ID: 952780470

View in Genome Browser
Species Human (GRCh38)
Location 3:37092444-37092466
Sequence TTATGAAGGACCTATTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952780466_952780470 29 Left 952780466 3:37092392-37092414 CCTCTCCAGTAGGTTTGACTGTC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 952780470 3:37092444-37092466 TTATGAAGGACCTATTTAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 139
952780467_952780470 24 Left 952780467 3:37092397-37092419 CCAGTAGGTTTGACTGTCTTTTA 0: 1
1: 0
2: 1
3: 15
4: 244
Right 952780470 3:37092444-37092466 TTATGAAGGACCTATTTAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952780470 Original CRISPR TTATGAAGGACCTATTTAGG AGG Intronic
906751383 1:48265143-48265165 ATATGAAGGAAATGTTTAGGTGG - Intergenic
907578485 1:55550715-55550737 TAATGAAGGACCTAATCATGCGG + Intergenic
911913814 1:103669870-103669892 TTCTTAAGGACTTTTTTAGGAGG + Intronic
912014053 1:105009649-105009671 TTATAAAGTATCTATTTAGTTGG + Intergenic
912828142 1:112924896-112924918 TTCTGAAGGATATATTTGGGTGG - Intronic
916660975 1:166921911-166921933 TGGTGAAGGTGCTATTTAGGGGG + Intronic
921385663 1:214567068-214567090 TTATGAAATACATATTTTGGGGG + Intergenic
924308756 1:242718895-242718917 TGATGCAGCACTTATTTAGGAGG - Intergenic
924503346 1:244657314-244657336 ATACGAAGGAACCATTTAGGTGG - Intronic
924849617 1:247812539-247812561 TTATGAAGATTCTATATAGGAGG - Intergenic
1065123658 10:22552425-22552447 TTATTAATGACAGATTTAGGGGG - Intronic
1065246832 10:23767433-23767455 ATAAGAAGGACATATTTAGTAGG + Intronic
1067749199 10:48958821-48958843 TCAGGAAGGACCTGTTGAGGAGG + Intronic
1072442459 10:95469040-95469062 TAATGAAGGAACTATTTATAAGG - Intronic
1075128396 10:119719493-119719515 TTGTCAAGGACCTACTCAGGAGG - Intergenic
1080377891 11:31735771-31735793 ATATGAAGGACCTCTTCAAGGGG + Intronic
1080639527 11:34150642-34150664 TTATGTGGGAGCTATTTTGGGGG - Intergenic
1083072267 11:59997405-59997427 ATATGAAGGAGCTATTTTTGGGG + Intergenic
1084331786 11:68434692-68434714 TTATGAAGGACCTGCTTGGTTGG + Intronic
1085221386 11:74876508-74876530 TAATGATGGTCCTATTTTGGGGG - Intronic
1085786105 11:79451695-79451717 TGATGAAGGTCATGTTTAGGAGG - Intergenic
1086868676 11:92011210-92011232 ATATGAAGGACCTCTTCAAGGGG - Intergenic
1086962657 11:92995476-92995498 CTATGAAAGACCTTTTTAAGAGG + Intergenic
1088959168 11:114643958-114643980 ATATGAAGGACCTCTTCAAGGGG - Intergenic
1094224868 12:28033535-28033557 TGATGAAGGTACTTTTTAGGTGG + Intergenic
1094708045 12:32933865-32933887 TCATGAAGCTCATATTTAGGGGG + Intergenic
1095998222 12:48107057-48107079 GTGTAAAGGACCTATTAAGGGGG - Intronic
1098081444 12:66790243-66790265 GTCTGAAGGACCTATGTAGCTGG - Intronic
1099824164 12:87753475-87753497 TTAAAAAAGACATATTTAGGAGG + Intergenic
