ID: 952796136

View in Genome Browser
Species Human (GRCh38)
Location 3:37241155-37241177
Sequence CTGTGTTTGTACATATATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 0, 2: 3, 3: 67, 4: 545}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952796136 Original CRISPR CTGTGTTTGTACATATATGT GGG (reversed) Intergenic
900484630 1:2916083-2916105 TTGTGTTTGTGTATATGTGTAGG - Intergenic
900546746 1:3233652-3233674 CTGTGTTAGTAAAGTTATGTAGG - Intronic
900907369 1:5568985-5569007 TTATGTTTGTACCTACATGTCGG + Intergenic
904123598 1:28220146-28220168 GTGTGTTTGTATGTGTATGTAGG - Intronic
905008472 1:34730193-34730215 CTGTGTATGCACATCTATTTGGG - Intronic
905174366 1:36126580-36126602 CTGTGTGTGTACGTGTAGGTGGG + Intergenic
905246103 1:36614948-36614970 GTGTGTGTGTATATGTATGTAGG + Intergenic
905521292 1:38602614-38602636 CTATATTTGTACATATCTATGGG - Intergenic
905874024 1:41420880-41420902 ATATGTTTGTATATATGTGTGGG + Intergenic
906006154 1:42472933-42472955 ATGTGTATGTATATATATCTTGG - Intronic
906075770 1:43050924-43050946 ACATGTATGTACATATATGTAGG - Intergenic
906300851 1:44680613-44680635 CTTTGTTTGTATATTTATTTGGG + Intronic
907222049 1:52914354-52914376 CTGTGTGTGTGCATGCATGTTGG + Intronic
907993587 1:59607195-59607217 CTGGGTTCTTTCATATATGTGGG + Intronic
908048507 1:60200357-60200379 ATGTGTTTCTAAATGTATGTAGG - Intergenic
908367819 1:63444516-63444538 GTATATATGTACATATATGTAGG + Intronic
909287822 1:73843260-73843282 CTGTGTTTCAACTTATGTGTTGG + Intergenic
909549860 1:76885802-76885824 CTGTGTCTGAGCATATAGGTGGG - Intronic
909824326 1:80108448-80108470 GTGTGTATATATATATATGTAGG - Intergenic
910502305 1:87906726-87906748 ATATGTGTGTACATATATGTAGG - Intergenic
911291800 1:96065423-96065445 TTTTGTTTGTACATATTTATGGG + Intergenic
911950181 1:104163564-104163586 GTGTGTGTGTATATATATATGGG - Intergenic
912040701 1:105386021-105386043 ATGTGTGTATACATATATTTTGG - Intergenic
912119340 1:106451025-106451047 GTGTGTATGTGCATATGTGTGGG - Intergenic
912244766 1:107949723-107949745 CTGTGTGTGTACATGTACTTTGG - Intronic
912902350 1:113665590-113665612 GTGTGTATGTATATATATTTTGG + Intronic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
914200164 1:145477292-145477314 CTATGTATGTACTTAGATGTTGG - Intergenic
914479280 1:148050444-148050466 CTATGTATGTACTTAGATGTTGG - Intergenic
914972423 1:152321051-152321073 GTGTGTGTGTATATATATATAGG - Intronic
915389894 1:155532941-155532963 GTGTGTGTGTATATATATATGGG + Intronic
915788879 1:158646110-158646132 CTGTGTGTGTATGTGTATGTTGG - Intronic
915837759 1:159191512-159191534 CTGTTCTTGTTCTTATATGTAGG + Intronic
917279250 1:173364349-173364371 ATGTATGTGTACATATATATTGG + Intergenic
917505452 1:175623239-175623261 GTGTGTGTGCATATATATGTTGG + Intronic
918027810 1:180770030-180770052 CTGTGTTTATACATAAATACTGG + Intronic
918425041 1:184400398-184400420 GTGTGTTTGTATGTATGTGTAGG + Intronic
918581179 1:186131755-186131777 CTGTGTGTGTAAATTTATGTAGG - Intronic
918832627 1:189417364-189417386 ATGTGCATGTACATATATGTAGG + Intergenic
918846038 1:189614841-189614863 ATGTGTGTATATATATATGTTGG - Intergenic
919247148 1:195003371-195003393 TTGTGTTTGTGGTTATATGTAGG - Intergenic
921557633 1:216617732-216617754 CTAATTTTGGACATATATGTGGG - Intronic
921624800 1:217367460-217367482 CTGTGTGTATACGTGTATGTAGG - Intergenic
921737112 1:218641499-218641521 CTGTGTTTACACATACATATTGG + Intergenic
922131610 1:222786079-222786101 CTATGTGTGTATATATATGGGGG + Intergenic
922656924 1:227393204-227393226 CTGTGATTTTATATATCTGTGGG + Intergenic
922992539 1:229926899-229926921 TTGTATTTGTACATATTTATGGG + Intergenic
923128963 1:231058153-231058175 CTGAGTTTGTAGCTATATCTTGG - Intergenic
923638832 1:235730499-235730521 GTGTGTGTATACATATATATGGG + Intronic
923808276 1:237284561-237284583 GTGTGTGTGTATATATATGGTGG - Intronic
924029742 1:239874263-239874285 CTGTGTATATAGATATATATAGG - Intronic
1063482380 10:6386910-6386932 CTGTGTATGTGCCTGTATGTGGG - Intergenic
1063751467 10:8953369-8953391 ATGTGTGTGTACACATTTGTGGG - Intergenic
1065019482 10:21492825-21492847 CTGTGTGTGTATTCATATGTGGG + Exonic
1065160879 10:22920093-22920115 CAGTGATTGTACATTTATTTTGG - Intergenic
1065310625 10:24413052-24413074 CTGGATTTGTGCATATATTTTGG - Intronic
1065459635 10:25945507-25945529 CAGTGTTTGTTCATATATTTTGG + Intronic
1065907329 10:30268844-30268866 ATGTGTTTTTACATATATATGGG + Intergenic
1066641525 10:37558848-37558870 ATGTGTGTGTATATATATATGGG + Intergenic
1066974322 10:42352135-42352157 ATATGTGTGTATATATATGTAGG - Intergenic
1067235553 10:44445335-44445357 CTGTATTTATTCATATATCTAGG + Intergenic
1068023198 10:51610017-51610039 TTGTATTTGTACATATTTATGGG + Intronic
1068281283 10:54873570-54873592 GTGTGTATATATATATATGTTGG + Intronic
1068281290 10:54873779-54873801 GTGTGTGTATATATATATGTTGG + Intronic
1068659566 10:59610068-59610090 CTTTGTTTATAAATATATGGAGG + Intergenic
1068835648 10:61549526-61549548 TTGTAGTTGTACATATATATGGG - Intergenic
1068903340 10:62294977-62294999 GTGTGTGTGTATATATATATAGG + Intergenic
1069191804 10:65501152-65501174 GTATGTGTGTACATATATGTAGG - Intergenic
1069718061 10:70533389-70533411 GTGTGTGTGTACCTGTATGTAGG + Intronic
1070210514 10:74315307-74315329 CTATGTATAGACATATATGTTGG + Intronic
1070361330 10:75692384-75692406 ATGTGTGTGTATATATATGTAGG - Intronic
1071127486 10:82352184-82352206 GTGTGTTTGTGCATGTATGTGGG - Intronic
1071641883 10:87316528-87316550 CTGTATTTCTACATGTATATAGG - Intergenic
1072725994 10:97814420-97814442 TTGGGTTTGTAGGTATATGTGGG + Intergenic
