ID: 952779996

View in Genome Browser
Species Human (GRCh38)
Location 3:37087148-37087170
Sequence AGCATTATTAAAAGTGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952779996_952779997 3 Left 952779996 3:37087148-37087170 CCACACACACTTTTAATAATGCT 0: 1
1: 0
2: 2
3: 33
4: 229
Right 952779997 3:37087174-37087196 TAAACCAGAATTAAGTTGTCAGG 0: 1
1: 0
2: 2
3: 11
4: 141
952779996_952779998 4 Left 952779996 3:37087148-37087170 CCACACACACTTTTAATAATGCT 0: 1
1: 0
2: 2
3: 33
4: 229
Right 952779998 3:37087175-37087197 AAACCAGAATTAAGTTGTCAGGG 0: 1
1: 0
2: 1
3: 29
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952779996 Original CRISPR AGCATTATTAAAAGTGTGTG TGG (reversed) Intronic
902949185 1:19868235-19868257 AGGTTAATTTAAAGTGTGTGTGG + Intergenic
907570749 1:55481080-55481102 AGAATTATTAATAGTTTTTGAGG + Intergenic
908352039 1:63295681-63295703 AGCATTTTTAGAATTCTGTGTGG + Intergenic
908378956 1:63576174-63576196 ATCATTATTGAAAGTCTGAGGGG + Intronic
909834780 1:80240275-80240297 AGCAGTAGCAAAAGCGTGTGTGG - Intergenic
910427597 1:87132238-87132260 GGCATCATTACAAGGGTGTGGGG + Intronic
910890218 1:92010729-92010751 GGGTTTATTAAAAATGTGTGTGG + Intronic
911588627 1:99720267-99720289 AGAATTATTCCAAATGTGTGTGG + Intronic
913003132 1:114601622-114601644 AGTATTAATAAAAATGTATGCGG - Intronic
913447126 1:118961458-118961480 AGCATTACTCAAAGTGCATGAGG + Intronic
914908022 1:151762768-151762790 AACATCATTAACAGTGTGTGGGG - Intronic
915216684 1:154345142-154345164 AGCATGATCAAAAGTGAGTGTGG + Exonic
916353576 1:163879412-163879434 AACATTCTTAGAAGTATGTGTGG - Intergenic
916382432 1:164226882-164226904 AACATTATTTAATGTGTGTTAGG + Intergenic
917961601 1:180149959-180149981 AGCTGCATTAAATGTGTGTGTGG - Intergenic
922487439 1:225985763-225985785 AGCAATATTAAAAATCTGTTTGG - Intronic
1063789179 10:9422395-9422417 AAAATTAATAAAATTGTGTGGGG - Intergenic
1069180836 10:65356597-65356619 AGCAGTATTTAAACTGTGTTAGG + Intergenic
1069399171 10:68023721-68023743 AGCACCATTAAAAGTTTTTGTGG - Intronic
1071592689 10:86890289-86890311 AGAATTATTAAACTTGTCTGCGG + Intronic
1072646679 10:97260960-97260982 AGCATTATCAAAGGCATGTGTGG - Intronic
1073540034 10:104310657-104310679 TGCATTAACAAATGTGTGTGCGG + Exonic
1076235261 10:128859076-128859098 AGCAATCTTAAAATTGGGTGAGG - Intergenic
1076235701 10:128862360-128862382 AGCAATCTTAAAATTGGGTGAGG - Intergenic
1076348657 10:129799285-129799307 AGCCGGATTAAAAGTGTCTGAGG + Intergenic
1078816846 11:14832915-14832937 AGCAGTTTTAAAAGTGTTTAAGG - Intronic
1080062911 11:27976310-27976332 TGCACTTTTAAAAGTTTGTGAGG - Intergenic
1080892216 11:36418833-36418855 AGGATTATAAAATGTATGTGGGG - Intronic
1082721121 11:56678303-56678325 AGGATTTTTAAAAGTTTCTGTGG - Intergenic
