ID: 952790929

View in Genome Browser
Species Human (GRCh38)
Location 3:37200262-37200284
Sequence CTGCATGTTTGTATGTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952790929_952790938 26 Left 952790929 3:37200262-37200284 CCACCCAACATACAAACATGCAG No data
Right 952790938 3:37200311-37200333 CTGTTAATTGGCCCATAGTTTGG No data
952790929_952790934 14 Left 952790929 3:37200262-37200284 CCACCCAACATACAAACATGCAG No data
Right 952790934 3:37200299-37200321 AGTCCCTAAAACCTGTTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952790929 Original CRISPR CTGCATGTTTGTATGTTGGG TGG (reversed) Intergenic
No off target data available for this crispr