ID: 952786433

View in Genome Browser
Species Human (GRCh38)
Location 3:37160123-37160145
Sequence CAGAAGTTCTAGAAGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 369}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952786429_952786433 -6 Left 952786429 3:37160106-37160128 CCTATTCTCCAGGATACCAGAAG 0: 1
1: 0
2: 0
3: 13
4: 144
Right 952786433 3:37160123-37160145 CAGAAGTTCTAGAAGACAAAGGG 0: 1
1: 0
2: 1
3: 39
4: 369
952786427_952786433 14 Left 952786427 3:37160086-37160108 CCTCAGCTTCAACTTCATCTCCT 0: 1
1: 0
2: 9
3: 52
4: 536
Right 952786433 3:37160123-37160145 CAGAAGTTCTAGAAGACAAAGGG 0: 1
1: 0
2: 1
3: 39
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952786433 Original CRISPR CAGAAGTTCTAGAAGACAAA GGG Intronic
900947077 1:5837104-5837126 CAGAAGTCCTGGAAGAAACAGGG + Intergenic
901499764 1:9644745-9644767 CAGCAATCCTAGAAGAAAAATGG + Intergenic
904094856 1:27968693-27968715 AAGAAGTGCTAAAAGAAAAAGGG + Intergenic
905078184 1:35292899-35292921 CAGAAGGTCTAGAATAGATAGGG - Intronic
905596208 1:39209761-39209783 CTGAAGTTCAAGAAAACCAAGGG - Intronic
905696829 1:39980771-39980793 CAGGATTTCTACCAGACAAAGGG - Intergenic
906135523 1:43497487-43497509 CAGAACTTCTAGACCACGAAAGG - Intergenic
909191571 1:72558950-72558972 CAGAATTTACAGAAAACAAAGGG - Intergenic
910074062 1:83256640-83256662 CAGAAGTTCCAGAGGATGAATGG + Intergenic
910752938 1:90654080-90654102 CACAATTTCTAGAAGAAAACAGG + Intergenic
911407120 1:97455916-97455938 CTGAAGTTCCTGATGACAAAAGG - Intronic
913031776 1:114913472-114913494 CATAAGTTCTTAAAGAGAAAGGG - Intronic
913225614 1:116695684-116695706 CAGAAGTTCTACAAGGTAGAGGG - Intronic
913296871 1:117330298-117330320 CAGGAATTCATGAAGACAAATGG - Intergenic
913392992 1:118334983-118335005 CAGAAATTATAGAAGGCAAAAGG + Intergenic
913970860 1:143415509-143415531 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
914065236 1:144241120-144241142 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
914113915 1:144725234-144725256 CTAAAGTTCTAGAAGAAAAAAGG + Intergenic
916432893 1:164749113-164749135 CAGAAAGTCTGGAAAACAAAGGG + Intronic
917069070 1:171129225-171129247 AAGAAAGTCTACAAGACAAATGG + Intergenic
917411298 1:174762509-174762531 TAGATGTCCTAGAAGACAAAGGG - Intronic
918210769 1:182349151-182349173 CAGAAATACTAGAAGGCACATGG - Intergenic
920955484 1:210616496-210616518 CATATGTTCTTGAAGACATATGG + Intronic
921000212 1:211036433-211036455 CATAAGTTCTACAGGACAATTGG + Intronic
921081567 1:211742810-211742832 CAGGAGTGCTGGAAGACAAAAGG - Intergenic
921979180 1:221236428-221236450 CAGGATTTCTAGAGAACAAAAGG - Intergenic
923407273 1:233674442-233674464 CAAAAGTTGAAGAAGACAAGTGG + Intergenic
924273675 1:242362677-242362699 CAGAAACTCTAGACTACAAATGG + Intronic
924879991 1:248150531-248150553 CAGTAGTTAAAAAAGACAAAAGG - Intergenic
1063268828 10:4484748-4484770 CAGAAGTTCTGAAAAAGAAATGG + Intergenic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1064016129 10:11773718-11773740 CAGAAATCCTAGAACACATACGG - Intergenic
1064569623 10:16679217-16679239 CAGAAGTTATATAAGACACTGGG + Intronic
1064659580 10:17592835-17592857 CTGAAGTGGTAGAAGACAAGGGG + Intronic
1064907933 10:20368259-20368281 CAGCAGTTAAAGAGGACAAAGGG - Intergenic
1065649661 10:27874690-27874712 CAGAAACCCTACAAGACAAAAGG - Intronic
1066337536 10:34494246-34494268 GAGAAGTTTTACCAGACAAAGGG + Intronic
1066711035 10:38233977-38233999 CAGAAACTCTAGACTACAAATGG - Intergenic
1067918079 10:50422023-50422045 CAAAAGTTCTAGGAGAAGAAAGG - Intronic
1068575010 10:58675369-58675391 AAGAAGTTCTGGAAGATGAATGG + Intronic
1070931257 10:80262097-80262119 TATAAGTTCTAGAAAACAGAAGG - Intergenic
1071083204 10:81837630-81837652 CAGGAGATCCAGAAGACATATGG - Intergenic
