ID: 952788024

View in Genome Browser
Species Human (GRCh38)
Location 3:37175818-37175840
Sequence CTTTTCCCCAGCGCGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952788020_952788024 -1 Left 952788020 3:37175796-37175818 CCACAGTGGGAATAACACGTACC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 952788024 3:37175818-37175840 CTTTTCCCCAGCGCGGTGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 89
952788016_952788024 14 Left 952788016 3:37175781-37175803 CCAATTTAATTTCTCCCACAGTG 0: 1
1: 0
2: 0
3: 26
4: 259
Right 952788024 3:37175818-37175840 CTTTTCCCCAGCGCGGTGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 89
952788015_952788024 15 Left 952788015 3:37175780-37175802 CCCAATTTAATTTCTCCCACAGT 0: 1
1: 0
2: 1
3: 20
4: 316
Right 952788024 3:37175818-37175840 CTTTTCCCCAGCGCGGTGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 89
952788019_952788024 0 Left 952788019 3:37175795-37175817 CCCACAGTGGGAATAACACGTAC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 952788024 3:37175818-37175840 CTTTTCCCCAGCGCGGTGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952788024 Original CRISPR CTTTTCCCCAGCGCGGTGGA AGG Intronic
904762859 1:32817903-32817925 CTTTTCCTCAGCGGGGTGAGGGG - Exonic
905580898 1:39082029-39082051 CGTTTCCCCACGGCGGAGGAGGG - Intronic
909339613 1:74517040-74517062 CTTGTCCCCAGCTCTGTTGATGG + Intronic
915333991 1:155130061-155130083 CTTTTCCCCAGGGTGGGGGAGGG + Intronic
915532480 1:156510748-156510770 CATTTCCCCAGCGCCCTGGCTGG - Intergenic
915955616 1:160217696-160217718 GTTCTCGCCAGCGCTGTGGATGG + Exonic
916719434 1:167473255-167473277 CTTGCCCCCTGGGCGGTGGAGGG - Intronic
920270054 1:204755922-204755944 CTATTCCCCATGGCTGTGGAAGG - Intergenic
920309374 1:205039834-205039856 GTTTTCCCCAGAGCTGTGGATGG + Intergenic
924858792 1:247900188-247900210 CTTTTTCCCAGCGAGGTTCAAGG + Intergenic
1068987064 10:63117308-63117330 AATTAGCCCAGCGCGGTGGAGGG + Intergenic
1070832375 10:79426074-79426096 CATATCCCCAGGGCAGTGGAAGG - Intronic
1071569804 10:86690682-86690704 CTTTTCCCCAGAGGGCTGGCTGG - Intronic
1075521439 10:123146040-123146062 TTCTTCCCCAGCGGGGTGGCTGG + Intergenic
1075633801 10:124017026-124017048 CTTGCCCCCAGGGCGCTGGATGG + Intronic
1077097667 11:805773-805795 CTTCTCCCCTGCGCGATTGAAGG - Intronic
1084643784 11:70442459-70442481 CTGTTGCCCAGTGCGGTGGCGGG - Intergenic
1089800762 11:121024626-121024648 CCTTGCCCCAGCGTGGGGGATGG + Intronic
1090803329 11:130188044-130188066 ATCTTCCCCAGCGGGGTGCAGGG + Intronic
1091832016 12:3556812-3556834 CTTTTGCCCTGCCCAGTGGAGGG + Intronic
1091866083 12:3838777-3838799 CGTTTCCCCACCACGCTGGAGGG - Intronic
1094374620 12:29776832-29776854 CTTTTCCCCAGATCTGTGCAGGG - Intronic
1102722382 12:115028452-115028474 TTTTTCCCTAGCACGGAGGAAGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1108435938 13:50401615-50401637 CTTTTCCCCTGGGGCGTGGAGGG - Intronic
1115922347 14:38390085-38390107 ATTTTCCCCAGTGTGGTGGGAGG - Intergenic
1117313474 14:54551279-54551301 TGTTTCCCCAGCTCTGTGGATGG + Intergenic
1120746734 14:88159158-88159180 GTTTTCCTCAGTGAGGTGGAAGG - Intergenic
1122901984 14:104785820-104785842 CTGTGCCTCAGCGAGGTGGACGG - Intronic
1129884797 15:79030628-79030650 GTTTTCTCCAGCTCGGTTGATGG + Intronic
1130906088 15:88241724-88241746 CTTCTCCCCAGTGCGCTGGGTGG - Intronic
1133030463 16:3008444-3008466 CTTTTCCCAGACGTGGTGGATGG + Intergenic
1133732767 16:8590481-8590503 CTTTTCCTCGGCGAGGAGGAGGG - Intergenic
1137933152 16:52607902-52607924 ATTCTCCCCAGCGCTGTGGATGG - Intergenic
1141700554 16:85640199-85640221 CTTGTCACCAGCCCGGTGGCCGG + Intronic
1142253782 16:89004067-89004089 CTTTTCCCCAGCCTGGCCGAGGG + Intergenic
1142699372 17:1649843-1649865 CTTTTCCCCGTCCCAGTGGAGGG - Exonic
1144388254 17:14770197-14770219 CTGTTCCCCAGGGCAGTGGCTGG + Intergenic
1146056843 17:29585549-29585571 CTTTCCCCCAGCCTGGGGGAGGG + Intronic