1072785974 10:98282546-98282568 CTGTGTGTGTACATGTGTGTTGG + Intergenic
1073422458 10:103435408-103435430 GTATCTTTGTACATATATTTGGG + Intronic
1073494105 10:103875909-103875931 GTGTGTGTGTATATATATTTAGG - Intergenic
1074040972 10:109788025-109788047 CTGTAATTGTACACATTTGTGGG + Intergenic
1074236733 10:111592255-111592277 GTGTGTGTGTGCATGTATGTAGG + Intergenic
1074309014 10:112305939-112305961 GTGTGTGTGTATATATATGAGGG + Intergenic
1074441965 10:113485733-113485755 ATGTGTCTGTAAATATATCTTGG - Intergenic
1074844251 10:117383127-117383149 GTGTGTGTGTACATGTGTGTTGG + Intergenic
1074955671 10:118386442-118386464 CTGTGTCTTTAGATATATTTAGG + Intergenic
1075707300 10:124509098-124509120 GTGTGTTTGCACTTATAAGTGGG - Intronic
1075827937 10:125376360-125376382 CTCTGTTTGGACAGTTATGTTGG - Intergenic
1076277162 10:129211060-129211082 CTGTGTTTTTAAAGATATGGTGG - Intergenic
1076417735 10:130303489-130303511 CTGTATTTGTCCATATACTTTGG + Intergenic
1077879794 11:6340025-6340047 ATATATTTGTACATATATGTGGG - Intergenic
1077965377 11:7126204-7126226 CTGAGTCTGTAGATATATTTTGG + Intergenic
1078955480 11:16189431-16189453 GTGTGTGTGTACACATATGTTGG + Intronic
1079341585 11:19616234-19616256 CTGTGTTTGTAATTTAATGTGGG + Intronic
1079883043 11:25950593-25950615 ATGTGTTTCTACTTATAAGTAGG + Intergenic
1079918904 11:26407026-26407048 GTGTGTGTGTATATATATATGGG + Intronic
1080169662 11:29284656-29284678 ATATGTATGTAAATATATGTAGG + Intergenic
1080424257 11:32141889-32141911 TTATGTATGTACATATATGCTGG + Intergenic
1080672052 11:34389366-34389388 TGGTGTATGTACATATATGATGG - Intergenic
1081086148 11:38803905-38803927 CTTTCTTTGTAAATGTATGTGGG - Intergenic
1081680731 11:45000583-45000605 CTGGGTTTCTACATAGATTTAGG + Intergenic
1082691491 11:56309864-56309886 CTGTGACTGGACATAGATGTTGG - Intergenic
1082709124 11:56531671-56531693 ATGTATGTGTATATATATGTTGG + Intergenic
1084609163 11:70190772-70190794 CTGTGTGTGTGCATATGTGCCGG + Intergenic
1084908690 11:72369763-72369785 CTGTGTGTGTGTATGTATGTGGG + Intronic
1085137368 11:74104500-74104522 ATGTGTATGTACATGTATGGGGG + Intronic
1086056216 11:82650211-82650233 ATGTGTATATACATATATATAGG - Intergenic
1086812171 11:91323562-91323584 CAGTGTATGTAGCTATATGTTGG + Intergenic
1087401350 11:97670348-97670370 CTGTGTGTGTGCATGTATGTAGG - Intergenic
1087554046 11:99691737-99691759 CAGAGTTTGTAGATATCTGTCGG + Intronic
1087646582 11:100814880-100814902 CTTAGTATGTACAGATATGTAGG + Intronic
1089725238 11:120471906-120471928 ATGTCTTTGTACATCCATGTAGG - Intronic
1090133085 11:124166092-124166114 ATGTGTGTGTATATATATATAGG - Intergenic
1091975190 12:4819105-4819127 ATGTGTTTGTGTATATACGTGGG - Intronic
1092482099 12:8868846-8868868 ATGTGTGTGTATACATATGTAGG + Intronic
1092639693 12:10491850-10491872 GTATATTTGTACATATTTGTGGG + Intergenic
1092657069 12:10697296-10697318 CTGTGGTTGTTCATATTTGATGG - Intergenic
1092657841 12:10706130-10706152 ATGTGTGTATATATATATGTGGG + Intronic
1092743469 12:11651536-11651558 TTGTGTTTGTACATAACTGGAGG + Intronic
1093545653 12:20343290-20343312 CTGTGTATGTGCATATGTGTTGG - Intergenic
1093575502 12:20723136-20723158 CAGTGCTTGTACATAAATATAGG - Exonic
1093837200 12:23847904-23847926 ATGTGTTTGTATATTTATGTAGG - Intronic
1094232166 12:28118903-28118925 CTGCGTGTGTACATATATATGGG - Intergenic
1094635133 12:32219264-32219286 GTGTGTGCGTGCATATATGTTGG + Intronic
1095467402 12:42502158-42502180 GTGTGTGTGTATATATATATAGG - Intronic
1095652059 12:44623214-44623236 CTTTATGTGTGCATATATGTGGG + Intronic
1096622508 12:52873370-52873392 CTGTGTGTGGATATATCTGTGGG + Intergenic
1097178783 12:57158989-57159011 CTGTGTGCGCACATACATGTGGG - Intronic
1097466040 12:59925928-59925950 ATGTGTGTGTATATATATGATGG + Intergenic
1097525005 12:60722325-60722347 GTGTGTGTGTATATATATATAGG + Intergenic
1099047102 12:77735084-77735106 TTGTGTTTGTACAGATATCAAGG + Intergenic
1099947761 12:89264356-89264378 ATGTGTTTGTACAATTATGAAGG - Intergenic
1099968078 12:89472136-89472158 CTTTCTTTGTGCATTTATGTGGG - Intronic
1100216824 12:92458924-92458946 GTGTGTGTGTATATATATTTTGG - Intergenic
1100454138 12:94735316-94735338 ATATGTTTGTACCTATATTTAGG + Intergenic
1100983503 12:100183441-100183463 GTGTGTGTGTGCATATAAGTAGG - Intergenic
1102303574 12:111788603-111788625 CTGTGTTTGTATAGATCTGGGGG + Intronic
1102732076 12:115120516-115120538 ATGTGTTTGTACATTTTTATTGG + Intergenic
1104114412 12:125735505-125735527 CACTGTTTCTACATATTTGTAGG - Intergenic
1104245564 12:127037834-127037856 GTGTGTGTGTATATATATGTTGG + Intergenic
1104596505 12:130123930-130123952 GTGTGTGTATACATATATATGGG + Intergenic
1104929608 12:132331263-132331285 CTGTGTATGCACATGTGTGTAGG + Intergenic
1105229931 13:18483923-18483945 ATATGTGTGTATATATATGTAGG - Intergenic
1105788838 13:23776913-23776935 GTGTATATGTACATATATGTGGG - Intronic
1107226408 13:38054084-38054106 CTGTGTTTCCACATAGAGGTGGG + Intergenic
1107612686 13:42132158-42132180 CAATGATTGTACATATTTGTAGG + Intronic
1108425854 13:50299430-50299452 ATGTGTGTGTACATGTATATGGG - Intronic
1108574389 13:51778907-51778929 ATGTGTGTACACATATATGTGGG + Intronic
1109024004 13:57137946-57137968 CTGTCTTTGAACATATTTGGTGG - Intergenic
1109504233 13:63278627-63278649 TTGTGTGTGTGTATATATGTAGG - Intergenic
1109508775 13:63340404-63340426 GTGTGTGTGTATATATATTTAGG + Intergenic
1109867600 13:68285791-68285813 GTGTATGTGTATATATATGTGGG - Intergenic
1110199102 13:72827711-72827733 TTTTGTTTCTACATGTATGTAGG + Exonic
