ID: 952782041

View in Genome Browser
Species Human (GRCh38)
Location 3:37110823-37110845
Sequence TGGGAGTCTCTTTAAACAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952782041 Original CRISPR TGGGAGTCTCTTTAAACAAC GGG (reversed) Intronic
902161048 1:14530592-14530614 TGCCAGGCTCTTTAAACAACCGG - Intergenic
903527861 1:24006090-24006112 TGGGTTCCTGTTTAAACAACTGG + Intergenic
904635921 1:31881326-31881348 TGGAAGACTATTTAAAGAACTGG + Intergenic
904950213 1:34231621-34231643 TGGGAATGTCTTCAGACAACTGG + Intergenic
905677426 1:39837426-39837448 TGGGAGACTGTATAAACATCAGG - Intergenic
906591085 1:47024533-47024555 TGGGAGTGGATTTAAAAAACGGG - Intronic
908410353 1:63858288-63858310 TGGAGATGTCTTTAAACAACAGG - Intronic
909700382 1:78514834-78514856 TCCCAGACTCTTTAAACAACCGG - Intronic
913208123 1:116560218-116560240 TGTGAGTGTCTTGAAACAACAGG - Intronic
913616525 1:120565535-120565557 AGGGAGGCACTTTAAACAAGGGG - Intergenic
914573752 1:148945376-148945398 AGGGAGGCACTTTAAACAAGGGG + Intronic
917541350 1:175917668-175917690 TGGGAGACTTTTTAAAAATCAGG + Intergenic
922547511 1:226469358-226469380 TACCAGCCTCTTTAAACAACTGG - Intergenic
924903531 1:248427822-248427844 TGGGAGGCTCTTTATACATGTGG - Intergenic
924924337 1:248664155-248664177 TGGGAGGCTCTTTATACATGTGG + Intergenic
1066403356 10:35096290-35096312 TGCGAGTCTCTTTAAAGAAGTGG + Intergenic
1067263260 10:44713298-44713320 TGTTAGTGTCTTTAAAGAACTGG + Intergenic
1070892018 10:79948124-79948146 TGGTAGTCTCTAGAAACACCTGG + Intronic
1072416434 10:95250390-95250412 TGATAGTATCTTTAAACCACTGG + Intronic
1072526046 10:96272548-96272570 CGGGCTGCTCTTTAAACAACAGG - Intergenic
1073956663 10:108879861-108879883 TGAGAGTCTCTTTATTCAAATGG - Intergenic
1074035992 10:109739085-109739107 AGGAAGTGTCTTTGAACAACAGG + Intergenic
1076414289 10:130274252-130274274 AGGGATTCTCTTCAAACACCTGG - Intergenic
1078155552 11:8796887-8796909 TGCGAGTCCATATAAACAACTGG - Intronic
1084093291 11:66893593-66893615 TGAGAATCTCATTTAACAACTGG + Intronic
1086845560 11:91745626-91745648 TGACAGTCTTTTTAAACAAATGG - Intergenic
1087828392 11:102792411-102792433 TTGGAGTCATTTTAAACAAAAGG - Intronic
1093187909 12:16042765-16042787 TGCAATTCTCTTTAAACAAAAGG - Intergenic
1099788702 12:87301886-87301908 TGGAAGTATTCTTAAACAACTGG + Intergenic
1100574649 12:95878965-95878987 TGGCAATCTTTTTAAACAATAGG - Intronic
1100727402 12:97423191-97423213 TGGGAGCCTCTTTAAAGGGCTGG - Intergenic
1102415062 12:112754282-112754304 TGTGTGTGTTTTTAAACAACTGG + Intronic
1103594340 12:122014716-122014738 TGAGACTCTCTTAAAAAAACAGG - Intergenic
1109295748 13:60528504-60528526 TGGGAGTCTCTTTGAAAACGAGG - Exonic
1111427286 13:88103616-88103638 TGTGAGGCCATTTAAACAACAGG + Intergenic
1117778564 14:59208232-59208254 TGGGAGTCCCCTTGGACAACAGG - Intronic