1101147182 12:101852293-101852315 CTATTTAGGAGCTATTTAGGAGG - Intergenic
1101451763 12:104786178-104786200 TTATGAAGGACCTTGTTGGCTGG + Intergenic
1105599997 13:21878307-21878329 TTATAAAGCACCTTTTTTGGGGG + Intergenic
1106516380 13:30458202-30458224 TCATCAAGGACCTTTTTAGGAGG + Exonic
1106789671 13:33141937-33141959 TTATAATAGACTTATTTAGGTGG + Intronic
1107363333 13:39643115-39643137 TTATGAGGGACCCAGTTAGTTGG + Intergenic
1109676899 13:65687496-65687518 TTGTGAAGGACCTCTTCAAGGGG + Intergenic
1110648380 13:77916161-77916183 TTATGAAAGTTCTGTTTAGGGGG - Intronic
1111183465 13:84698409-84698431 AAATGAAGGACCTCTTTAAGGGG + Intergenic
1112336483 13:98521333-98521355 TTATGACGGTCATACTTAGGAGG + Intronic
1114587898 14:23831649-23831671 TCATGAAGGGGCTATTTAAGAGG + Intergenic
1114781237 14:25540252-25540274 TTATGCAGGGGCAATTTAGGGGG + Intergenic
1119292388 14:73505798-73505820 TGATGAAGAACCAATTTTGGCGG + Intronic
1123977343 15:25565846-25565868 TTAAGAAGAAATTATTTAGGTGG + Intergenic
1124449953 15:29778921-29778943 TTAGCAAGGCCCTATTTGGGAGG + Intronic
1125336331 15:38630156-38630178 GAATGACTGACCTATTTAGGTGG + Intergenic
1127347634 15:58116458-58116480 TTATAATGGACCAATTTTGGAGG + Intronic
1128794399 15:70454465-70454487 GTATGAAAGACATATTTGGGAGG - Intergenic
1129749240 15:78049090-78049112 TTGTGAAGGACCCAGTCAGGAGG + Intronic
1130169322 15:81495619-81495641 TAATGAAGGGCCTATTTACAAGG + Intergenic
1133891081 16:9879564-9879586 TTTTTAAGGGCCTATTTACGTGG - Intronic
1134401032 16:13909754-13909776 TTATCAAGGACAGATTTTGGAGG + Intergenic
1134751057 16:16625478-16625500 CTGTGGAGGACCTATTTAAGTGG - Intergenic
1134994399 16:18728113-18728135 CTGTGGAGGACCTATTTAAGTGG + Intergenic
1135358026 16:21786317-21786339 TTATGGAGGGCCTATTTACCTGG - Intergenic
1135456531 16:22602441-22602463 TTATGGAGGGCCTATTTACCTGG - Intergenic
1140751276 16:78026251-78026273 TTATGAAGCACATGTTTAAGGGG + Intronic
1141239393 16:82250941-82250963 TTATGTGGAATCTATTTAGGAGG - Intergenic
1153492340 18:5662622-5662644 TCATGAGGCACCTATTCAGGTGG - Intergenic
1155405240 18:25480713-25480735 TAATGAAGTACCTATTTTGTAGG - Intergenic
1156332612 18:36138296-36138318 CCATGAAGGACCTGTTTATGCGG + Exonic
1157233296 18:45939508-45939530 TTATAAAAGACCTACTTAAGTGG + Intronic
1157872341 18:51242041-51242063 TGATGAAGGTCATGTTTAGGAGG + Intergenic
1157978269 18:52351121-52351143 TTAAGAAGGGGATATTTAGGAGG + Intronic
1158374964 18:56852847-56852869 TGCTGAAGTACCTATTTAGTTGG - Intronic
1159275686 18:66218675-66218697 TTTTGAAGAACCCATTTGGGTGG - Intergenic
1162122387 19:8479417-8479439 TTATGAAGGCCCTAGAAAGGTGG + Intronic
1163467492 19:17476792-17476814 ATCTGAGGGACCTATTTTGGAGG + Intronic
1165200366 19:34138745-34138767 TTATGAAGGCCATATTTATGAGG - Intergenic