1071932289 10:90485611-90485633 CAAAAATTCTAGAAGAAAACAGG - Intergenic
1073779426 10:106821119-106821141 CAGAAATTCTCAAATACAAAAGG - Intronic
1074473136 10:113745400-113745422 CAGGAGTTCTAGGAAACATAGGG + Intergenic
1075230262 10:120670452-120670474 CATTTGTTTTAGAAGACAAATGG - Intergenic
1077681794 11:4248639-4248661 CAGAGATGCTAGAAGACACAGGG + Intergenic
1077944530 11:6880733-6880755 CAGAGGTTAGAGAAGACAGAAGG + Intergenic
1078564717 11:12404535-12404557 CAGAAGATTTAGGATACAAAAGG - Intronic
1079130884 11:17746308-17746330 AAGAAGTTCGAAAAGACAGAGGG - Intronic
1079639493 11:22786573-22786595 CTGAATTTCTAGAAGATAATCGG + Intronic
1081399284 11:42624207-42624229 CAGCAGTTCTAGAACCTAAATGG + Intergenic
1081414577 11:42798948-42798970 CTAAAGTTCTAGAAGAAAACCGG - Intergenic
1081594501 11:44449977-44449999 CAGAAGTTGGAGAAGGAAAAAGG + Intergenic
1084628956 11:70333027-70333049 CAGAGCTCCCAGAAGACAAAAGG - Intronic
1086021078 11:82230318-82230340 CAGTAGTATTAGAAGAAAAATGG + Intergenic
1087137892 11:94739232-94739254 CATGAGTTCCAGAGGACAAATGG + Intronic
1087441507 11:98189437-98189459 CAGAAGTTCTTGAAATCACAAGG + Intergenic
1087616122 11:100488657-100488679 CAGCAGTTTAAAAAGACAAAAGG + Intergenic
1088339913 11:108752295-108752317 CACAAGTTAGAGAAAACAAATGG + Intronic
1088399903 11:109412084-109412106 CAGAAAACCTAGATGACAAAAGG + Intergenic
1090760615 11:129833922-129833944 CAGAACTGTTAGAAGATAAATGG + Intronic
1090901602 11:131037258-131037280 TAAAACATCTAGAAGACAAAGGG - Intergenic
1092060215 12:5544292-5544314 CAGAAATTCTACAAGCCAGAAGG + Intronic
1092146106 12:6215784-6215806 CGGAATTTCTAGATGACAACAGG - Intronic
1092839387 12:12524633-12524655 CAGAATTTCTATAAGTCAAGGGG + Intronic
1093080805 12:14808490-14808512 CCGTAGTGCTAGAAGACATACGG - Intronic
1093246714 12:16747605-16747627 AAGAATTTCTAGCAGAGAAAAGG + Intergenic
1093274880 12:17112899-17112921 CAAAGTTTCTAGAAGAGAAAAGG + Intergenic
1093598659 12:20994461-20994483 TAGATGTTTTAGAAGACAACAGG - Intergenic
1093604308 12:21071789-21071811 CAGCAGTTTAAAAAGACAAAGGG - Intronic
1094354130 12:29559535-29559557 CAGAAGCGCTATAAGAGAAAAGG + Intronic
1097099455 12:56576587-56576609 CACAAGTTCAAGAAGAAAAAAGG - Intronic
1098496401 12:71140812-71140834 TAGAGGTTATAGAAGGCAAATGG - Intronic
1098999608 12:77163760-77163782 AAGAAATTTTTGAAGACAAATGG + Intergenic
1099913565 12:88863238-88863260 CAGAAATAATAGAACACAAAGGG + Intergenic
1100148427 12:91706239-91706261 CAGAAGATCTCAAAGATAAAAGG + Intergenic
1100203431 12:92324080-92324102 CAGAAGTTCTACAAGCTAGAAGG - Intergenic
1103029341 12:117600004-117600026 CACAGGTTCTACCAGACAAATGG + Intronic
1103159001 12:118711910-118711932 CAGAAGTGCCAAAAGAAAAAGGG - Intergenic
1105331100 13:19416055-19416077 CATTATTCCTAGAAGACAAAAGG - Intergenic
1105840019 13:24246180-24246202 CAGAAGTACAAGAAGACCACAGG - Intronic
1105897500 13:24728627-24728649 CAGTAAATCTAGAAGAAAAATGG + Intergenic
1105919139 13:24944361-24944383 CATTATTCCTAGAAGACAAAAGG - Intergenic
1106369313 13:29116190-29116212 CAGAACTTTATGAAGACAAAAGG + Intronic
1107333706 13:39330429-39330451 CACAAGTTCAACAATACAAATGG + Intergenic
1109123327 13:58486234-58486256 AAGAAGGTTTAGAAGACAATAGG - Intergenic
1109897219 13:68708935-68708957 CAGAGGTTCTAGAAGGGACATGG - Intergenic
1109958500 13:69601469-69601491 CAGAGGTTTTAGAAGATAATTGG + Intergenic
1109967231 13:69716166-69716188 GAGAAATTATAGAAGATAAATGG - Intronic
1110120516 13:71874700-71874722 CAGTAATGCTAGAAAACAAAAGG + Intergenic
1112838280 13:103544605-103544627 CATCAGTTCTATGAGACAAATGG - Intergenic
1115158807 14:30369666-30369688 GAGAAGTTCTAAAAAAAAAAAGG - Intergenic
1115417925 14:33158528-33158550 CAGAAGTATTAAAAAACAAAAGG + Intronic