1087167247 11:95017273-95017295 AGCCTTACTAAAATTCTGTGGGG - Intergenic
1087489433 11:98804776-98804798 TGCTTTATTAAAAGTTTATGGGG - Intergenic
1087740298 11:101879692-101879714 AGCCTTTTTAAGGGTGTGTGAGG - Intergenic
1087893542 11:103562437-103562459 AGCATCATTAAAAGTCAATGTGG - Intergenic
1087927838 11:103940919-103940941 AGCTTTATTAAAAATGTCTTTGG - Intronic
1088487223 11:110352454-110352476 AGAATTATTAAAAGAGTAGGGGG + Intergenic
1089271506 11:117304760-117304782 TACATGATTAAAAGTGTGAGTGG - Intronic
1090109685 11:123893147-123893169 AACCTTTTTAAAAGTATGTGTGG + Intergenic
1090519617 11:127464446-127464468 CTAATTATTCAAAGTGTGTGAGG - Intergenic
1090629546 11:128633989-128634011 AGTGTTTTTAAAAGTGTGTCAGG + Intergenic
1091369495 11:135046759-135046781 AGCATGATTAAAGGTGTATGTGG - Intergenic
1092595024 12:9993179-9993201 AACATTATTTAATGTGTGAGAGG - Exonic
1092599647 12:10045571-10045593 AACATTATTTAATGTGTGAGAGG + Intronic
1093438245 12:19162856-19162878 CACAATATTTAAAGTGTGTGAGG + Intronic
1094241975 12:28238814-28238836 AAGATAATTAAAAATGTGTGTGG + Intronic
1094743031 12:33311055-33311077 TCCATTAATAAAAGGGTGTGTGG + Intergenic
1097809559 12:64003385-64003407 TGCTTTATTAAAAGTCTTTGTGG - Intronic
1098172245 12:67758683-67758705 AGTTTTATTAAAAATTTGTGAGG - Intergenic
1098598922 12:72306386-72306408 AACATTATTAAATGAGAGTGGGG + Intronic
1098856867 12:75662808-75662830 ATCAATATGAAAAGTATGTGTGG + Intergenic
1099761416 12:86924742-86924764 AGCATTGTTAAAGATGTGTGTGG + Intergenic
1100125052 12:91414593-91414615 AGCTATTTTAAAAGAGTGTGGGG + Intergenic
1100472365 12:94904944-94904966 AGCATTAATAAAACCGTGTCTGG - Intronic
1101027665 12:100628522-100628544 AACATTATTAAATGTGAGTCTGG - Intergenic
1102387537 12:112522363-112522385 TGCCTTATGAAAAGTTTGTGGGG + Intergenic
1106278794 13:28243576-28243598 ACCATTATTAAAAGGCTGTGTGG - Intronic
1109035874 13:57259326-57259348 AGAAATAATAAAACTGTGTGAGG - Intergenic
1109274869 13:60292260-60292282 ATCTTTCCTAAAAGTGTGTGAGG - Intergenic
1110686614 13:78382989-78383011 AGCACTATTCTACGTGTGTGAGG + Intergenic
1110968308 13:81729157-81729179 TTCATTATTACAAGTGAGTGTGG - Intergenic
1111752039 13:92345092-92345114 AGTAATATTAAAAGTGCATGAGG + Intronic
1114177962 14:20340707-20340729 TACATTTTTAAAAATGTGTGTGG + Intergenic
1114222596 14:20710254-20710276 AGCCTTTTTGAAATTGTGTGTGG - Intergenic
1114704620 14:24712847-24712869 ATCATCATTAAAAATGAGTGGGG + Intergenic
1115052597 14:29082110-29082132 ATCTCTATTAAAAGAGTGTGAGG + Intergenic
1116908189 14:50426874-50426896 AGCATAATTAAAAGTGATGGAGG + Intronic
1117456882 14:55906889-55906911 GGGATTTTTAAAAATGTGTGTGG - Intergenic
1118063717 14:62167851-62167873 AGCATTACTAAAGTTGTTTGTGG - Intergenic
1118459295 14:65974140-65974162 TTCATTATAAAAAGTGGGTGGGG - Intronic