1110233094 13:73187123-73187145 GTGTGTATATATATATATGTAGG + Intergenic
1110918951 13:81060270-81060292 CTATGTCTGTATATATATATGGG - Intergenic
1110927705 13:81176465-81176487 ATTTATATGTACATATATGTGGG + Intergenic
1111316309 13:86565268-86565290 CTGTTTATATACATATATTTGGG + Intergenic
1111356410 13:87109636-87109658 CTGTGTTTGTGTGTGTATGTGGG + Intergenic
1111391284 13:87597788-87597810 ATATGTGTGTATATATATGTGGG + Intergenic
1111518582 13:89367504-89367526 ATGTGTTTGTATGTCTATGTTGG - Intergenic
1112221300 13:97493936-97493958 CTGTGATTGTATGTATGTGTGGG - Intergenic
1112885396 13:104164273-104164295 CTGTATTTTTAAATATATGATGG + Intergenic
1113069584 13:106407513-106407535 CTGCTTTTGTACCTTTATGTGGG + Intergenic
1113546915 13:111159734-111159756 CTGAGTTTTTAAATATATTTTGG + Intronic
1113643440 13:111975088-111975110 ATGTGTGCGTACATAGATGTGGG + Intergenic
1113643458 13:111975457-111975479 GTGTGAATGTACATAGATGTGGG + Intergenic
1114014184 14:18410739-18410761 ATATGTGTGTATATATATGTAGG - Intergenic
1114066736 14:19066334-19066356 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
1114095530 14:19333693-19333715 CTGTGTTTGAACAGGTAGGTTGG - Intergenic
1114954665 14:27803229-27803251 TTGTGTTTGTGTATATGTGTGGG - Intergenic
1115844339 14:37509575-37509597 CTATATATGTACATATATATAGG - Intronic
1115844341 14:37509847-37509869 ATGTATATGTACATATATGTAGG + Intronic
1116113544 14:40618628-40618650 CTGTGCTTGTACATAGCAGTAGG + Intergenic
1116530116 14:45960938-45960960 ATGTGTATGTGCATATGTGTGGG + Intergenic
1116692919 14:48134217-48134239 CTGTGTTTCTATATATCTGCAGG - Intergenic
1117678060 14:58175130-58175152 CTGTGTGTATCCGTATATGTCGG + Intronic
1118080458 14:62352607-62352629 ATGTGTATGTGCATATGTGTGGG - Intergenic
1118499086 14:66340662-66340684 ATGTGTGTGTATATATATGTGGG + Intergenic
1118826378 14:69386535-69386557 CTGTGTAAGTACGTATATTTTGG - Intronic
1119109260 14:71956400-71956422 GTGTGTGTGTATATATATGTAGG + Intronic
1119272572 14:73321811-73321833 CTATGTATGTATATATGTGTAGG + Intronic
1120464832 14:84843137-84843159 ATGTATGTGCACATATATGTGGG + Intergenic
1120599010 14:86477546-86477568 GTGTGTGTGCATATATATGTAGG - Intergenic
1121569704 14:94937820-94937842 CTGTGTGTGTATATCTGTGTGGG + Intergenic
1121883212 14:97518687-97518709 CTGAGTATGTATATATGTGTGGG - Intergenic
1124359230 15:29023190-29023212 TTGTGTTTGTACTTCTAGGTAGG + Intronic
1126548928 15:49905947-49905969 GTGTGTGTGTATATATATGTAGG - Intronic
1127425896 15:58856074-58856096 CTGTGTTTCTATATATAGTTTGG + Exonic
1128971727 15:72113723-72113745 GTGTGTTTGTATGTATATATGGG - Intronic
1129053019 15:72797706-72797728 CTCTGTGTGTATATATTTGTGGG + Intergenic
1129297357 15:74607070-74607092 CTGTGTGTGTGCATATCTGGGGG + Intronic
1130615801 15:85406526-85406548 CTGTGGTTGTACCTATAATTGGG + Intronic
1130836082 15:87651452-87651474 CTCTGTATGTACACGTATGTGGG + Intergenic
1132406914 15:101547934-101547956 CTGTGTATATAATTATATGTTGG - Intergenic
1132873468 16:2125611-2125633 CTGTGTTTTTCCATCTGTGTAGG - Intronic
1133546027 16:6807906-6807928 GTGTGTGTGTATATATATATAGG + Intronic
1134794102 16:17018828-17018850 CTGTGTCTGTACATCTACGTGGG + Intergenic
1135742687 16:24990117-24990139 CAATGTTTGTACATATTTATGGG - Intronic
1135897971 16:26427187-26427209 ATGTGTATGTGCATATATATGGG + Intergenic
1136457296 16:30387868-30387890 CAGTGTGTATACATATATATAGG - Intronic
1138375248 16:56558853-56558875 GTGTGTGTGTGCATATATTTGGG + Intergenic
1138609160 16:58109258-58109280 CTGTGCTTGTCCATAGATGGGGG + Intergenic
1139001311 16:62513514-62513536 GTATGTTTGTACATGTAAGTGGG - Intergenic
1140017009 16:71197174-71197196 CTGTGTTTATATCTATATCTAGG - Intronic
1140722940 16:77787863-77787885 CTGTGTATGTGCATGCATGTTGG + Intergenic
1141909849 16:87051219-87051241 GTGTGTGTGTACATGTATGTTGG + Intergenic
1144461902 17:15465122-15465144 CTGTGTTTGTATCTGTGTGTTGG - Intronic
1145977974 17:28995328-28995350 CTGTGTGTGTGCATGTATGTGGG + Intronic
1145984288 17:29034331-29034353 CTGTGCTTGAACAAATATATTGG - Intronic
1146051265 17:29555466-29555488 GTGTGTGTGTACATATATGGGGG + Intergenic
1146134963 17:30311585-30311607 CTGTATATGTACATATATGTGGG + Intergenic
1146553541 17:33803329-33803351 CTGTGTATGTGTATATGTGTGGG + Intronic
1146567042 17:33922347-33922369 CTGGGTTTGTAGAAATAAGTTGG - Intronic
1149098197 17:52870590-52870612 ATGTGTTTCTACCTATAAGTGGG + Intronic
1149137477 17:53386288-53386310 GTGTGTGTGTATATATATGATGG - Intergenic
1150469897 17:65428240-65428262 GTGTGTGTGTATATATATGATGG - Intergenic
1152446979 17:80350874-80350896 CTGTGTTTGTAGACATGTTTTGG + Intronic
1152582010 17:81170010-81170032 ATGTGTATGTGCATATGTGTAGG + Intergenic
1153489992 18:5636951-5636973 CTGTGTTTGGAAATATTTCTAGG - Intergenic
1154079853 18:11245397-11245419 CTGTGTTTATACAAATATTTAGG - Intergenic
1154282733 18:13020573-13020595 GTTTGTTTGGATATATATGTAGG + Intronic
1154392584 18:13953100-13953122 ATGTGTTTGTACAGGTATGAGGG + Intergenic
1154523475 18:15255918-15255940 ATATGTGTGTATATATATGTAGG + Intergenic
1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG + Intronic
1155259245 18:24025508-24025530 TTGTGTTTCTACATAAATGGAGG + Intronic
1155369763 18:25085677-25085699 GTGTGTGTATACATATATGGTGG + Intronic
1156020095 18:32589606-32589628 GTGTGTTTGTAATTACATGTTGG - Intergenic
1156876888 18:42025110-42025132 CTGTTATTGAAAATATATGTTGG - Intronic
1156928376 18:42610948-42610970 CTGTGTTTATACATTGCTGTGGG + Intergenic
1157152841 18:45236607-45236629 ATGTGTGTGTATATATGTGTGGG + Intronic