1115989261 14:39135221-39135243 AAAAAGTTCTAGACTACAAAAGG + Intronic
1116030519 14:39565582-39565604 AAGAAGTCCTAGAAAACAGAAGG - Intergenic
1116264499 14:42669906-42669928 CAGTGGTTATAGAGGACAAAGGG + Intergenic
1116529157 14:45946251-45946273 CACAACTTCTAAAAGAAAAATGG + Intergenic
1116563319 14:46412216-46412238 CAGAAGTTCTAAAGGAAAAAAGG - Intergenic
1117033453 14:51700899-51700921 AAGAGATACTAGAAGACAAAAGG - Intronic
1117034660 14:51715644-51715666 CAGTATTTCCAGAAGGCAAAGGG + Intronic
1117172718 14:53117148-53117170 CAGAAAATCTAGAAGAAATAGGG + Intronic
1117177129 14:53156228-53156250 AAGATGATCTAGAAAACAAAAGG - Intergenic
1118079246 14:62339315-62339337 CAGAATTTCTAAAAGAATAAAGG - Intergenic
1118506722 14:66421531-66421553 AAGAATTTCAAGAATACAAAAGG - Intergenic
1118619661 14:67602999-67603021 CAGAGGGTCTACAATACAAAAGG + Intergenic
1120158561 14:81120944-81120966 CAGAAGTTGTTAAAGATAAAGGG + Intronic
1121100842 14:91249083-91249105 CTGAGGTTCTAAATGACAAACGG + Intronic
1121505281 14:94472427-94472449 CAGAAGTGCCAGAAGAGAGAAGG - Intronic
1124597159 15:31101113-31101135 CTGAAGTTCTAGGAGAGACAGGG - Intronic
1125011014 15:34875192-34875214 CAGAAGCCCAAGAAGAGAAATGG + Intronic
1125355074 15:38808831-38808853 CATAGATTCCAGAAGACAAAGGG - Intergenic
1125897720 15:43316545-43316567 CAGAAGTTCTGAATGACAGATGG + Intergenic
1127205689 15:56715772-56715794 CAGAAGATCTACATGACAGAAGG + Intronic
1127219111 15:56859083-56859105 CAGAATATATAGTAGACAAATGG - Intronic
1128747905 15:70127416-70127438 CAGAAGGTCTAGAGTTCAAAAGG + Intergenic
1129972511 15:79791527-79791549 CAGAAATTATAGAAGACAAAAGG + Intergenic
1130262374 15:82366242-82366264 CAGAATTAGTTGAAGACAAAAGG + Intergenic
1130278854 15:82502765-82502787 CAGAATTAGTTGAAGACAAAAGG - Intergenic
1131802068 15:96081048-96081070 AAGAAGTTCTACAAGACCATAGG + Intergenic
1132889791 16:2197802-2197824 CAGGAGTGCTGGAAGACCAAGGG - Intergenic
1133865778 16:9641793-9641815 CAGAAGCTCAAGAGGAAAAAAGG + Intergenic
1134529005 16:14967862-14967884 TAGAAGTTACACAAGACAAAAGG + Intergenic
1135251743 16:20906248-20906270 CAGAAGTGATGGAAGTCAAAAGG + Intronic
1138871066 16:60886833-60886855 CAAAACTTCTAGAAGAACAAAGG - Intergenic
1139120525 16:64010624-64010646 CAGCAGATCTAAAATACAAAGGG - Intergenic
1139867361 16:70073116-70073138 TAGAAGTTACACAAGACAAAAGG - Intergenic
1140334368 16:74090730-74090752 AGGAAGTTCTGGAAGACAAAAGG - Intergenic
1141342196 16:83213421-83213443 CAGACCTTCTAGAAGAAACAAGG - Intronic
1141352374 16:83309844-83309866 CAGAAGTCCTTCCAGACAAATGG + Intronic
1143712646 17:8744946-8744968 CAGAAGTTCCTGAGGGCAAAGGG - Intronic
1144361301 17:14496814-14496836 CAGTAGCCCTAGAAGACACAGGG - Intergenic
1144448318 17:15352621-15352643 CAGAAGATATGGAAGACAAAAGG - Intergenic
1144837632 17:18165307-18165329 CAGAAGTTCTAAAATGAAAATGG + Intronic
1145927855 17:28661213-28661235 CAGAAGAGCTGGAAGACAAAGGG + Intronic
1146432687 17:32812698-32812720 CAGAAGTTCCAGCAGACACTGGG + Intronic
1146681855 17:34814219-34814241 GTGAAGTCCTAGAAGACAATTGG - Intergenic
1148072576 17:44916764-44916786 CAGAAGTCCAAGGACACAAATGG - Intronic
1148109890 17:45138351-45138373 CAGGAGTTCTAGAAGGGAAGAGG - Intronic
1149190896 17:54060363-54060385 TTGAAGTTGAAGAAGACAAAAGG + Intergenic
1149205698 17:54243865-54243887 AAGAAATTCTAGATAACAAAAGG + Intergenic
1150037306 17:61817743-61817765 CAGAGATTCTAGAAAACCAATGG + Intronic
1150847392 17:68673403-68673425 CAGAAATTCCAGAGGACACAGGG - Intergenic
1152503872 17:80733951-80733973 CAGAAGCTGTAAAAGAAAAAAGG - Intronic
1152995609 18:403639-403661 GAGAATTTCTAAAAGATAAATGG + Intronic
1155373366 18:25129378-25129400 CAAAACTTCTAGAAGACAACAGG + Intronic