1119371337 14:74146930-74146952 AAGTAGTCTCTTTCAACAACTGG + Intronic
1120686876 14:87548107-87548129 TGCGAGTCTCTCTAGACCACAGG + Intergenic
1122131667 14:99607455-99607477 TGGGAGAGTCTTTAAAAAAAGGG - Intergenic
1124665615 15:31589241-31589263 TGGGATTCTCTTTAAAGAGTAGG + Intronic
1126810250 15:52395350-52395372 TTGCAGTGTCTTTAAACATCTGG + Intronic
1128921751 15:71616983-71617005 TGGAAGTCCCTTTAAACTAATGG - Intronic
1129904660 15:79177990-79178012 TGGGAGGCTCTTTAAAGAGAAGG + Intergenic
1131409892 15:92198816-92198838 TGCCAGGCTCTTTAAAAAACCGG - Intergenic
1131884902 15:96902155-96902177 TGTGAGTTGTTTTAAACAACTGG - Intergenic
1134420191 16:14080226-14080248 TGGTAGTCTCTTTAGAGGACAGG - Intronic
1138166669 16:54808310-54808332 AGGGACTCGCTTTAAAGAACTGG - Intergenic
1142049527 16:87949249-87949271 TGGGAATGTTTTGAAACAACAGG + Intronic
1143253938 17:5542066-5542088 TGGGTGTCTGTTGAATCAACAGG - Intronic
1143995661 17:11004320-11004342 TGAGGGTTTCTGTAAACAACTGG + Intergenic
1149964221 17:61145896-61145918 TGGCAGTCTCTGCAAACAAGTGG - Intronic
1152193563 17:78903027-78903049 TGGGAGCCTCGCTAAACAGCTGG + Intronic
927350200 2:22102867-22102889 AGGGAGTCTCTTCAGACAAAAGG + Intergenic
929801772 2:45110646-45110668 TGGGTGTCTGCTTAAACAAGCGG + Intergenic
935791689 2:106597158-106597180 TGGAAGTAACTTTTAACAACAGG + Intergenic
941385629 2:164847762-164847784 TGGGTGTTTCTTTAAAAAAAAGG + Intergenic
941542566 2:166804847-166804869 TGAGAATCTTTCTAAACAACAGG - Intergenic
941667407 2:168256155-168256177 TTGGCTTCTCTTGAAACAACAGG - Intergenic
943754832 2:191546956-191546978 TGGGAGAGTCTATAACCAACTGG - Intergenic
1169870714 20:10245324-10245346 AGGGTGTCTCTTTCAATAACTGG + Intronic
1171428155 20:25061388-25061410 GGGGAGTCTCTGTGGACAACTGG - Intergenic
1173746446 20:45440999-45441021 TGGGAGTTTATTTAAAGACCTGG + Intergenic
1174111574 20:48201289-48201311 TGGGTGTCACTTTAAATAAAGGG + Intergenic
1174134552 20:48370405-48370427 TAGGAATCTCTTCAAACAGCCGG + Intergenic
1175619971 20:60435210-60435232 TGGGAGTTTTTTTATACAGCTGG + Intergenic
1175809066 20:61847810-61847832 TGCCAAGCTCTTTAAACAACAGG + Intronic
1178011594 21:28292776-28292798 TGGAAGCCACTTTAAACTACAGG + Intergenic
949205135 3:1428995-1429017 GGTGAGTCCCTTTAAAAAACTGG - Intergenic
952782041 3:37110823-37110845 TGGGAGTCTCTTTAAACAACGGG - Intronic
961979301 3:131060036-131060058 TGTGAGTCTCTTTTAAGCACTGG + Intronic
965612263 3:170556958-170556980 TGGGAGTCTCATTTAAAAAGTGG + Intronic
968808920 4:2791518-2791540 TGGGAGAGTCTTCAGACAACAGG - Intergenic
970088827 4:12379828-12379850 TGAGAGCCTCTTTAAATCACAGG - Intergenic
975709591 4:77147021-77147043 TGGGACTGTGTTGAAACAACTGG + Intergenic
975720293 4:77242656-77242678 TGGAAGTCACTTGAAGCAACTGG - Intronic