1119556717 14:75559124-75559146 AGCAAAAAAAAAAGTGTGTGGGG - Intergenic
1119924340 14:78478320-78478342 AACATTATTAATACTGTGTGGGG + Intronic
1120886921 14:89458996-89459018 AGCCTTCTTAAAAGTGGATGGGG - Intronic
1122405081 14:101496087-101496109 AGGATTAGAAAAAGTGTTTGGGG - Intergenic
1123822160 15:24041841-24041863 ATCCTAATTAAAAGTGGGTGAGG + Intergenic
1124686468 15:31786882-31786904 CTCATTATGAAATGTGTGTGAGG + Intronic
1126081321 15:44965961-44965983 AGTATAATTATATGTGTGTGTGG + Intronic
1129089311 15:73131716-73131738 AACATTTTTAAAAGTGGGTAGGG - Intronic
1135774279 16:25242784-25242806 AACCTTAATAAAAGTGTGGGTGG + Intronic
1137917567 16:52449396-52449418 AGGATGAATAAAAGTTTGTGAGG - Intronic
1138872903 16:60913602-60913624 AGCAATATTAAAAATGTCTCTGG - Intergenic
1140946031 16:79769263-79769285 AGCATATTTAAAACTGTGTGGGG - Intergenic
1144066764 17:11631279-11631301 AGGAATTTTAAGAGTGTGTGCGG + Intronic
1146105772 17:30034828-30034850 AACATTGTTAATAGTGTGTTTGG - Intronic
1146239537 17:31205778-31205800 CACAGTATTAAAAGTGTATGTGG - Intronic
1146774698 17:35603276-35603298 AGCAGTATTAAAAATGTATAAGG + Intronic
1147553159 17:41459385-41459407 AGCATTACTAACAATGTGTCTGG + Intergenic
1148916638 17:50986213-50986235 TACATTTTTAAAAGTGTGTGTGG + Intronic
1149437796 17:56648431-56648453 CGGATTCTCAAAAGTGTGTGTGG - Intergenic
1150116223 17:62552231-62552253 TGCATTAATACAAGTGTTTGTGG + Intronic
1151105696 17:71614235-71614257 ATCATGGTTCAAAGTGTGTGTGG + Intergenic
1151208639 17:72527375-72527397 AGAACTATTAAAAGTGTGCGCGG + Intergenic
1155766222 18:29636530-29636552 GACATCAATAAAAGTGTGTGTGG - Intergenic
1156015823 18:32546024-32546046 TGCATTATTAAAAGTCTGGAAGG - Intergenic
1157020062 18:43770487-43770509 TGCAGTATGAAAAGTGTGTGGGG + Intergenic
1157952177 18:52051780-52051802 AGCATTATTACAATTTTGTGGGG + Intergenic
1158053610 18:53254112-53254134 ATGATTATTTAATGTGTGTGGGG + Intronic
1158430198 18:57378302-57378324 AGCAATATTAGCAGTGTCTGTGG + Intergenic
1159295499 18:66481543-66481565 ACCAATATTAAGTGTGTGTGTGG + Intergenic
1159772650 18:72565115-72565137 AGCATTACAAAAAGTGTTTAAGG + Intronic
1160324482 18:77930738-77930760 AGCACTACAAAAAGTGTGGGTGG - Intergenic
1165569235 19:36761463-36761485 AAAATTTTAAAAAGTGTGTGTGG + Intronic
1166162251 19:40963146-40963168 AGCATGATTGTAAGTCTGTGAGG - Intergenic
1168423722 19:56222342-56222364 CGCTTTATTAACTGTGTGTGTGG - Intronic
927477984 2:23428610-23428632 AACATAATTAAGTGTGTGTGTGG - Intronic
927605381 2:24482272-24482294 AGCATTATTCTAAGTGTTGGGGG - Intergenic
929168319 2:38905934-38905956 AGCATTTTTTAAAGTATGTGAGG - Intronic
929488555 2:42376300-42376322 AGCATGATTAAAAGACTCTGAGG - Intronic
933357226 2:81226388-81226410 AGCCTTATTAAATGTGAATGGGG + Intergenic