1155398433 18:25412191-25412213 CAAAGGTTCTAGAAGAAAACAGG - Intergenic
1156290360 18:35743970-35743992 AAGAAGTTCTTGAAACCAAAAGG - Intergenic
1156392404 18:36663133-36663155 CAGAAGTACTAGAAGAAACCAGG - Intronic
1156839664 18:41596365-41596387 CTAGAGTTATAGAAGACAAAAGG + Intergenic
1157460358 18:47886629-47886651 GCAAAGTTCTAAAAGACAAAAGG + Intronic
1158181472 18:54720144-54720166 CAGAATTACTAGCAAACAAATGG + Intronic
1158538225 18:58327561-58327583 CATAACTTCTAGAAGGCAAGAGG + Intronic
1158832493 18:61295532-61295554 CAGGAATTTAAGAAGACAAATGG - Intergenic
1159084823 18:63776657-63776679 GAGAAGCTCTGGTAGACAAAGGG + Intronic
1159291895 18:66434134-66434156 GAGAAGTTAAAGAAGAAAAAAGG + Intergenic
1159361932 18:67416529-67416551 CAAGAGTTCTAGGAAACAAAAGG + Intergenic
1159733936 18:72070464-72070486 CAGAAATTCTGGATGCCAAAAGG - Intergenic
1159906801 18:74099798-74099820 CAGCAGTTTAAAAAGACAAAGGG + Intronic
1161921020 19:7265995-7266017 CTGAGGTACTAAAAGACAAATGG + Intronic
1162004902 19:7771473-7771495 AAGAAGTACCAGAAGACAAGGGG - Intergenic
1164250319 19:23469908-23469930 GAGAAGAACTAGAAGAGAAAAGG - Intergenic
1164406073 19:27948009-27948031 CAGAAATTCTACAAGCCAGAAGG - Intergenic
1164847500 19:31446672-31446694 TAGAATTTCTAGAAGTGAAATGG - Intergenic
1165172237 19:33902010-33902032 CAGGAGCTCAAGAAAACAAAAGG + Intergenic
1166162154 19:40962280-40962302 GAGGAGTTCCAGAAGACCAAGGG + Intergenic
1168225757 19:54993836-54993858 CAGAAGTTGGAGAAGTAAAAAGG - Intronic
1168521118 19:57051288-57051310 CAGAAGTTCTGGAAGGTAGAGGG - Intergenic
925459902 2:4052236-4052258 GAGAAAATCTAGAAAACAAAAGG - Intergenic
926392543 2:12408221-12408243 GAGAAGTTCTAGGAGAGAATCGG + Intergenic
926436846 2:12846900-12846922 GAGAAATTCTACAAGCCAAAGGG + Intergenic
927069749 2:19515217-19515239 CAGCAGTTAAAAAAGACAAAGGG - Intergenic
929179522 2:39020599-39020621 CAGTAGTTCTTAAAAACAAATGG + Intronic
929189422 2:39125303-39125325 CAGAGGTTCTCCAAGACATATGG + Intergenic
929240727 2:39650515-39650537 CAGAACTGGTAGAAGAGAAAGGG + Intergenic
931143356 2:59488216-59488238 CAGCTGTTTTAGAAGAGAAATGG - Intergenic
931221810 2:60295319-60295341 CAGAAATTGTTGAAAACAAAAGG + Intergenic
931424954 2:62162320-62162342 CAGAAGTTAAAGAACTCAAAGGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
931500964 2:62865879-62865901 CAGAATTTGTAGAAGAGAAGAGG + Intronic
932008394 2:67950858-67950880 TATAAGAACTAGAAGACAAAGGG - Intergenic
932280148 2:70484195-70484217 CAGAAGATAAAGAAGACAACAGG - Intronic
933433276 2:82212805-82212827 CAGCAGTTAAAAAAGACAAAGGG - Intergenic
934175560 2:89576435-89576457 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
934285876 2:91650799-91650821 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
936097600 2:109544284-109544306 CAGAAGTTCCAGAGCACAGAAGG - Exonic
936791065 2:116152859-116152881 CAGAAGAATTAGAAGGCAAAAGG - Intergenic
936968567 2:118151826-118151848 CAGAAGTGGGTGAAGACAAAGGG + Intergenic
937773922 2:125753366-125753388 CAGTAGTGCTAGAAGAAAAAGGG - Intergenic
937827606 2:126383935-126383957 CAGAATTGCTAGAGGATAAAAGG + Intergenic
938001514 2:127743611-127743633 CAGAAGTAAAGGAAGACAAACGG + Intronic
938311258 2:130289579-130289601 GAGAAATTCTAAAAGAAAAATGG + Intergenic
938809446 2:134839394-134839416 CAAAAGTTCTTAATGACAAAAGG - Intronic
939438610 2:142211741-142211763 AAGAAGTTTTATAAGACAAAGGG + Intergenic
939554697 2:143660301-143660323 CAGAAATTTTAGGAGACAATGGG + Intronic
939618294 2:144386065-144386087 CAGATATGCTAGAATACAAAAGG + Intergenic
940255645 2:151725526-151725548 GAGAAGTTTGAGAAAACAAAAGG - Exonic
942777368 2:179599189-179599211 CAGAGGTCCAAGAAGACTAAGGG + Intronic
943130541 2:183848390-183848412 CAGCAGTTAAAAAAGACAAAGGG + Intergenic