977849273 4:101805380-101805402 TGGGATGCTCTTTAAAGAAAAGG + Intronic
978415831 4:108474889-108474911 TGCCAGGCTCTTTAAACAAACGG - Intergenic
978589711 4:110311824-110311846 TGGGATTCGCTTTAAAACACTGG + Intergenic
980121704 4:128734672-128734694 TGGGAGTCTTTTCAAAACACTGG - Intergenic
984557581 4:181233843-181233865 CAGGAGTCTCTTTAATGAACGGG - Intergenic
987720190 5:21623490-21623512 TGAGAGTATTTTGAAACAACTGG + Intergenic
993632809 5:90307523-90307545 TTGGAGTCTCTCCAAATAACTGG + Intergenic
996491729 5:124105860-124105882 TGGGAATCTCTTGAAAGAACCGG + Intergenic
997131368 5:131279708-131279730 TTTGTGTCTCTTTAAAGAACTGG - Intronic
997363069 5:133307542-133307564 TGGGTATCACTTTATACAACTGG + Intronic
998069377 5:139184878-139184900 TGGATTTCTCTGTAAACAACTGG - Intronic
1000070053 5:157731907-157731929 TGAGAGTGACTTTTAACAACAGG - Intronic
1000204683 5:159047655-159047677 AGGGAGTCTTTTTACACAAAGGG - Intronic
1000422061 5:161049293-161049315 TTGGAGGCTCTTCAAAAAACAGG + Intergenic
1001240142 5:170062694-170062716 TGCAAGTCTCTTTAGACCACAGG + Intronic
1011078362 6:83462417-83462439 TGGGAGGCTTTTTAAACATCTGG + Intergenic
1017832542 6:158144062-158144084 TTGGAGTCTCTATAAACCATTGG - Intronic
1021024740 7:15650865-15650887 TGGGAGTCCCTTTTAATAAAAGG - Intronic
1025183435 7:56837376-56837398 TGGGAGTATCTTTTAAGGACAGG - Intergenic
1025688490 7:63739591-63739613 TGGGAGTATCTTTTAAGGACAGG + Intergenic
1025911601 7:65833087-65833109 TGGGAGTATCTTTTAAGGACAGG + Intergenic
1026001694 7:66564344-66564366 TGGAAGTCTCTTTGGAGAACTGG - Intergenic
1028973899 7:96890937-96890959 TGGGCAGCTCTTAAAACAACTGG + Intergenic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1036068655 8:5414436-5414458 TTGGAGTCAATTTAAACATCGGG + Intergenic
1045576103 8:103421955-103421977 TGAAAGTCTTTTTAAACAAGGGG + Intronic
1046272581 8:111915886-111915908 TGGGACTGTCATTAAACAACTGG + Intergenic
1046428665 8:114091696-114091718 AGGAACTCTCTTTTAACAACAGG + Intergenic
1048308448 8:133299748-133299770 TGGGAGGGTCTTTAGACAGCAGG - Intronic
1048666825 8:136671570-136671592 TGAGAGTATCTTGAAACAACTGG + Intergenic
1056084408 9:83131121-83131143 AGGGCGTTTCTTCAAACAACAGG + Intergenic
1057517287 9:95732510-95732532 TGGGAGTCTCTCTAATCCATAGG + Intergenic
1059577205 9:115503329-115503351 TCAGAGACTCTTTAAACAAATGG - Intergenic
1060719861 9:125969667-125969689 TGGGAGTCTCTTAAATCTATTGG + Intergenic
1062010744 9:134265451-134265473 TGGGAGTTTCTTCAAGGAACTGG - Intergenic
1191960581 X:66697142-66697164 TGGATCTCTCTTTAAACAATTGG - Intergenic
1198309526 X:135416768-135416790 TGCGGGTCTCTTTAATCAAGGGG + Intergenic
1201862737 Y:18617208-18617230 TGGGAGTATTTTAAAGCAACTGG + Intergenic
1201870586 Y:18703170-18703192 TGGGAGTATTTTAAAGCAACTGG - Intergenic