931219976 2:60280336-60280358 TCATTAAGGGCCTATTTAGCAGG + Intergenic
933070252 2:77848258-77848280 TTATGAGCGTCCTATTTAGGTGG + Intergenic
933382229 2:81563488-81563510 TTAAGAAGGTTCTATTTTGGTGG + Intergenic
937478596 2:122236824-122236846 TGATTAAGGAATTATTTAGGAGG + Intergenic
938755265 2:134373518-134373540 TTAATAAGGTTCTATTTAGGTGG - Intronic
940594914 2:155778849-155778871 TTGTGAAGGACCTTTTTCAGGGG + Intergenic
941107399 2:161371729-161371751 TTATGCAGGACATATTCTGGAGG + Intronic
944118837 2:196218425-196218447 TAATCAAGGACCTATTTATATGG - Intronic
946791413 2:223304192-223304214 AAATGAAGAACTTATTTAGGGGG + Intergenic
946899274 2:224356605-224356627 CTATGAACGTCCTATTTTGGGGG + Intergenic
1168751794 20:287624-287646 TTATGAAAGACCTTTTTAGGAGG - Intronic
1170124270 20:12945791-12945813 ATGTGAAGGACCTATTTGGGGGG - Intergenic
1172068357 20:32237695-32237717 TTCTGAAGGACCTCTCTAGCTGG + Exonic
1174023937 20:47556305-47556327 TTATGATGGAACTGTTTATGTGG + Intronic
949103331 3:172415-172437 TTATGAGTGTCCTAATTAGGTGG - Intergenic
949765929 3:7525560-7525582 GTATGAATGAATTATTTAGGGGG + Intronic
951114077 3:18839285-18839307 TTATAAAGGTCCTAACTAGGTGG + Intergenic
952738618 3:36714313-36714335 TTATGAATGACCTGGTTAGTAGG - Exonic
952780470 3:37092444-37092466 TTATGAAGGACCTATTTAGGAGG + Intronic
954142815 3:48618643-48618665 TTAAGAGGGACATATTTATGTGG + Intergenic
954569269 3:51626813-51626835 TCATGAAGGAACTATATGGGAGG - Intronic
956511474 3:69998270-69998292 TTATAAAGCAGCTATCTAGGGGG - Intergenic
959495416 3:107045097-107045119 TGATGAAATACCTAATTAGGAGG - Intergenic
968034829 3:195539190-195539212 TTATGAAGGTCTAATTTAGCAGG - Intronic
970258300 4:14193583-14193605 TTATGAGGTATCTATTTATGAGG - Intergenic
976669921 4:87640690-87640712 ATATGAAGGACCTCTTTAAGGGG + Intergenic
978563652 4:110059502-110059524 TTTTGAAGGTCCTATTTTGTTGG - Intronic
979943321 4:126791567-126791589 TTATGAAAGACCTAATGAAGAGG + Intergenic
984532691 4:180936000-180936022 CTATGAAGGACATTTTTAGAAGG + Intergenic
988369604 5:30349168-30349190 TTATGAAGCAACTGTTTTGGGGG + Intergenic
988441012 5:31232892-31232914 TATTAAAGGACCTATTTTGGAGG - Intronic
988937943 5:36107977-36107999 TGATGCAGAAGCTATTTAGGAGG - Intronic
989345491 5:40424856-40424878 ATCTGAAGCACCTATTTACGGGG - Intergenic
990492423 5:56315399-56315421 TAATGAAGGAACTATTTGGTGGG - Intergenic
990744344 5:58943425-58943447 TTATGAGGAAGCTTTTTAGGTGG + Intergenic
992301489 5:75386671-75386693 TTATGAAGGACCTATGGGGCTGG + Intronic
994986533 5:106940827-106940849 TTATGTGGGAGGTATTTAGGAGG - Intergenic
1006384280 6:33720753-33720775 TTTTTAGGGACATATTTAGGAGG + Intergenic
1008215739 6:48786255-48786277 TTATGAGGTACATATTTATGGGG - Intergenic
1008640684 6:53459219-53459241 TTATGAAGGTGCTTTTTATGTGG - Intergenic