943606993 2:189987629-189987651 ATGAAGCTCTAGAAGGCAAAAGG + Intronic
943654492 2:190493265-190493287 CAGCAGTTAAAAAAGACAAAGGG + Intronic
943702447 2:191001243-191001265 CAGAAGATCTGGAAGGCAAGTGG - Intronic
943795558 2:191988590-191988612 CTGACTTTCTAGAGGACAAATGG + Intronic
944993349 2:205263614-205263636 TAAAACTTCTAGAAAACAAATGG + Intronic
945372176 2:209032706-209032728 AGGAAGATCTAGAAGATAAAAGG - Intergenic
945613768 2:212040830-212040852 CAAAAGTTGAAGAAGGCAAAGGG - Intronic
945659814 2:212672197-212672219 CAGAAGTTGAAGAAGAAGAAAGG - Intergenic
946057554 2:216915335-216915357 CAGAAGCTCAAGAAGATAAGTGG + Intergenic
946254105 2:218430710-218430732 ATGAAGTTCTGGAAGAGAAAGGG - Exonic
947593587 2:231397855-231397877 CAGAAGGCCCAGAAGCCAAATGG + Exonic
947950256 2:234140718-234140740 GAGAAGCTCTAGAAGAGCAAAGG - Intergenic
1169545545 20:6646836-6646858 CAGAAGTTCTCGTAGACATTAGG - Intergenic
1169861173 20:10154122-10154144 AAGAACTTCTAGAAGACCAAAGG + Intergenic
1169982663 20:11404015-11404037 CAGCAGTGCTAGAAGATAAGAGG - Intergenic
1171470476 20:25366651-25366673 AAGAAGTACTAGAAGAAAACAGG - Intronic
1172323236 20:34013681-34013703 CAGCAGTCCTAGAAGTCAAAGGG - Intronic
1173855167 20:46245696-46245718 CAGAAATCCTAGAAGACAACTGG - Intronic
1176741902 21:10612569-10612591 CATTATTCCTAGAAGACAAAAGG + Intergenic
1177468071 21:21516088-21516110 CACAAGTTTTAGAAAACAAAAGG + Intronic
1177754163 21:25324359-25324381 CAGGAAATCTAGAAGAAAAAAGG + Intergenic
1179137145 21:38689654-38689676 CAGAAGTTCCTGATGCCAAATGG + Intergenic
1180563782 22:16645806-16645828 CATTATTCCTAGAAGACAAAAGG + Intergenic
1181458532 22:23072794-23072816 CTGAGATTCTAGAAAACAAAAGG - Intronic
1181463140 22:23097027-23097049 CAGAAGGTCTAGCACACGAAGGG + Intronic
1181863364 22:25836301-25836323 CAGAAATTCTAGAGAAAAAAGGG - Intronic
1182042256 22:27247387-27247409 GAGAAGATCTGGAAGACAAAAGG + Intergenic
1182386610 22:29948483-29948505 CATAAATTCTAGAAGACATTTGG - Intronic
1182706031 22:32280976-32280998 CAACAGTTCTAGAAAACAAAAGG + Intergenic
1183794667 22:40106139-40106161 AACAAGTTCTAAAAGAGAAAAGG - Intronic
1184345476 22:43910159-43910181 CAGGTTTTCTAGAAGTCAAAGGG - Intergenic
1184394352 22:44224059-44224081 CAACAGTTCTAGAAAACAAAAGG + Intergenic
949825292 3:8158486-8158508 CAGTAGCTCTTGAATACAAAGGG + Intergenic
950878115 3:16296890-16296912 TAAAAGTTCTAGAAGAAAATGGG + Intronic
951115678 3:18859025-18859047 CACAAGTTTTACAAGAGAAAAGG - Intergenic
951292676 3:20892793-20892815 CAAATGTTCTAGAAGTCAAATGG + Intergenic
951843590 3:27061568-27061590 CAGAAGTACAGGAAGCCAAAAGG - Intergenic
952056597 3:29454082-29454104 CAGAAGTTCTGGCAGAAAAAGGG - Intronic
952273593 3:31856392-31856414 GAAAAATTCTAGAAGAAAAATGG + Intronic
952424242 3:33158693-33158715 CAGAACCTCTAGGAGACAACTGG - Intronic
952757558 3:36885063-36885085 CAGAAGTTTGAGAAGAAACAGGG + Intronic
952786433 3:37160123-37160145 CAGAAGTTCTAGAAGACAAAGGG + Intronic
953000295 3:38926279-38926301 CAGAACTTCTAGAAGTAAACAGG + Intronic
953605092 3:44407517-44407539 CAGCATTTCTAGTATACAAATGG + Exonic
953632016 3:44626032-44626054 CAGAAGTTAAAAAAAACAAAAGG - Intronic
953854540 3:46491071-46491093 AAAAAGTTCCAGAAGACAGAAGG + Intergenic
954916546 3:54152865-54152887 CAGAAGTTCAAGAAGCAAGAGGG - Intronic
955331118 3:58048273-58048295 CACCAGTTCTACAAGACAACGGG - Intronic
955827937 3:62968312-62968334 CATAAGTGGTAGAAAACAAAGGG - Intergenic
956522928 3:70125406-70125428 CAGAATTTCTAGAGAAGAAATGG - Intergenic
956750811 3:72342506-72342528 CAGAAGTTGGAAGAGACAAAGGG - Intergenic
958006416 3:87817746-87817768 AAGAAGTTAAAGTAGACAAATGG + Intergenic
958084862 3:88794572-88794594 CAGAAGTTGAAGAAGAAACAAGG + Intergenic