935550523 2:104448500-104448522 AGTATTATCAAAAATCTGTGAGG - Intergenic
935578057 2:104731226-104731248 AGCACAATTAAAAGTTGGTGTGG - Intergenic
937570278 2:123349518-123349540 AGCATTAAAAAAAATGTGTTTGG - Intergenic
938604598 2:132879447-132879469 AGTAATATTACAAGAGTGTGGGG - Intronic
939140196 2:138345412-138345434 ATAATTTTTAACAGTGTGTGTGG - Intergenic
940248727 2:151649262-151649284 AGCATTATAAAAAGTCTGTGAGG + Intronic
941147335 2:161865606-161865628 ATAATTATGCAAAGTGTGTGAGG - Intronic
941318506 2:164025252-164025274 TGCCTTATTAAAAGTTTATGAGG - Intergenic
943522365 2:188968813-188968835 ATGATTTTTAAAAGTGGGTGAGG + Intergenic
943994722 2:194747090-194747112 AAAATTATTAAATGTTTGTGAGG + Intergenic
946642931 2:221803579-221803601 AGCAATATTATAAGGGTTTGGGG - Intergenic
948734940 2:239996692-239996714 AGCTTCATTTAAAGTGTGTGGGG - Intronic
1169634334 20:7671094-7671116 AGCAATATTAAGAGCTTGTGAGG - Intergenic
1169949682 20:11030006-11030028 AGAATTTTTAAAAATGTGTTTGG - Intergenic
1170292932 20:14790790-14790812 AGCATTATTTTGAGTGTTTGTGG - Intronic
1170595365 20:17801558-17801580 AGAGTTATTAAATGTGAGTGGGG - Intergenic
1170712965 20:18808627-18808649 AGCATTGTTAAAAATGTGACTGG + Intergenic
1171493958 20:25541521-25541543 AGCATGAATATAAGTATGTGTGG - Intronic
1174216050 20:48917251-48917273 AGTCTTATTAAAACTGTGTGTGG - Intergenic
1175042984 20:56073464-56073486 AACATTATTGAAAGTGTGCTGGG - Intergenic
1175647144 20:60684440-60684462 AATATTTTTAAAAGTGTGTTTGG - Intergenic
1176950444 21:15039252-15039274 AGTATTATCAAAAATGTGTTGGG + Intronic
1177865019 21:26501867-26501889 AGTATTATTAAAAGTGTCAAAGG + Intronic
1178084367 21:29097877-29097899 AACATCATAAAAAATGTGTGTGG + Intronic
1183136510 22:35894289-35894311 ACTGTTATTAAAATTGTGTGAGG - Intronic
1183910041 22:41071903-41071925 CGCACTATTAAAATTGTGTGAGG - Intergenic
950892576 3:16417394-16417416 AGCATTATTTAATGTGTGTGTGG - Intronic
951045522 3:18033632-18033654 ATGATTATAAAAAGCGTGTGGGG + Intronic
951900081 3:27648230-27648252 AGCATTTTTAAAAGTTGCTGAGG + Intergenic
952779996 3:37087148-37087170 AGCATTATTAAAAGTGTGTGTGG - Intronic
956216164 3:66851580-66851602 AGAATTATAAAAAGAGTGGGAGG + Intergenic
956288883 3:67640669-67640691 AGCATGATAAAAAGTGGGTGCGG - Intronic
956440738 3:69278159-69278181 AGCATTTTCAAAAGTGTGGTAGG + Intronic
956581198 3:70816012-70816034 AGCATTATAAAAGGTGGGTGGGG - Intergenic
957301451 3:78397098-78397120 ACCATTATTATAAGTTTATGAGG + Intergenic
957517900 3:81279651-81279673 AAGATTATTTAAATTGTGTGAGG - Intergenic
957951295 3:87130642-87130664 AGAATTATTGAAAGTGTTTTAGG - Intergenic
959442458 3:106394925-106394947 AGTATTATTAATAGTGTTAGTGG + Intergenic
960368489 3:116804538-116804560 AGTATATTTAAAAATGTGTGGGG + Intronic