1157300488 18:46475330-46475352 GTGTGTGTGTACATGAATGTGGG - Intergenic
1158167995 18:54563555-54563577 ATGTGTGTGTATATATATATTGG - Intergenic
1158397880 18:57094028-57094050 GTGTGTGTATACATATGTGTGGG - Intergenic
1158430197 18:57378281-57378303 CTGTGTTTTTCCATATCTATAGG - Intergenic
1159534767 18:69702087-69702109 CTGGGTTAGTACAGAAATGTTGG - Intronic
1159559495 18:69978423-69978445 GTGTGTGTGTATATATATATGGG + Intergenic
1159908871 18:74124470-74124492 CTATGTATGTATTTATATGTGGG - Exonic
1160000849 18:75020332-75020354 GTGTGTGTGTATATATATATAGG + Intronic
1160209486 18:76864498-76864520 ATGTGTGTGTAAATATTTGTTGG - Intronic
1160699608 19:499509-499531 CTGTGTTTGTACACGCGTGTGGG - Intronic
1164882631 19:31747144-31747166 ATGTGTGTGTAGATATATATAGG + Intergenic
1164882632 19:31747182-31747204 GTGTGTGTGTAGATATATATAGG + Intergenic
1164882635 19:31747208-31747230 GTGTGTATGTAGATATATATAGG + Intergenic
1164882638 19:31747246-31747268 GTGTGTGTGTAGATATATGTAGG + Intergenic
1164882639 19:31747282-31747304 ATGTGTGTGTAGATATATATAGG + Intergenic
1164882642 19:31747352-31747374 ATGTGTGTGTAGATATATATAGG + Intergenic
1164882647 19:31747558-31747580 GTGTGTGTGTAGATATATGTAGG + Intergenic
1164882649 19:31747626-31747648 GTGTGTGTGTAGATATATATAGG + Intergenic
1164882651 19:31747720-31747742 ATGTGTGTGTAGATATATATAGG + Intergenic
1164882653 19:31747784-31747806 ATGTGTGTGTAGATATATATAGG + Intergenic
1167091905 19:47350049-47350071 GTGTGTATGTACATAGGTGTGGG + Intronic
1167320014 19:48791583-48791605 ATGTGTGTATATATATATGTAGG + Intergenic
1167676760 19:50892006-50892028 GTCTGGTTGTGCATATATGTAGG + Intergenic
1168159102 19:54496932-54496954 ATGTGTGTGTATATATATGTAGG - Intergenic
924993033 2:330710-330732 CTATGTTTAGACATATTTGTGGG + Intergenic
926881567 2:17550691-17550713 CTGTGTTTGCATGCATATGTGGG - Intronic
927065696 2:19468756-19468778 CTGTGTTTGTGTCTATATGAGGG - Intergenic
927845789 2:26472148-26472170 ATGTGTGTGTGCATGTATGTGGG - Intronic
928236950 2:29551394-29551416 CTGTGCTTATATATATATTTAGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929423237 2:41816510-41816532 TTGTGTGTGTATATATATGTGGG - Intergenic
929741256 2:44603027-44603049 GTGTGTGTGTATATATAGGTTGG - Intronic
929949161 2:46393202-46393224 CTGTGAGTGTGCATGTATGTTGG - Intergenic
930160056 2:48145752-48145774 CTGTGTGTTTGCATATGTGTTGG - Intergenic
930496687 2:52154180-52154202 GTGTGTATATATATATATGTGGG + Intergenic
931254730 2:60560319-60560341 GTGTGTTCCTACATATATATAGG + Intergenic
931328319 2:61251483-61251505 CTGAGTTTGTAGTTATATCTTGG - Intronic
931540039 2:63320936-63320958 CTGTGTTTGTATATTTATAGTGG - Intronic
931541822 2:63337761-63337783 CAGTTTTTCCACATATATGTTGG + Intronic
932784026 2:74583787-74583809 CTGTGTTGGAACAAGTATGTTGG - Intronic
932852842 2:75203097-75203119 CTGTGTATGTGCAAATATATGGG - Intergenic
932981967 2:76680476-76680498 GTGTGTATATACATATCTGTAGG + Intergenic
934928532 2:98399975-98399997 GTGTGTATGTATATATATGTTGG + Intergenic
934998185 2:98985982-98986004 CTGTGCTTGTCCATATTTCTTGG + Intergenic
935168138 2:100587636-100587658 GTGTGTGTATACATATATATGGG - Intergenic
935236883 2:101146599-101146621 CTGTAATTGTACATATTTATGGG + Intronic
935559100 2:104542855-104542877 CTACATTTGAACATATATGTTGG - Intergenic
936074740 2:109394653-109394675 ATGTGTGTGCACATCTATGTAGG + Intronic
936843680 2:116804056-116804078 GTGTGTGTATACATATATGATGG - Intergenic
936983055 2:118281870-118281892 TTGTTTGTGTTCATATATGTTGG + Intergenic
937034333 2:118768578-118768600 CTGTGTTTGCACATAGATAGTGG + Intergenic
937581328 2:123492414-123492436 GTGTGTGTGTGCATGTATGTGGG + Intergenic
937725933 2:125166620-125166642 GTGTGTCTGTATATATATGGGGG - Intergenic
937962792 2:127474444-127474466 CAGTGTTTGTTCATATATTTAGG - Intronic
938484133 2:131686428-131686450 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
938522776 2:132088788-132088810 ATATGTGTGTATATATATGTAGG + Intergenic
938641253 2:133282802-133282824 CTATGTTTCTACATAATTGTTGG - Intronic
939014718 2:136888973-136888995 GTGTGTGTGTACATGTATTTAGG + Intronic
939370162 2:141288960-141288982 GTGTGTTTGTACATGTACTTTGG + Intronic
939931435 2:148239056-148239078 ATGTGTGTGTATATATGTGTGGG + Intronic
940117505 2:150225257-150225279 CTGTGTTAGGACATACATGTTGG - Intergenic
941216950 2:162723674-162723696 CTTTTTTTGTACATATATGAGGG + Intronic
941338659 2:164277707-164277729 CTGTAATTGTACATATTTATGGG + Intergenic
941620281 2:167770074-167770096 CTGTGTTTGTATGTTTATTTAGG + Intergenic
941729052 2:168895646-168895668 TTGTGCTTGTACGTATCTGTTGG - Intronic
942308716 2:174634148-174634170 CTGTGTTTGCAGACATCTGTGGG - Intronic
942354663 2:175097207-175097229 CTGTGGGTGTCCATATATGTTGG - Intronic
942609355 2:177726854-177726876 ATGTGTACGTACATATCTGTGGG - Intronic
942795809 2:179817789-179817811 CTGTGTGTGTGCATGCATGTTGG + Intronic
943100097 2:183477817-183477839 ATATGTTTGTATGTATATGTTGG + Intergenic
943146028 2:184045904-184045926 CTGTTTGTGGACATATATATTGG + Intergenic
945377975 2:209101609-209101631 ATGTGTGTGTACATATGTGGGGG + Intergenic
945382943 2:209163212-209163234 GTATGTTTGTATATATAAGTGGG + Intergenic
945502754 2:210597819-210597841 GTGTGTGTGTATATATATGAAGG - Intronic
945580072 2:211582058-211582080 CTGTGTTTGCACATATCTTCTGG + Intronic
945633487 2:212316267-212316289 GTGTGTGTGTACATGCATGTGGG - Intronic
945762412 2:213930176-213930198 CTGTGCTGATACATATACGTGGG + Intronic
945908694 2:215622257-215622279 CTGGGTTTCTATATATTTGTGGG - Intergenic