959371116 3:105527261-105527283 AAAAAGGTCTAGAAGTCAAATGG + Intronic
959666328 3:108926182-108926204 CAGCAGTTAAAAAAGACAAAGGG - Intronic
959908145 3:111732880-111732902 CAGAAGAGATAGAAGACAGAAGG - Intronic
961578073 3:127854861-127854883 AAGAAGCTTTAGAAGATAAAAGG + Intergenic
962264628 3:133936081-133936103 CAGAAGGCTTAGAAGACAAAAGG + Intronic
963362528 3:144293180-144293202 CAGCATTTCTAGAACATAAAAGG - Intergenic
964299549 3:155272994-155273016 CAGCAGTTAAAAAAGACAAAGGG + Intergenic
964347833 3:155771993-155772015 CAGAAGTTCAAGAAGGGCAAGGG + Intronic
966087766 3:176090377-176090399 CAGAAAGTATAAAAGACAAAGGG + Intergenic
967049097 3:185765638-185765660 CAGAAGTGCTCGAGGACCAAGGG + Intronic
967622172 3:191647448-191647470 AAGAAGTTCTAGAATAAGAATGG - Intergenic
970443610 4:16106317-16106339 AAGAAGTTCAAGATGACATATGG - Intergenic
970823209 4:20243770-20243792 AGGAAGTTCTCTAAGACAAAAGG - Intergenic
973644574 4:52937233-52937255 CTTAAGTTCTAGAAGAGCAAGGG + Intronic
974328565 4:60446426-60446448 GAGCACTTCAAGAAGACAAAAGG - Intergenic
977440966 4:97066944-97066966 CACAATTTCTAAAAGACCAAAGG + Intergenic
977549523 4:98425611-98425633 CAGCAGTTCAAAAAGACAGAGGG + Intronic
978074894 4:104516210-104516232 AAGATGCTCTAAAAGACAAATGG - Intergenic
979728824 4:123997257-123997279 CAGAATGTCTGGAAGACAAGAGG + Intergenic
980278080 4:130681305-130681327 CATAAATTCAACAAGACAAAAGG - Intergenic
980411074 4:132419751-132419773 CATCAGTTCTATGAGACAAATGG + Intergenic
980989331 4:139725515-139725537 GAGAGGTTCTAGAAGGCACAGGG - Intronic
981053143 4:140331577-140331599 CTCATGTTCTAGAAGCCAAATGG - Intronic
981580885 4:146247449-146247471 CAGAAGATGTAGAGGAAAAAGGG + Intergenic
981875854 4:149544934-149544956 CAAAACTTCTAGAAGAAAACAGG + Intergenic
983064602 4:163194044-163194066 CAGAAGTTTAGGAAGTCAAAAGG - Intergenic
983386070 4:167063493-167063515 CAGAAGTTACAGAATTCAAAAGG + Intronic
983754850 4:171322154-171322176 CAGCAGTTAGAAAAGACAAAGGG + Intergenic
983997066 4:174195428-174195450 TAGAAGCTCCAGAAGAAAAAAGG + Intergenic
984610478 4:181831395-181831417 CAGAAGTTAGAAAAGCCAAATGG + Intergenic
985033691 4:185817857-185817879 AAGCACTTCTAGAAGACACAAGG - Intronic
985137975 4:186808137-186808159 CAGAATGTCTAGAAGGTAAATGG - Intergenic
985245847 4:187979053-187979075 CATCAGTTCTATAAGACAATTGG - Intergenic
986152787 5:5142574-5142596 CAGAAGAGCTAGAAGACACTTGG + Intronic
988322769 5:29721212-29721234 CAGAAATTTTAAAAGACACAGGG - Intergenic
988878307 5:35472729-35472751 ATGAAGTCCTATAAGACAAATGG - Intergenic
989686773 5:44098314-44098336 AAGAAGGTCTTGAATACAAAAGG - Intergenic
990634251 5:57706560-57706582 TAGAAGGTTTAGAAGATAAATGG + Intergenic
992297659 5:75341856-75341878 CAATAGTGCTAGAAGACCAATGG - Intronic
993148254 5:84125064-84125086 CAAAAGTTCTAAAAGACTATAGG + Intronic
993289336 5:86044254-86044276 CAGAAGTTCATAAAGACAATAGG - Intergenic
993336649 5:86667905-86667927 CAGAAGTTCTAAAGGGCATATGG - Intergenic
993743480 5:91566912-91566934 CAGCAGTTAAAAAAGACAAAAGG + Intergenic
995989608 5:118221438-118221460 CAGAAGCTGCAGAAGAAAAATGG - Intergenic
996143176 5:119940139-119940161 GAGAAGCACCAGAAGACAAAGGG - Intergenic
996297736 5:121942786-121942808 CAGAAGTCCTAGAATACACATGG - Intergenic
1003475651 6:6479807-6479829 CTGTAGTTCTAGAAGCCCAAAGG - Intergenic
1004461215 6:15838235-15838257 CAACCATTCTAGAAGACAAAAGG + Intergenic
1004587566 6:17016627-17016649 CTGAAGTTTTAGAAGTAAAATGG - Intergenic
1005439837 6:25855143-25855165 CCAAAGATATAGAAGACAAAGGG + Exonic
1005559490 6:27023714-27023736 CAGAAGTACAAGAAGGCAAGTGG - Intergenic
1007429695 6:41769632-41769654 CTGGAGTCCTAGAAGCCAAAAGG - Intergenic
1008966920 6:57322225-57322247 CAGAAGATCTAGAATAGAATGGG + Intronic