961229900 3:125295627-125295649 AGTAATACTAACAGTGTGTGAGG + Intronic
962206146 3:133435844-133435866 AGCTTTATGAAAAGTTTATGGGG - Intronic
964415394 3:156442819-156442841 AGAATTCTTAAAAGGGTTTGAGG + Intronic
964519219 3:157544854-157544876 CGCATTAAGAAATGTGTGTGAGG - Intronic
965557350 3:170032180-170032202 AGCAATATTAAAACTATTTGCGG - Intergenic
965566588 3:170125275-170125297 ATCATTCTAAAAAGTGTCTGGGG + Intronic
965903253 3:173669961-173669983 AGCATAATTAAAACTTTGTAAGG + Intronic
966332149 3:178826248-178826270 AGCATTTTTAAGAGTTTCTGGGG - Intronic
966963153 3:184961363-184961385 AACATTTTTAAAAGTATGTGTGG - Intronic
969479407 4:7440064-7440086 AGCATTTGTTAAAGTGTGGGTGG - Intronic
970295617 4:14626411-14626433 AGCATTATGAAAATGGTGGGAGG + Intergenic
971333099 4:25698679-25698701 AGTATTATTAATTGAGTGTGTGG + Intergenic
971647693 4:29229971-29229993 AGCTTTGTTTAAACTGTGTGGGG - Intergenic
973107299 4:46356171-46356193 AGCATTATTAAAGTTTTCTGAGG - Intronic
978225372 4:106327769-106327791 AGCATTTTGAAAAGTGTTTGGGG + Intronic
978897931 4:113912228-113912250 AGCAGCATTAAAAGAGTCTGAGG + Intronic
980335193 4:131464529-131464551 AGTAATATTAAAAGTGGGTATGG + Intergenic
980627336 4:135390677-135390699 AGCAATATTTAAGATGTGTGAGG - Intergenic
980852313 4:138397593-138397615 ATCATTCTTAAAAATGTGAGTGG + Intergenic
984041620 4:174741884-174741906 AGCAGATTTAAAACTGTGTGAGG + Intronic
985281851 4:188294991-188295013 AGCATCATGAAGAGTGTCTGTGG - Intergenic
987868614 5:23580390-23580412 AGCAATATTAAGAATGTATGAGG + Intergenic
990204342 5:53413167-53413189 AGAATTCTTAAAAGTGTATGTGG - Intergenic
990877553 5:60502763-60502785 AGCAGTAATAAAAGTGTTTTAGG + Intronic
992261258 5:74972865-74972887 AGCATTCTAAATGGTGTGTGTGG + Intergenic
992409335 5:76489766-76489788 ATTATTTTTAAAAGTGTATGTGG - Intronic
993508246 5:88737906-88737928 AGCTTTATTAAATTTGTGTTAGG + Intronic
993961522 5:94303136-94303158 AGCATTGTAAAAATTGTGTGTGG - Intronic
995375628 5:111471458-111471480 GGCTTTATAAAAAGTTTGTGGGG - Intronic
996213989 5:120845525-120845547 TGCATAATTAAAAGTGTGTCAGG + Intergenic
1002976843 6:2087671-2087693 AGCAATACTAAAATTGCGTGTGG - Intronic
1005008240 6:21311434-21311456 ATTGTTTTTAAAAGTGTGTGTGG - Intergenic
1005688418 6:28278212-28278234 AGATTTATTTAAAGTGTTTGTGG + Exonic
1006375412 6:33669072-33669094 AGCATCATGAGAAGAGTGTGAGG + Exonic
1006810679 6:36818503-36818525 AGCATCATCCAAAGTGTTTGGGG - Intronic
1007499796 6:42287977-42287999 AGCATTATGGAAACTTTGTGTGG - Intronic
1007594126 6:43040905-43040927 AGCATTATTACCAGTGAGTGTGG - Exonic
1008269303 6:49471381-49471403 ACCATTATTATAAGTTTGTTTGG + Intronic
1008704321 6:54139120-54139142 AGCTTTCTTTAGAGTGTGTGTGG + Intronic
1008949577 6:57140953-57140975 AACATTAGGAAAAGTGTATGTGG + Intronic