946449457 2:219767351-219767373 CTGTGTGTGTGCATGTGTGTGGG + Intergenic
946505918 2:220300671-220300693 CTGTCTTTTTAAATATATGGAGG + Intergenic
946756166 2:222949964-222949986 CTGTGTCAGTACATATATAATGG + Intergenic
946760069 2:222984575-222984597 GTGTGTGTGTACATATATATAGG - Intergenic
946920144 2:224571834-224571856 TTGTGTTTATACATAAATCTAGG - Intronic
947286232 2:228518137-228518159 CTATAGTTGTACAGATATGTAGG + Intergenic
947699894 2:232224190-232224212 ATGTGGTTGTATATATATGTGGG - Intronic
947746443 2:232510127-232510149 GTGTTTTTCTACATATCTGTAGG + Intergenic
947947355 2:234117188-234117210 GTGTGTGTATATATATATGTAGG + Intergenic
948009632 2:234641036-234641058 CTATATTTGTACACATATCTTGG - Intergenic
948600381 2:239104561-239104583 CTGTGCCTGTACACACATGTGGG - Intronic
1169291540 20:4357442-4357464 CTGTGTTTGTAAAGCTTTGTTGG + Intergenic
1170514068 20:17109591-17109613 GTGTGTTTGGACAGAAATGTGGG + Intergenic
1170576408 20:17665092-17665114 CTGTGTATACATATATATGTGGG + Intronic
1170900579 20:20458689-20458711 GTGTGTGTGTATATATATATAGG - Intronic
1170900581 20:20458735-20458757 GTGTGTATGTATATATATATAGG - Intronic
1171051467 20:21863074-21863096 GTGTATTTGTACATGTGTGTGGG + Intergenic
1171249055 20:23634979-23635001 ATGTGTGTGCACATATGTGTGGG - Intronic
1171335076 20:24377539-24377561 TTGTGTATGTATATATGTGTGGG + Intergenic
1171335129 20:24378420-24378442 ATTTGTGTGTACATATGTGTGGG + Intergenic
1172825675 20:37782367-37782389 GTGTGTGTGCACATATGTGTGGG - Intronic
1173950028 20:46984753-46984775 GTGTGTGTATACATATATATAGG + Intronic
1176773917 21:13112269-13112291 ATATGTGTGTATATATATGTAGG - Intergenic
1177407948 21:20694513-20694535 GTGTGTGTGTATATATATATAGG + Intergenic
1178132673 21:29590956-29590978 CTGTGTTTGTACATACTTACAGG - Intronic
1178165968 21:29977613-29977635 CTCTCTCTTTACATATATGTGGG - Intergenic
1179050247 21:37883004-37883026 GTGTGTTTGTATGCATATGTGGG + Intronic
1179982653 21:44904367-44904389 TTGTGTGTGTGCATATATGTGGG - Intronic
1180485218 22:15788918-15788940 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
1180521537 22:16211992-16212014 ATATGTGTGTACATATATGTAGG - Intergenic
1183366156 22:37408143-37408165 CTGTGTATGTATAAATGTGTGGG - Intronic
1183906268 22:41042940-41042962 ATGTGTGTGTATATATATGTGGG + Intergenic
1184990628 22:48167034-48167056 CTGTGTGTGTGCATGTATGAAGG - Intergenic
1185095823 22:48805553-48805575 CTGTATTTGTACATATTTATGGG - Intronic
1185232917 22:49693653-49693675 CTGTGCGTGTACACATATGTGGG + Intergenic
949646625 3:6102538-6102560 CTGTGGCTGCACATGTATGTAGG - Intergenic
949695334 3:6688217-6688239 CTGTCTATGCACATAGATGTGGG - Intergenic
950255811 3:11504626-11504648 ATGTGTCTGAACATATATTTAGG + Intronic
950992536 3:17455536-17455558 GTGTGTGTGTATATATATATAGG + Intronic
951292871 3:20895014-20895036 CTGTAATTGTACATATTTATAGG - Intergenic
951541640 3:23787716-23787738 GTGTGTGTGTATATATATATGGG - Intergenic
951946654 3:28144980-28145002 GTGTGTGTGTATATATATATAGG + Intergenic
951998098 3:28754222-28754244 CTGTGTTTTCACTTATAAGTGGG + Intergenic
952796136 3:37241155-37241177 CTGTGTTTGTACATATATGTGGG - Intergenic
952802897 3:37313708-37313730 GTATATGTGTACATATATGTGGG - Intronic
954309573 3:49754876-49754898 CTGAGGTTGTAAAAATATGTTGG - Intronic
954426962 3:50448409-50448431 GTGTATCTGTACATGTATGTAGG + Intronic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
955471680 3:59293227-59293249 CAGAGTTTGTAAATAGATGTTGG + Intergenic
955528711 3:59849555-59849577 CTGTGTCTGTTTATATTTGTGGG - Intronic
955651714 3:61202041-61202063 ATGTGCGTGTATATATATGTAGG - Intronic
956402230 3:68892564-68892586 CTTTCTTTGTACATATTTATGGG - Intronic
956585275 3:70857722-70857744 ATGTATATGTATATATATGTGGG - Intergenic
956861811 3:73331634-73331656 GTGTGTGTGTATATATATGATGG - Intergenic
957809280 3:85197259-85197281 CTGTGTTTATAAAATTATGTAGG - Intronic
958127256 3:89372396-89372418 CTGTGTTTTTAAAAATATCTTGG - Intronic
958170665 3:89935618-89935640 CTTTGTGTGTGTATATATGTTGG + Intergenic
958506971 3:94992240-94992262 GTGTGTCTGTATATGTATGTGGG + Intergenic
958520356 3:95178492-95178514 ATGTATTTAGACATATATGTTGG - Intergenic
958619587 3:96540295-96540317 CTGTGTTTCCACAGATATATAGG - Intergenic
959121085 3:102233091-102233113 CCGTGTGTGTACAATTATGTGGG - Intronic
959753723 3:109870689-109870711 CTTTCTTTTTACATATATATTGG - Intergenic
959970621 3:112405518-112405540 GTGTGTTTGTATATATTTGAAGG - Intergenic
960453412 3:117839415-117839437 GTGTGTGTGTATATATATGGGGG - Intergenic
961734104 3:128990035-128990057 CCATTTTTGTGCATATATGTGGG - Intronic
962054836 3:131860138-131860160 CTGTGTCTGTAAAGTTATGTTGG + Intronic
962236049 3:133708379-133708401 CAGTGTATGTAAATATATGTGGG + Intergenic
962536316 3:136332324-136332346 AAGTGTGTGTATATATATGTGGG + Intronic
962669243 3:137688340-137688362 CTGTATTTGCAAATAAATGTAGG + Intergenic
963145919 3:141994163-141994185 TTGTGTTTGTACATGTGTGTAGG + Intronic
963237694 3:142971937-142971959 CTGTGTTTTTACACACATGCTGG + Intronic
963318044 3:143782106-143782128 CTGTGTCTGTGCACATATCTGGG - Intronic
963841025 3:150106523-150106545 GTGTGTGTATACATATGTGTGGG + Intergenic
964005582 3:151823341-151823363 TTGTGTGTGTATATATATGTGGG + Intronic
964578415 3:158201860-158201882 TTGTGTTTCTTCATATATCTAGG + Intronic
964592482 3:158379785-158379807 GTGTGTTTGTATGTATGTGTAGG - Intronic
965446670 3:168781700-168781722 ATGTGTGTGTATATATATATGGG + Intergenic
965778311 3:172256861-172256883 GTGTGTTTGTGTGTATATGTGGG + Intronic