1009431397 6:63570576-63570598 CACAAGTTCTACAAGAAAATTGG + Intronic
1009689628 6:67011763-67011785 CATAAGCACTAGAAGATAAACGG + Intergenic
1009704058 6:67221719-67221741 AAGAAATTCTAGAAGCCAGAAGG + Intergenic
1010504600 6:76641744-76641766 CAGATATACTAGAAGAAAAAAGG + Intergenic
1010605439 6:77884455-77884477 CAGAACTACTAGAAGAAAACAGG - Intronic
1010633485 6:78229097-78229119 CAGAAGTTTAAGAAAACAGAGGG - Intergenic
1010665427 6:78624222-78624244 CAGGAGTTTAAGAAAACAAAGGG + Intergenic
1011227646 6:85125702-85125724 GAGAAGTCCCAGAAGACAAATGG + Intergenic
1011891856 6:92173757-92173779 CACAAGTTATAGCAGGCAAAGGG + Intergenic
1013573225 6:111451131-111451153 CAGAGGTCATAGAAGAAAAAGGG + Intronic
1013576678 6:111490187-111490209 CAGAGGTGCTAGAAGATAAATGG - Intergenic
1014017697 6:116552461-116552483 TAGGAGTTCTGGAAGAAAAAAGG - Intronic
1015113857 6:129623720-129623742 CATACCTTCTAGAAGACAAACGG + Intronic
1015333799 6:132011384-132011406 TAGAAGTTCAAGAGGAAAAATGG + Intergenic
1015618895 6:135108499-135108521 AACAAGTTCTAGAATAAAAAAGG + Intergenic
1015907518 6:138132159-138132181 CAGAAGGTCAACAAAACAAAAGG - Intergenic
1020077834 7:5270245-5270267 ATGAAGTTCATGAAGACAAACGG - Intergenic
1020250729 7:6466316-6466338 CAGAGGATCTGGAAGAGAAATGG + Exonic
1020549278 7:9580107-9580129 CATGAGTTCCAGATGACAAATGG - Intergenic
1020671664 7:11122858-11122880 CAGAACTTGGAAAAGACAAAGGG - Intronic
1020844673 7:13267884-13267906 ATGAAGTTGTAGAAGAAAAAAGG + Intergenic
1021014388 7:15514775-15514797 CAGTAATTCTAAAAGACAAGAGG - Intronic
1021529537 7:21628853-21628875 CAGAAGATCAACAACACAAAAGG - Intronic
1021544220 7:21795121-21795143 CAAAAGTTTGAGAACACAAAGGG - Intronic
1024435151 7:49343436-49343458 CTGGAGTTCTAGAACAAAAAGGG + Intergenic
1027291762 7:76721503-76721525 CAGAAGTTCCAGAGGATGAATGG + Intergenic
1029517383 7:101034122-101034144 CAGAAGTTGTAGGAGACGAACGG - Exonic
1029517667 7:101036597-101036619 CAGAAGTTGTAGGAGATGAACGG - Exonic
1029517827 7:101038010-101038032 CAGAAGTTGTAGGAGATGAACGG - Exonic
1029518137 7:101040842-101040864 CAGAAGTTGTAGGAGATGAATGG - Exonic
1030736508 7:113054955-113054977 TAAAAGTTATTGAAGACAAATGG - Intergenic
1030894970 7:115047782-115047804 CACAACTTCTAAAAGAAAAAAGG + Intergenic
1031383111 7:121112641-121112663 CAGAAGTCCTAAAAAGCAAAAGG + Intronic
1033983402 7:147193814-147193836 CAGAATGTCTAGAAGGCAAGAGG + Intronic
1034604439 7:152298496-152298518 CTAAAGTTCTAGAAGAAAAAAGG + Intronic
1035121115 7:156567789-156567811 CAGAATTTCTAGTACAGAAAGGG - Intergenic
1035201705 7:157271888-157271910 CAGAAGCTGGAGGAGACAAAGGG - Intergenic
1035673802 8:1440597-1440619 CAGAAATTTTAGAAGACTCATGG + Intergenic
1036579385 8:10059057-10059079 CAGAAGTTCTTAAATACATAAGG + Intronic
1037085916 8:14850407-14850429 CAGAAGATGGAGAAAACAAAGGG + Intronic
1038101811 8:24386605-24386627 GATAAGATCTAGAAGACAAATGG - Intronic
1039443537 8:37612308-37612330 AAGGAGTTCTGGAAGAAAAAAGG + Intergenic
1039520147 8:38163772-38163794 AAGAAATTCTAGAAGAACAAAGG - Exonic
1039935595 8:42041526-42041548 CAGGAGTTCGAGAACACAACTGG + Intronic
1040574938 8:48643711-48643733 CAGAAGTGCCAGGAGACAAGAGG + Intergenic
1041169659 8:55128340-55128362 CAGAAGTTCTAGTAGAGCACTGG - Intronic
1041307420 8:56476802-56476824 CAGAAGTTCCAGAGCACAGAAGG - Intergenic
1043451937 8:80376512-80376534 CAGCAGTGCTAGTACACAAAGGG + Intergenic
1043629105 8:82305958-82305980 CAGCAGTTGATGAAGACAAATGG + Intergenic
1043803056 8:84635940-84635962 CAGAAGTTCAAAAAGCCAAGGGG - Intronic
1043955869 8:86359279-86359301 CATAGGTTCCAGAAGAGAAAGGG - Intronic
1044215332 8:89602825-89602847 CAAAATTTCTCAAAGACAAATGG - Intergenic
1044679330 8:94761441-94761463 GAGAATTTCAGGAAGACAAAGGG - Intronic