1009058531 6:58368944-58368966 TTCTGAAGGACAGTTTTAGGTGG - Intergenic
1009232308 6:61078176-61078198 TTCTGAAGGACAGTTTTAGGTGG + Intergenic
1010595347 6:77756124-77756146 TTATGAAAGACCCATTTAAAGGG + Intronic
1011847761 6:91587734-91587756 CTAGGAAGAACCTATTTTGGGGG - Intergenic
1013035130 6:106374995-106375017 TTTTGAATGACATATTGAGGTGG + Intergenic
1014359203 6:120454779-120454801 TTTTGAAGGAACTCTTTAGAGGG - Intergenic
1018351874 6:162968626-162968648 TAATGAAGGAACCATGTAGGTGG + Intronic
1018962899 6:168460763-168460785 TTATGAAGAACTCATTTTGGTGG + Intronic
1021006908 7:15408486-15408508 GTATTAACGAACTATTTAGGAGG + Intronic
1021644433 7:22774776-22774798 ATATCAAGGACATATTAAGGGGG - Intergenic
1021683342 7:23157024-23157046 TTAGGGAGGACCTGTTTAAGAGG - Intronic
1022470654 7:30680182-30680204 TGATGAATGCCCTAATTAGGGGG - Intronic
1024771469 7:52728708-52728730 TAATGAAGGGGTTATTTAGGAGG - Intergenic
1024772119 7:52735785-52735807 TAATGAAGGGGTTATTTAGGAGG + Intergenic
1029402500 7:100354677-100354699 TTAAGAAGCTCCTATTCAGGCGG - Intronic
1030003788 7:105095301-105095323 TTATGATGGACCTTTTGAGTAGG + Intronic
1031766503 7:125784782-125784804 TTTTGAAGCACATATTTACGAGG - Intergenic
1031881196 7:127200499-127200521 TAATGAAGGACCTTCTTGGGTGG + Intronic
1032695080 7:134328682-134328704 TTGTGAAGGGCCTAGTTATGTGG + Intergenic
1037907695 8:22725126-22725148 TTAAGAAGTACATATTTTGGTGG + Intronic
1038127984 8:24695864-24695886 TTATGAATGACTTAGTTCGGTGG - Intergenic
1039190855 8:34972424-34972446 TTTTCAAGGACCTCTATAGGTGG + Intergenic
1040916062 8:52566811-52566833 GTCTGAAGGCCCTACTTAGGTGG + Intergenic
1042097994 8:65239983-65240005 TTATGAAGAACCTAAATAGAAGG + Intergenic
1043252730 8:78096035-78096057 TAATGAAGGATCTATTTATGTGG + Intergenic
1044448304 8:92303524-92303546 TTATGTATGACCTATTTTGAGGG - Intergenic
1049627968 8:143634876-143634898 TTAAAAAGGACCTATTCAAGTGG + Intergenic
1051563830 9:18473485-18473507 TTATTAAGGACTTAATTTGGGGG - Intergenic
1058610280 9:106768867-106768889 TTATGAAGGAGATAGTTTGGGGG - Intergenic
1059094589 9:111399263-111399285 TTATGAAGGTGCTTTTTTGGTGG - Intronic
1060443083 9:123659926-123659948 TTTTGTAGGACCAATTTATGTGG - Intronic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1187483705 X:19681970-19681992 GGATGATGGACATATTTAGGAGG + Intronic
1188072868 X:25738681-25738703 TTATAAAGGAAATATTTAGAAGG - Intergenic
1188080563 X:25834488-25834510 TTATGAAGAACCTATTTGGAGGG + Intergenic
1188999972 X:36933523-36933545 TTGTTAAGGACCTATGTAGAAGG + Intergenic
1190581191 X:51894207-51894229 ATACGAAGGACCTAATTGGGAGG - Intronic
1196946168 X:120828738-120828760 ATATGAAGGACCTCTTCAAGAGG - Intergenic
1197041750 X:121944479-121944501 TTATGAAGGTCCTCTGTATGAGG + Intergenic
1202143418 Y:21752603-21752625 TTAGGAAGTACCTCTTTAGTAGG - Intergenic