966086324 3:176071253-176071275 GTGTGTGTGTGCATATACGTGGG + Intergenic
966326085 3:178756208-178756230 ATGTGTGTGTATATATATGTGGG + Intronic
966642468 3:182205993-182206015 ATGAGTTTTTTCATATATGTAGG - Intergenic
967789781 3:193534991-193535013 CTGTTTTTCTCCATATAGGTAGG - Intronic
969368815 4:6717567-6717589 GTGTGTGTATATATATATGTGGG + Exonic
969800890 4:9564367-9564389 GTGTGTGTGTGCATGTATGTAGG - Intergenic
970651925 4:18188229-18188251 GTGTGTGTGTCCATGTATGTGGG + Intergenic
970668667 4:18368832-18368854 GTGTGTGTGTATATACATGTAGG - Intergenic
970684917 4:18556062-18556084 TTGTTCTTGTACCTATATGTGGG + Intergenic
970692659 4:18637633-18637655 ATGTGTGTGTACATGTATCTTGG + Intergenic
970899916 4:21146959-21146981 ATGTATATGTATATATATGTGGG + Intronic
971154902 4:24071207-24071229 GTGTGTTTGTGCATGCATGTGGG - Intergenic
971548782 4:27921866-27921888 GTGTGTGTGTATATATATATTGG + Intergenic
972114594 4:35615068-35615090 TTGTGTATACACATATATGTAGG + Intergenic
972807843 4:42548427-42548449 CAGTATTTGTACATATTTATGGG + Intronic
972940522 4:44189638-44189660 GTGTGTGTGTGCATGTATGTTGG - Intronic
974024469 4:56721238-56721260 GTGTGTATGTATGTATATGTTGG + Intergenic
974468436 4:62287906-62287928 ATGTATGTGTATATATATGTGGG - Intergenic
974598253 4:64041200-64041222 GTATTTTTGTACATATTTGTTGG - Intergenic
974702398 4:65468508-65468530 GTGTGTCTGTATATATGTGTAGG - Intronic
976130316 4:81877185-81877207 TTGTGTGTGTATATATGTGTGGG - Intronic
976764664 4:88587083-88587105 CTGGGCTTTTACCTATATGTAGG + Intronic
977142477 4:93390855-93390877 ATGTGTGTGTATATATATGCTGG + Intronic
977802155 4:101247886-101247908 GTGTGTGTGTATATATATATAGG - Intronic
977814029 4:101392580-101392602 ATGTGTGAGTAGATATATGTGGG + Intergenic
978628658 4:110717079-110717101 ATATGTTTGTACAAATATATTGG + Intergenic
978668984 4:111223410-111223432 CTGTGTGTATATATATGTGTTGG + Intergenic
978692551 4:111532643-111532665 CTGTGTTTTTATAGATATTTTGG + Intergenic
978996278 4:115158080-115158102 ATATGTGTATACATATATGTAGG - Intergenic
979122107 4:116916579-116916601 CTGTGTTTGTATATGTGTTTAGG + Intergenic
979459116 4:120960267-120960289 GTGTGTTTGTACACCTTTGTGGG - Intergenic
979854430 4:125613381-125613403 CTGTGTGTGTATGTGTATGTGGG - Intergenic
980190192 4:129515297-129515319 TTGTATTTGTACATATAGGATGG + Intergenic
980751028 4:137088682-137088704 AAGTGTTTGTACATATGTTTGGG - Intergenic
980847955 4:138346612-138346634 CTGTATTTGGAAATATATTTTGG - Intergenic
981120467 4:141045049-141045071 CAGTTTTTTTACATATATGATGG - Intronic
981160561 4:141493682-141493704 GTGTGTGTGTATATATATATAGG + Intergenic
981342988 4:143643925-143643947 CTGTACTTGTACATATTTATAGG - Intronic
982672753 4:158341581-158341603 CTGTGTGTGTATACATATGTGGG - Intronic
982914095 4:161183333-161183355 CTATGTTTGTATATATTTATGGG + Intergenic
983068408 4:163238947-163238969 CTGTAATTGTACATATTTATAGG - Intergenic
983837818 4:172414353-172414375 CTGTGTATACACATATAAGTTGG - Intronic
983983801 4:174032902-174032924 ATGTGTTTGTATATCTTTGTAGG - Intergenic
984106548 4:175555217-175555239 TTGTATTTGTACATCTGTGTAGG + Intergenic
984577995 4:181473794-181473816 ATGTGTGTATACATATATGTGGG - Intergenic
984806357 4:183755254-183755276 CTGTGTGTACACATATGTGTTGG + Intergenic
985080821 4:186262177-186262199 TTCTATTTGTACATATTTGTGGG + Intergenic
985874158 5:2582710-2582732 TTGTGTGTGTACATGTGTGTGGG - Intergenic
987006281 5:13713270-13713292 ATATGTTGGTATATATATGTCGG - Intronic
987617446 5:20294822-20294844 ATGTGTGTATATATATATGTAGG - Intronic
987793810 5:22603456-22603478 ACGTGTGTGTACATATATGTAGG - Intronic
988386286 5:30569583-30569605 CTGTGTTTCTAGTTATGTGTTGG - Intergenic
989723079 5:44552882-44552904 GTGTGTATATATATATATGTAGG - Intergenic
990673254 5:58156273-58156295 CAGTGTTTGTACATATATACAGG + Intergenic
990813964 5:59762108-59762130 ATATGTGTGTATATATATGTAGG + Intronic
991023976 5:62009831-62009853 CTGTGTATCTACTTTTATGTTGG - Intergenic
991267125 5:64733363-64733385 GTGTGTGTGTATATATATGTGGG - Intronic
991353836 5:65747630-65747652 CAGAGTTTGGACATATAGGTGGG - Intronic
992166167 5:74054120-74054142 CTGTGTTTGCACATCTGTGGTGG + Intergenic
993271181 5:85798215-85798237 GTGTGTGTGTATATATATATAGG - Intergenic
993741110 5:91540862-91540884 GTGTGTGTGTACATATATATAGG - Intergenic
993942048 5:94070599-94070621 ATGTGTTTGTACATACTTATGGG - Intronic
994213367 5:97109816-97109838 TTGTGTTTTCACATATAAGTGGG - Intronic
994448870 5:99914432-99914454 ATCTGTTTATTCATATATGTTGG - Intergenic
994548052 5:101193968-101193990 GTGTGTGTGTATATGTATGTAGG - Intergenic
995584282 5:113630956-113630978 CTCTTTTTGTTCATATCTGTAGG - Intergenic
995657125 5:114439182-114439204 ATGTTTTCATACATATATGTAGG - Intronic
996191702 5:120551669-120551691 CTGTGCATGTATATAAATGTAGG + Intronic
996616450 5:125447188-125447210 ATGTGTTTGTGCATTTCTGTTGG - Intergenic
996959168 5:129223540-129223562 GTGTGTGTGTATATATATATAGG + Intergenic
997184211 5:131865702-131865724 GTGTGTATGTGCATATGTGTTGG + Intronic
997487230 5:134241652-134241674 GTGTGTGTGTATATATATGTGGG + Intergenic
998542769 5:142998497-142998519 CTGTGTTTGTAAATGTATGTTGG + Intronic
998811270 5:145968480-145968502 ATGTGTTTGTGCATGTATGTGGG + Intronic
999546809 5:152638204-152638226 CCATGCATGTACATATATGTGGG - Intergenic
999966356 5:156813977-156813999 CTGTGTTTTCACATGTATTTAGG - Intergenic
1000509012 5:162158906-162158928 CCGTGTGTTTAAATATATGTGGG - Intergenic
1000584471 5:163079765-163079787 ATGTGTGTGTACATATATGTGGG + Intergenic