1044912018 8:97069925-97069947 CATTAATTATAGAAGACAAAAGG + Intronic
1045635540 8:104183541-104183563 CAGAAGTTCCAGAATACCATGGG + Intronic
1046250918 8:111629962-111629984 CAGAAATTTTAGCAGACATATGG + Intergenic
1046831719 8:118753362-118753384 CAGAACTTTTAAAAGACAAAGGG - Intergenic
1046967977 8:120188471-120188493 CAGAAAGTATAGAAGAGAAAGGG + Intronic
1047238673 8:123065301-123065323 GAAAAGTTTTAGAAGAGAAAAGG + Intronic
1047371785 8:124261819-124261841 CAGAAGGTCAGGAAGACAGAAGG - Intergenic
1048569747 8:135642149-135642171 GAGAAGTTCTGGAAGAGCAAAGG + Intronic
1048954111 8:139520233-139520255 CAGAACTACTAGAAGACATAGGG - Intergenic
1050315892 9:4400542-4400564 CAAAAGTTGTAAAAGACTAAAGG + Intergenic
1051128111 9:13828504-13828526 CAGAAATTATAAAACACAAATGG - Intergenic
1052238339 9:26240716-26240738 CAGTAGTTTTGAAAGACAAATGG + Intergenic
1052410979 9:28120668-28120690 CAGAATTTCTAGATGTAAAATGG + Intronic
1052711269 9:32059472-32059494 CTGAAATTCTAGAAGACAATGGG - Intergenic
1052898206 9:33767971-33767993 CAGAACTGTTAGAAGATAAATGG + Intronic
1052981378 9:34452250-34452272 CACAAGTCCTAGAAAACCAAAGG - Intronic
1055971320 9:81915560-81915582 CAGAAGCTGAAGAAGCCAAAGGG - Intergenic
1055973042 9:81930623-81930645 CAGAAGCTGAAGAAGCCAAAGGG - Intergenic
1055974795 9:81945715-81945737 CAGAAGCTGAAGAAGCCAAAGGG - Intergenic
1056281157 9:85042315-85042337 CAGAAGGACTAGAAGGGAAAAGG - Intergenic
1056365196 9:85898030-85898052 CAGGAGTTCCAGAAAAAAAAAGG + Intergenic
1057213601 9:93215491-93215513 TAAAACTTATAGAAGACAAAGGG - Intronic
1057540119 9:95959823-95959845 AAGGAGTCCTAAAAGACAAAAGG + Intronic
1058371292 9:104270860-104270882 TAGGAGTTCTAGAAAACAGAAGG + Intergenic
1058421691 9:104838687-104838709 CAAAAGTTGTAACAGACAAATGG + Intronic
1059256504 9:112935865-112935887 CAGCAGCTCTAAAAGACAAAAGG + Intergenic
1059545357 9:115170477-115170499 AAAAATTTCTAGCAGACAAAAGG - Intronic
1059696573 9:116735578-116735600 GAGAAGATCTAGAGGACAAGGGG - Intronic
1060100630 9:120837575-120837597 CAAAACTTCTAGAAGAAAACAGG - Intronic
1060160761 9:121361207-121361229 CAGAAGTGGTAGATGACTAAGGG - Intronic
1060346192 9:122817738-122817760 CAGAAGTTCTAAAATACAGTAGG - Intronic
1061768129 9:132895659-132895681 CAGCAGGTCTAGAAGAACAACGG - Exonic
1188228320 X:27629308-27629330 CAGAACTCCTAGAAGAAAACAGG - Intronic
1190110974 X:47588676-47588698 CAGATGTTCTACAAGAGCAATGG - Intronic
1191065687 X:56344629-56344651 CAGCAGTTAAAAAAGACAAAAGG + Intergenic
1191176131 X:57503533-57503555 CAGAAACTCTACAAGACAGAAGG + Intergenic
1192188574 X:68976036-68976058 CAGAAGTAATAGAAGCCAGAAGG - Intergenic
1192751181 X:73993260-73993282 CAGTGGTGCTAGAAGATAAATGG - Intergenic
1193729322 X:85083137-85083159 TAGAAGCTCCAGAAGATAAAGGG - Intronic
1194608201 X:96007044-96007066 CACAAGTTTTAAAAGAAAAATGG + Intergenic
1194624960 X:96216321-96216343 CAGAAATTCTACAAGCCAGAAGG + Intergenic
1195015237 X:100772570-100772592 CAAAAGATCAAGAAAACAAAAGG - Intergenic
1195316212 X:103680935-103680957 CAGAGGTTCCATAAAACAAAGGG + Intronic
1195338630 X:103882003-103882025 GAGAAGATGGAGAAGACAAAAGG - Intergenic
1196155959 X:112430799-112430821 CAGAAGTTCTAGAAGAGCGTGGG - Intergenic
1197165758 X:123375839-123375861 CAGAACATCTAGAAGATGAAAGG - Intronic
1197453361 X:126645434-126645456 CCAAAGTTCTAGCAGACAATAGG + Intergenic
1198066598 X:133103725-133103747 CATAAGTTCTAGAACAGAAAAGG + Intergenic
1198393686 X:136201937-136201959 TAGAAGTTCTGGAAGATTAAAGG + Intronic
1200738323 Y:6825758-6825780 TAGAAGTTTAAAAAGACAAAGGG - Intergenic
1201988854 Y:20002344-20002366 CAGAAATTAAAGTAGACAAAAGG + Intergenic
1202600226 Y:26586759-26586781 CATTATTCCTAGAAGACAAAAGG + Intergenic