGAGGTGAACAACACACACCAGG - Intronic
1192852671 X:74974156-74974178 GGAGGGGAACAACAGCCACCAGG + Intergenic
1193555618 X:82950501-82950523 GGAGAAGAACAACACACACCAGG + Intergenic
1194435284 X:93861718-93861740 GGAGGTGAACAACAGACACTGGG + Intergenic
1197249091 X:124196034-124196056 GGAGATGACCAAAAGAAACTCGG - Intronic
1197367241 X:125579177-125579199 AGAGAGGAACAACAGACACCAGG - Intergenic
1197601170 X:128532137-128532159 GGAGATAGCCAACAAACACCTGG + Intergenic
1199099746 X:143785174-143785196 GGAAAGGAACAACACCCACCAGG + Intergenic
1200182981 X:154162473-154162495 GGACTTGACCAACACCCACACGG + Intergenic
1200188635 X:154199587-154199609 GGACTTGACCAACACCCACACGG + Intergenic
1200194284 X:154236728-154236750 GGACTTGACCAACACCCACACGG + Intergenic
1200200040 X:154274531-154274553 GGACTTGACCAACACCCACACGG + Intronic
1201241252 Y:11958804-11958826 GGAGAGGAACAACATACACCAGG - Intergenic
1201933575 Y:19380983-19381005 GAAGATGAACAACACACACCTGG - Intergenic