1008981520 6:57489227-57489249 TGCATTTTTAAGAGTATGTGTGG + Intronic
1009169613 6:60382256-60382278 TGCATTTTTAAGAGTATGTGTGG + Intergenic
1009405832 6:63311511-63311533 TGCTTTATAAAAAGTTTGTGGGG - Intronic
1009935427 6:70229074-70229096 AGCAACATTAAAAGTTGGTGTGG - Intronic
1011634879 6:89362494-89362516 AGCATGACCAAAAGAGTGTGGGG - Intergenic
1011821444 6:91257577-91257599 AGCCTTGTTAGAAGTGTGTTTGG + Intergenic
1012062184 6:94501290-94501312 AGCATTACCACAAATGTGTGAGG + Intergenic
1014576398 6:123079746-123079768 AGCTTTATTTAAATAGTGTGGGG + Intergenic
1015234959 6:130960170-130960192 TGCATTATGAAGTGTGTGTGAGG - Intronic
1015765925 6:136716407-136716429 AGCATTGTTTAAAGTGAGTGGGG + Intronic
1017911097 6:158793718-158793740 AGCATTTGGAAATGTGTGTGTGG - Intronic
1018948498 6:168363552-168363574 AGCATTTTTGAAAGTATGTGAGG - Intergenic
1021303104 7:18996710-18996732 ACCATTACAAACAGTGTGTGAGG - Intronic
1021337501 7:19421535-19421557 AGCATTGTTTAAAGTCTGTCAGG + Intergenic
1022168327 7:27795918-27795940 AGAATTGTTAAATGTGTGTTTGG - Intronic
1022786643 7:33644619-33644641 AGGATGATTACAAGTGTGTTTGG + Intergenic
1023525363 7:41097018-41097040 ACTATGATAAAAAGTGTGTGGGG + Intergenic
1023887842 7:44373993-44374015 AAAATAATTTAAAGTGTGTGGGG + Intergenic
1024959244 7:54957630-54957652 AGCATTTTGAAAAGTGTTTTGGG - Intergenic
1027648546 7:80836181-80836203 AGCATTAAAAAAGGTGTGAGAGG + Intronic
1028103221 7:86846924-86846946 AGCATTAGTAAAACTGTGGTAGG - Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1030910180 7:115238041-115238063 AGCATTATTAGAGGTCTGTCTGG + Intergenic
1032045956 7:128608047-128608069 TGCATTAATACAAGTGTTTGTGG + Intergenic
1035850052 8:2909700-2909722 AGCCTTTTTCAAAGTGTGTGAGG - Intergenic
1035976219 8:4314562-4314584 AGCATAAGTAAAAGTGATTGTGG - Intronic
1037354627 8:18004540-18004562 AGCATTTCAAAAAGTGTCTGAGG + Intronic
1040978109 8:53216251-53216273 AGCTTTATAAAAAGTGAGTCAGG + Intergenic
1041225735 8:55696384-55696406 AGCATTGTTAAAAGTGATTTTGG - Intergenic
1042603465 8:70523030-70523052 AGCTTGATTTAAAATGTGTGGGG + Intergenic
1042979861 8:74514498-74514520 TGCATTGGTAACAGTGTGTGAGG - Intergenic
1043178371 8:77051211-77051233 AGCTTTCCTAAAAGTTTGTGTGG + Intergenic
1043563926 8:81526845-81526867 AGCATTATATAAAATGTGTGTGG - Intronic
1043600115 8:81927485-81927507 AGCATTCTAAAAAGAGTGTCTGG - Intergenic
1043839960 8:85091191-85091213 ATCATTACTAATAATGTGTGAGG - Intergenic
1044178505 8:89159665-89159687 AACACTATTAAAAGTGAGAGTGG - Intergenic
1044628674 8:94258695-94258717 AGTATTATCAAAAATATGTGTGG + Intronic
1046796206 8:118375478-118375500 AGGATTATTATAAATGTATGAGG + Intronic
1047411874 8:124630527-124630549 AGCCTTGTTAAAAATGTGGGCGG - Intronic
1047476700 8:125239311-125239333 AGCATTTTAAAAATTGGGTGGGG + Intronic