1001159763 5:169302217-169302239 GTGTGTGTGTATATATATGCAGG - Intergenic
1001550156 5:172596679-172596701 GTGTGTGTGTGCATACATGTGGG - Intergenic
1002394917 5:178945228-178945250 CTGTGTGTGTATTTGTATGTTGG + Intronic
1002669325 5:180853170-180853192 CTGTGCTTGGAGATTTATGTAGG - Intronic
1002765903 6:238621-238643 CTATATTAGTACATATTTGTGGG + Intergenic
1002848946 6:974294-974316 GTGTGTGTGTATATATATATGGG + Intergenic
1003721351 6:8706226-8706248 GTGTGTGTGTAAGTATATGTAGG - Intergenic
1004123705 6:12851594-12851616 CTGTGTAATTACATATATGCCGG - Intronic
1004895506 6:20143961-20143983 CTGTCTTTGTACAGTTATATTGG - Intronic
1005520183 6:26594294-26594316 TTGTGTGTGTACATATGTTTAGG - Intergenic
1005725667 6:28645307-28645329 CTGTGTGTATACATGTATATAGG + Intergenic
1008394290 6:50989129-50989151 TAGTGGTTGTACATATATATGGG - Intergenic
1009456910 6:63868029-63868051 ATGTGTTTTCAGATATATGTTGG - Intronic
1010045814 6:71442128-71442150 CTGTGGTTATAAATATATGATGG + Intergenic
1010421150 6:75677549-75677571 CAGTGTGTGCATATATATGTTGG - Intronic
1011610257 6:89143935-89143957 CTGTGTTAATAAATATTTGTTGG - Intergenic
1011784620 6:90830123-90830145 ATGTGTGTGTATATATATATGGG - Intergenic
1011968639 6:93193003-93193025 GTGTGTTTGCGCATATATGCAGG - Intergenic
1012517651 6:100081375-100081397 TTGTATTTGTGCATGTATGTGGG + Intergenic
1012519807 6:100107698-100107720 CTGGGTGTGTACGCATATGTAGG + Intergenic
1012587206 6:100938316-100938338 TTATGTTTGTACTTATATTTTGG + Intergenic
1013707401 6:112853924-112853946 TTTTGTTTGTACATATATGGAGG + Intergenic
1013895299 6:115080945-115080967 GTGTGTGTGTATATGTATGTAGG - Intergenic
1014403616 6:121021740-121021762 ATGTGTTTGACCATATATCTTGG - Intergenic
1015078502 6:129193429-129193451 GTATGTTTTTACATATGTGTGGG - Intronic
1015137467 6:129890031-129890053 GTGTGTATATACATATATGATGG + Intergenic
1016315164 6:142777206-142777228 CGGTTCTTGTACATATATATTGG - Intronic
1018413452 6:163579755-163579777 CTGCGTATGTACTTAAATGTGGG - Intergenic
1018440802 6:163811090-163811112 GTGTGTGTGTATAGATATGTGGG - Intergenic
1018541562 6:164885488-164885510 CTGTGTTTGTATGTATGTGTAGG - Intergenic
1018698518 6:166409145-166409167 GTGTGTATGTACATATGTGTAGG - Intergenic
1018765586 6:166930454-166930476 GTGTGTGTGTACATGCATGTGGG - Intronic
1018765597 6:166930793-166930815 ATGTGTGTGTACATGCATGTGGG - Intronic
1018765599 6:166930832-166930854 ATGTGTGTGTACATGCATGTGGG - Intronic
1018929367 6:168230345-168230367 GTGTGTACATACATATATGTAGG + Intergenic
1020374913 7:7474009-7474031 GTGTGTTTTTATATATATGATGG + Intronic
1020920680 7:14260075-14260097 GTGTGTGTGTACACATATGTAGG - Intronic
1022417957 7:30194469-30194491 ATGTGTTTGTACAGGTGTGTAGG + Intergenic
1023019044 7:35993882-35993904 ATATGTTTGTACAGACATGTAGG + Intergenic
1023355645 7:39364624-39364646 CTGTGGTTATATATATATGATGG - Intronic
1023362110 7:39427652-39427674 CTGAGATTGTACAAATATTTGGG + Intronic
1023748449 7:43345787-43345809 GTGTGTGTGTATATATATGATGG - Intronic
1024193662 7:47037701-47037723 GTGTGTGTGTGCATATGTGTGGG + Intergenic
1024519559 7:50292983-50293005 TTGTGTTTGTGCATATCTGAGGG + Intergenic
1024872298 7:53978879-53978901 GTGTGTGTGTATATATATATAGG - Intergenic
1026029311 7:66776095-66776117 CTGTCTTTGAAAATTTATGTTGG + Intronic
1026220806 7:68395987-68396009 ATGTGTGTGTATATATATGATGG + Intergenic
1026257211 7:68722680-68722702 CTATGTTTATGTATATATGTTGG + Intergenic
1026260459 7:68750695-68750717 GTGTGTGTGTGCATATGTGTGGG + Intergenic
1026413077 7:70146949-70146971 ATGCATGTGTACATATATGTAGG + Intronic
1027519753 7:79190974-79190996 CTATATTTCCACATATATGTGGG + Intronic
1027521395 7:79213228-79213250 GTGTGTGTGTGTATATATGTGGG + Intronic
1027862603 7:83604576-83604598 GTGTGTATATATATATATGTTGG - Intronic
1028031554 7:85920938-85920960 CTGTATTTGCACATATTTATGGG - Intergenic
1028812931 7:95109132-95109154 ATGTGTGTGTATATATATTTTGG + Intronic
1029842534 7:103381565-103381587 GTGTGTGTGTATATGTATGTAGG - Intronic
1029852135 7:103473608-103473630 GTGTGTATGTACATATGTGGGGG - Intronic
1030167173 7:106566930-106566952 CTGTGTGTGTACATCTGTATGGG - Intergenic
1030353724 7:108520344-108520366 CTCTGTTTTCACTTATATGTAGG + Intronic
1030479245 7:110081639-110081661 ATATGTGTGTACATATATATAGG - Intergenic
1031609096 7:123804147-123804169 CTGTGTTTATTCACATAGGTTGG - Intergenic
1032146391 7:129385856-129385878 GTGTGTTTGTACATACGTGTTGG + Intronic
1033458711 7:141525945-141525967 GTGTGTGTGTATATATGTGTGGG - Intergenic
1033800238 7:144892548-144892570 GTGTATGTGTACACATATGTGGG - Intergenic
1033828955 7:145228822-145228844 ATGTGTGTATACATGTATGTGGG - Intergenic
1035330286 7:158092276-158092298 GTGTGTGTGTATATATATGTAGG + Intronic
1035671294 8:1419278-1419300 CAGTAATTGTACATATTTGTGGG + Intergenic
1035671300 8:1419397-1419419 CAGTAATTGTACATATTTGTGGG + Intergenic
1035704259 8:1663073-1663095 GTGCGTTTGTACATGTGTGTGGG + Intronic
1035959202 8:4118166-4118188 GTGTGTTGGTACATTTATGCTGG + Intronic
1036040766 8:5078140-5078162 GTGTGTGTGTATATATATATAGG - Intergenic
1036126360 8:6066595-6066617 GTGTGTGTGTACACATGTGTGGG + Intergenic
1037180479 8:15999339-15999361 CTGTATTGTAACATATATGTTGG + Intergenic
1037315068 8:17592905-17592927 GTGTGTGTGTGCATGTATGTGGG - Intronic
1037357490 8:18037543-18037565 CTGTGTGTATATATATATTTTGG + Intergenic
1037436762 8:18871151-18871173 CTGTGTTCATACATGTATGTCGG + Intronic
1037827770 8:22169479-22169501 GTGTGTTTGTGCATATGCGTGGG + Intronic
1039784451 8:40820789-40820811 CTGTGTGTGTATATATGTGTGGG + Intronic
