ID: 952793153

View in Genome Browser
Species Human (GRCh38)
Location 3:37216450-37216472
Sequence CTGCTGGCCTTGTCCAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952793149_952793153 13 Left 952793149 3:37216414-37216436 CCACCATTCTGAGTAGTCCTGCA No data
Right 952793153 3:37216450-37216472 CTGCTGGCCTTGTCCAGAACTGG No data
952793148_952793153 29 Left 952793148 3:37216398-37216420 CCATTAGCAGAAGAAGCCACCAT No data
Right 952793153 3:37216450-37216472 CTGCTGGCCTTGTCCAGAACTGG No data
952793150_952793153 10 Left 952793150 3:37216417-37216439 CCATTCTGAGTAGTCCTGCAAGC No data
Right 952793153 3:37216450-37216472 CTGCTGGCCTTGTCCAGAACTGG No data
952793151_952793153 -4 Left 952793151 3:37216431-37216453 CCTGCAAGCATGTTTCTCTCTGC No data
Right 952793153 3:37216450-37216472 CTGCTGGCCTTGTCCAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952793153 Original CRISPR CTGCTGGCCTTGTCCAGAAC TGG Intergenic
No off target data available for this crispr