1047809357 8:128391383-128391405 AGCACTTTTAAAAGTGAATGAGG + Intergenic
1050565782 9:6881266-6881288 AGCATTATTATAATTTTGTCAGG + Intronic
1050858916 9:10398496-10398518 TGAATTATTAAAACTGTGGGTGG + Intronic
1051096066 9:13466513-13466535 AGCATTATTTCCAGTGTTTGGGG - Intergenic
1051227432 9:14916032-14916054 TGCTTTATGAAAAGTTTGTGGGG + Intergenic
1052286072 9:26787087-26787109 GGCATTAAAAAAAGTGTGTGTGG + Intergenic
1052427710 9:28326303-28326325 AGCATTATAAAAACAGTTTGTGG - Intronic
1053045587 9:34913904-34913926 AGGAGTGTTAAAAGTTTGTGAGG + Intergenic
1054164801 9:61714084-61714106 AGCATAATTTAAATTGTGGGAGG + Intergenic
1058106547 9:100978411-100978433 AGTTTGATTAATAGTGTGTGAGG + Intergenic
1059388142 9:113981235-113981257 AACATTGTTAAAGGTGGGTGAGG + Intronic
1059785689 9:117580755-117580777 AGCTTTTTTAAAGGTGTGTGTGG + Intergenic
1060444557 9:123676054-123676076 AACATTTTTAATAGTGTGGGAGG + Intronic
1060575603 9:124690114-124690136 AGCATCACTATAAGTGTTTGGGG - Intronic
1061301780 9:129709724-129709746 AACATTCTTAAAAGTGTGGCAGG + Intronic
1186628611 X:11323500-11323522 TGCTTTATTAAAAGTTTATGAGG + Intronic
1186896652 X:14010661-14010683 AACATTATTAAAAATGTATGTGG + Intronic
1186954581 X:14668437-14668459 AGTTTTATTAAAATAGTGTGTGG - Intronic
1188522033 X:31049291-31049313 AGAATTACTCATAGTGTGTGAGG - Intergenic
1189660364 X:43290674-43290696 TGCTTTATGAAAAGTTTGTGGGG - Intergenic
1190914681 X:54802562-54802584 GGCAATATTAAAAGTGAGAGGGG - Intergenic
1193418473 X:81254028-81254050 AGCATCCTTAAAACTGTGTTAGG + Intronic
1193713815 X:84911931-84911953 AGCATGATTAAAATTGAGAGTGG - Intergenic
1194428561 X:93771415-93771437 AGCATGATAAAAAGTGTGACAGG - Intergenic
1194973908 X:100374110-100374132 AGCATTATCAAAAGGGTGAGGGG - Intronic
1195330528 X:103795052-103795074 AGTATTATGCAAAGTGTTTGTGG + Intergenic
1196745626 X:119069666-119069688 AGCATCCTTAAAAGTGGGAGAGG - Intergenic
1196765696 X:119240468-119240490 AGCATTTTTAAAATTGTGTCTGG + Intronic
1196929937 X:120671528-120671550 TGCATTTTTAAAAGCGTGGGGGG - Intergenic
1198110806 X:133501314-133501336 AGCATTTTGACACGTGTGTGTGG + Intergenic
1198191226 X:134308492-134308514 AGCATTTTTAAAAAGGTGTTAGG + Intergenic
1198299320 X:135319370-135319392 AGCATTATCAAAGAAGTGTGTGG + Intronic
1198439998 X:136653855-136653877 AGCAAAATTAAAAATGTCTGAGG + Intronic
1198457790 X:136834307-136834329 TGCATTATGAAAAGTTTGTGGGG - Intergenic
1198541419 X:137644071-137644093 AGCACTGTTAAGAGAGTGTGGGG - Intergenic
1198768279 X:140100789-140100811 TGCATTCTTAACAGTGTTTGTGG - Intergenic
1199454472 X:148012606-148012628 AGCAACATTGAAAGTGTATGGGG - Intronic
1201427705 Y:13872561-13872583 AGCCTTTTAAAATGTGTGTGGGG + Intergenic
1201723717 Y:17132235-17132257 AGCAGGATTAAAAGTATTTGGGG + Intergenic