1040638061 8:49299056-49299078 GTGTGTGTGTATATATATGGTGG + Intergenic
1040741967 8:50587206-50587228 ATATGTATATACATATATGTAGG + Intronic
1040827930 8:51644430-51644452 ATGTGTGTGTATATATATATGGG + Intronic
1041853695 8:62423469-62423491 GTGTGTGTGTATGTATATGTTGG - Intronic
1042285654 8:67107598-67107620 CTATGTTTGTACATACCTATAGG + Intronic
1043500777 8:80852931-80852953 CTGTATTTTTACATCTATTTTGG + Intronic
1043541402 8:81267267-81267289 GTGTGTGTGTATATATATATAGG + Intergenic
1043669626 8:82865821-82865843 ATGTGTTTGCAAATATATCTTGG + Intergenic
1043803273 8:84638937-84638959 GTGTGTGTGTACATATATATGGG - Intronic
1044476494 8:92632742-92632764 GTGTGTGTGTACATATCTTTAGG + Intergenic
1045095463 8:98792959-98792981 GTGTGTATGTATATATATGATGG + Intronic
1045768669 8:105707821-105707843 CTATTTTTGGTCATATATGTTGG - Intronic
1045779098 8:105843024-105843046 GTGTGTATGTACACATATGGAGG + Intergenic
1045955822 8:107905395-107905417 GTGTGTTTATATATGTATGTAGG - Intronic
1048157356 8:131970963-131970985 TTGTGTGTGTATGTATATGTGGG + Intronic
1048245973 8:132799920-132799942 CTTTATTTATACATACATGTGGG - Intronic
1048885773 8:138908211-138908233 CCATGTTTGTAAATATGTGTTGG + Intronic
1049298056 8:141854395-141854417 CTCTGTGTGTGCATATGTGTGGG - Intergenic
1049525359 8:143122845-143122867 AGGTGTGTATACATATATGTGGG - Intergenic
1050349694 9:4728974-4728996 GTGTGTGTGTATATATATGTAGG - Intronic
1050612972 9:7372260-7372282 ATGTGTGTGCACACATATGTGGG - Intergenic
1050912943 9:11097685-11097707 CTTCGTTTGTTCATATATATAGG - Intergenic
1051425170 9:16925007-16925029 GTGTGTATATATATATATGTGGG + Intergenic
1051720434 9:20031329-20031351 AAGTGTGTGTACATATATATGGG - Intergenic
1052141484 9:24990921-24990943 GTATGTGTGTATATATATGTGGG - Intergenic
1052184096 9:25568899-25568921 TAGTATTTGTACATATTTGTGGG + Intergenic
1053701461 9:40695916-40695938 ATATGTGTGTATATATATGTAGG + Intergenic
1053874236 9:42526346-42526368 GTGTGTGTGTACATGTGTGTGGG + Intergenic
1054268097 9:62940408-62940430 GTGTGTGTGTACATGTGTGTGGG - Intergenic
1054411525 9:64819371-64819393 ATATGTGTGTATATATATGTAGG + Intergenic
1054849773 9:69835842-69835864 CTGTGGTTGTATGTTTATGTGGG - Intronic
1055024528 9:71705809-71705831 GTGTGTGTGTATATATATATAGG + Intronic
1055254172 9:74346432-74346454 ATGTGTGTGTATATATATGATGG - Intergenic
1055254173 9:74346462-74346484 ATGTGTGTGTATATATATGATGG - Intergenic
1055254174 9:74346494-74346516 ATGTGTGTGTATATATATGATGG - Intergenic
1055254175 9:74346526-74346548 ATGTGTGTGTATATATATGATGG - Intergenic
1055426768 9:76204612-76204634 TTGTGTTTGTTCTTATTTGTTGG + Intronic
1055879897 9:80988231-80988253 GTGTGTGTGTACATACATGCAGG - Intergenic
1057586122 9:96330304-96330326 CTGTGTGTGTGTATATGTGTGGG - Intronic
1057932101 9:99203083-99203105 ATGTGTGTGTACATATATACAGG + Intergenic
1058271558 9:102977858-102977880 CTATGTTTTTACATAGATGAGGG - Intergenic
1058818472 9:108707145-108707167 CTGTGTTTGCTCATTTTTGTCGG - Intergenic
1059415918 9:114162487-114162509 CTGTGTTTGTCTATATAAGCAGG + Intronic
1059726070 9:117009285-117009307 GTATGTTTCCACATATATGTGGG - Intronic
1185764376 X:2713372-2713394 TTGTGTATGTGCATATGTGTAGG - Intronic
1185907076 X:3944904-3944926 CTGTCTTTGTACATACACATAGG + Intergenic
1186847748 X:13547661-13547683 TTGTGCATATACATATATGTGGG - Intergenic
1187840672 X:23484064-23484086 GTGTGTTTGTATATATATGGGGG - Intergenic
1188795625 X:34460831-34460853 ATGTGTTTCTATATATATTTAGG - Intergenic
1190038602 X:47050272-47050294 TTGTAGTTGTACATATTTGTGGG + Intronic
1190709687 X:53058022-53058044 CTATGTTTGTACATGAAAGTGGG + Intronic
1191658461 X:63627058-63627080 ATATGTATGTACATATATATAGG + Intergenic
1193467126 X:81863911-81863933 GTGTGTGTGTATATATATATGGG + Intergenic
1193762281 X:85481966-85481988 TTGTGTGTGTACATCTCTGTAGG - Intergenic
1193872021 X:86810311-86810333 CTGAGGTTATACATATGTGTAGG + Intronic
1195494240 X:105511418-105511440 CTCTTTTTGTATATATATATAGG - Intronic
1195712229 X:107782386-107782408 CTATGTGTGTATATATGTGTGGG - Intronic
1196409746 X:115403796-115403818 ATGTATATATACATATATGTAGG - Intergenic
1196409747 X:115403822-115403844 ATGTATATATACATATATGTAGG - Intergenic
1196409748 X:115403848-115403870 ATGTATATATACATATATGTAGG - Intergenic
1196752975 X:119133866-119133888 TTATGTTTGTACATATTTATGGG + Intronic
1196981764 X:121222052-121222074 CTGTATTTTTAGATATCTGTGGG - Intergenic
1197487973 X:127077477-127077499 CATTGCTTCTACATATATGTGGG - Intergenic
1197621621 X:128756800-128756822 GTGTGTGTGTATATATATATAGG + Intergenic
1197957820 X:131971847-131971869 ATGTGTGTGTATATATATGAGGG - Intergenic
1198570120 X:137945846-137945868 CGGTGGTTGTAAATATAGGTAGG - Intergenic
1198973571 X:142309088-142309110 CTGTGTTTGTACAAATACCATGG - Intergenic
1199085594 X:143626503-143626525 GTGTGTATATATATATATGTGGG - Exonic
1199204260 X:145129833-145129855 GTGTGTGTGTATATATATGGTGG + Intergenic
1199235232 X:145485167-145485189 ATGTATATGTACATATATATAGG + Intergenic
1199363408 X:146948550-146948572 GTGTGTGTATATATATATGTTGG + Intergenic
1199682611 X:150237556-150237578 ATGTGTATGTACGTATATTTGGG - Intergenic
1200040326 X:153360917-153360939 TTGTGTGTGTACATATATGCAGG - Intergenic
1200345965 X:155449040-155449062 TTGTATTTGTACATATTTATGGG - Intergenic
1200371727 X:155733268-155733290 GTGTGTGTGTATATATATATAGG - Intergenic
1200510301 Y:4069377-4069399 ATGTGTTTGAACTTATTTGTGGG + Intergenic
1201909805 Y:19122349-19122371 ATGAGTGTGTACATATCTGTTGG - Intergenic