1147967544 17:44200910-44200932 CTTTTCCCAGCCGCGGTGGATGG + Intergenic
1148766421 17:50041555-50041577 CTTTCCCCCAGCACCGTTGAGGG + Intergenic
1152762844 17:82118444-82118466 CTTTGCCCCAGCGAGGTGCGAGG + Intronic
1152840883 17:82567411-82567433 CTTTTTCCCACCGGGCTGGACGG - Intronic
1154409663 18:14131298-14131320 CTTTTTCACAGAGCAGTGGATGG - Intronic
1154936442 18:21062642-21062664 CTTTTTCCAAACGCTGTGGAGGG - Intronic
1161790691 19:6358081-6358103 CTTCTCCCCAGGGCGGGGGCAGG + Intergenic
1164743339 19:30593348-30593370 TTTATCCCCAGCACAGTGGATGG - Intronic
1166206602 19:41273841-41273863 CTTTTGCCCACCTCTGTGGAAGG + Intronic
1168125473 19:54280214-54280236 CTTGTCCCCAGTGAGGAGGAGGG + Intronic
1168134102 19:54338816-54338838 CTTGTCCCCAGAGAGGAGGAGGG + Intronic
1168171781 19:54594504-54594526 CTTGTCCCCAGTGAGGAGGAGGG - Intronic
1168176502 19:54631334-54631356 CTTGTCCCCAGTGAGGAGGAGGG - Intronic
926491169 2:13527825-13527847 CTTTTTCCCAGCGAGGTTCAAGG + Intergenic
929085485 2:38163540-38163562 CTTTTGCACAGCTCTGTGGAAGG + Intergenic
938082945 2:128379929-128379951 CTTTTCCCCTGCGAGCTGCATGG - Intergenic
1172997183 20:39079612-39079634 CTGTTTCCCAGAGAGGTGGAAGG + Intergenic
1173555282 20:43961418-43961440 CTTTTCCCCAGTGGAGGGGATGG + Intronic
1176863564 21:14028554-14028576 CTTTTTCACAGAGCAGTGGATGG + Intergenic
1182422834 22:30256903-30256925 CTTTTCCCCAGAGCAGTACAGGG - Intergenic
952495310 3:33910674-33910696 CTTTTCCCCAGAGGAGTGGTGGG + Intergenic
952788024 3:37175818-37175840 CTTTTCCCCAGCGCGGTGGAAGG + Intronic
966691307 3:182744432-182744454 CTTTTCCCCATGGCCTTGGAGGG - Intergenic
968513363 4:1004865-1004887 CCGTACCCCAGCACGGTGGAGGG + Intergenic
968918681 4:3511128-3511150 CTTTCTCCCAGCTGGGTGGAAGG - Exonic
981475194 4:145180467-145180489 CGTTTCCCCACCTCGCTGGAGGG + Intergenic
986268445 5:6210802-6210824 CTTTTCTCCAGGAGGGTGGAAGG + Intergenic
987038598 5:14041119-14041141 CTGTTCCCCAGCGGCTTGGAGGG - Intergenic
988978144 5:36535994-36536016 CTGTTCCCCACCCCAGTGGAAGG - Intergenic
989724387 5:44570759-44570781 CTTTTCCACAGAACGATGGAAGG - Intergenic
994717171 5:103335656-103335678 CTTTCCCCCATCTCAGTGGAAGG - Intergenic
997689357 5:135815196-135815218 CTTTTCCACAGAGAGGGGGAAGG + Intergenic
1004457484 6:15804369-15804391 GTTTTCACCAGCGCGGTGAGTGG + Intergenic
1006136118 6:31897343-31897365 CTGCCCCCCAGCCCGGTGGACGG + Intronic
1011845886 6:91562258-91562280 CTCCTCCCCAGAGAGGTGGAGGG - Intergenic
1012788682 6:103663578-103663600 CTTTTCCCCAGCACTTTGGGAGG - Intergenic
1012939693 6:105403288-105403310 CTTGTCCCCGGCGCAGAGGACGG - Intergenic
1017740019 6:157398238-157398260 CTTTTGCCCAGCAGGCTGGATGG + Intronic
1017891659 6:158644475-158644497 CGTTTCCCCGGCGCGGGGGGCGG - Intronic
1020470715 7:8531424-8531446 CTCTTCCCAAGTGAGGTGGATGG + Intronic
1023864705 7:44233227-44233249 CTGTGCCCCAGCGTGGTGGGGGG + Intronic
1026471332 7:70695412-70695434 CGCTTCCCCAGCGCGGAGGTCGG + Intronic
1042837618 8:73092577-73092599 CTGTTCTCCAGCGGGATGGAAGG - Intronic
1044437911 8:92187820-92187842 TTTTTCCCTAGAGAGGTGGAGGG - Intergenic
1047490792 8:125373210-125373232 CTTTGCCCCAGGGCCATGGAGGG + Intergenic
1048286696 8:133147209-133147231 CTATTCCCCAGTGCCCTGGAGGG - Intergenic
1049726317 8:144148099-144148121 CTCTTCCCCAGCGCCGCCGAAGG - Intronic
1052834481 9:33240400-33240422 ACTTTCCCCAGCACAGTGGAGGG - Intronic
1059680622 9:116581927-116581949 TCTTTCCCCAGGGAGGTGGAAGG + Intronic
1060203485 9:121667266-121667288 CTTTTCCCCAGCACTTTGGGAGG - Intronic
1061061393 9:128252134-128252156 CTTTTTCCCAGGGCGGTTGTGGG + Intronic
1062044694 9:134419602-134419624 TTTCTCCCCAGCGCGGGGCAGGG + Intronic
1062216439 9:135392160-135392182 CTTGTCCCCAACGCATTGGAGGG + Intergenic
1062268165 9:135696838-135696860 CTATTCCCCAGCCCCCTGGAAGG + Intronic
1187758141 X:22548322-22548344 CGTTTCCCCAGCAAGGGGGAAGG - Intergenic