ID: 952796956

View in Genome Browser
Species Human (GRCh38)
Location 3:37247905-37247927
Sequence ATATGGGTCTAGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952796956_952796964 14 Left 952796956 3:37247905-37247927 CCCTCTGCCCTCTAGACCCATAT 0: 1
1: 0
2: 0
3: 15
4: 206
Right 952796964 3:37247942-37247964 TAATTAGTTTAGACCCATCCAGG 0: 1
1: 0
2: 0
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952796956 Original CRISPR ATATGGGTCTAGAGGGCAGA GGG (reversed) Intronic
901270064 1:7945395-7945417 GTGTGGGTCCAGAGAGCAGATGG - Intergenic
902512849 1:16975581-16975603 ATGGGGGGCTAGAGGGCACAGGG - Intronic
903474115 1:23607629-23607651 AGATGGGGAAAGAGGGCAGAAGG - Intronic
903624456 1:24720926-24720948 AAATGGGGCAGGAGGGCAGAAGG + Intergenic
903664958 1:25000671-25000693 CTTTGGCTCTCGAGGGCAGAGGG + Intergenic
904497546 1:30895701-30895723 ACAGGGGTCTTGAGGGCTGAGGG - Intronic
904788209 1:32998359-32998381 AGATGGGGCTACAGGGCAGGTGG - Intergenic
904877090 1:33663507-33663529 AATTGGGGCTAGAGGGCAGGGGG + Intronic
906108292 1:43307504-43307526 ATAGGGGTCTGGGAGGCAGAAGG - Exonic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908420711 1:63955956-63955978 ATATGGGAAGAGAAGGCAGAAGG + Intronic
912736185 1:112151500-112151522 GTATGGGTCTTGAGTTCAGAAGG + Intergenic
915236926 1:154490635-154490657 AGATGGGTCTAAAGGCCAGAAGG + Intronic
917605839 1:176628287-176628309 AAATGGGTCTACAGGACACAAGG - Intronic
919373218 1:196758347-196758369 GTATAGGGCTAGAGGGGAGATGG - Intergenic
919379662 1:196843031-196843053 GTATAGGGCTAGAGGGGAGATGG - Intronic
920558747 1:206923399-206923421 AAATGGGCCAAGATGGCAGAGGG + Intergenic
921186155 1:212671296-212671318 AAATGGGTGTAGAGGGCACAAGG - Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
924301317 1:242641106-242641128 ATATGCCACTGGAGGGCAGAAGG - Intergenic
1063633595 10:7758473-7758495 AACTGGGTCTACAGTGCAGAAGG + Intronic
1066438510 10:35415512-35415534 AGCTGGGTCCTGAGGGCAGAAGG + Intronic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067086457 10:43243013-43243035 AGATGGGTCGGGCGGGCAGAGGG - Intronic
1068043400 10:51856095-51856117 TTATGGGTCAATGGGGCAGAAGG - Intronic
1070820047 10:79349132-79349154 AGATGGGTCTAGAGGGAAGGGGG + Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1075906833 10:126088916-126088938 ATCTGGGTGTAGATTGCAGAAGG + Intronic
1076559919 10:131355442-131355464 ATGTGGGTCCAAATGGCAGAAGG - Intergenic
1077397700 11:2332932-2332954 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
1077465951 11:2733736-2733758 AGAGGGGTCTAGCGGGCAGGAGG + Intronic
1078308335 11:10213638-10213660 CTATTGGTCTAGAGGCCAAAAGG + Intronic
1078378016 11:10812616-10812638 AAATGGCTATAGAGGCCAGATGG - Intronic
1078652983 11:13213174-13213196 CTATGGCTGTAGAGGGCAGAGGG + Intergenic
1078865122 11:15289915-15289937 ATATGGGTGTAGAGAGTAGACGG + Intergenic
1079166719 11:18050800-18050822 ATAAAGGTCTAGAGTTCAGAAGG - Intergenic
1081659584 11:44879804-44879826 ATAAGTGTCTGGAGGCCAGATGG + Intronic
1081829186 11:46092205-46092227 ATAGGGGGCTAGAGAGCTGAAGG - Exonic
1082102407 11:48183560-48183582 GTGTGGGCCCAGAGGGCAGAGGG + Intergenic
1083068472 11:59950306-59950328 ATAGAGGTCTAGAGTTCAGAGGG + Intergenic
1083285116 11:61653680-61653702 ATAGGGGTCTTCAGGGGAGAAGG - Intergenic
1083628725 11:64085150-64085172 GGATGGGGCTTGAGGGCAGAGGG + Intronic
1085175319 11:74481657-74481679 ATCTGGGTTTACAGGGGAGAGGG + Intergenic
1085339915 11:75724347-75724369 ATTTGGGTCCAGGGGACAGATGG + Intronic
1085904947 11:80749149-80749171 ATGTGGGTTTACAGGGAAGATGG + Intergenic
1089709014 11:120301785-120301807 ATACGGCTCTAAAGGGCAGTGGG - Intronic
1095705158 12:45228977-45228999 ACTTGGGTCTGGAGGGGAGAAGG + Intronic
1096472646 12:51888990-51889012 ATATGGGTTTAGAGGGTGCAAGG + Intronic
1098323024 12:69268581-69268603 TTAAGAGTCAAGAGGGCAGAAGG - Intronic
1099201077 12:79677975-79677997 GTTTGGGGGTAGAGGGCAGATGG - Intronic
1099289309 12:80755672-80755694 TTATGAGTCTAGAGTTCAGAGGG - Intergenic
1101401984 12:104396414-104396436 ATTTGGGTGCAGAAGGCAGATGG - Intergenic
1106670795 13:31903046-31903068 ATGTGGCTCTAGAGGGAGGAAGG + Intergenic
1106870762 13:34017228-34017250 ATATGGTTCCAGAGGGAAAACGG - Intergenic
1108837585 13:54571194-54571216 ATTTGGGTCTTGAGCTCAGAGGG + Intergenic
1116041073 14:39686973-39686995 ACTTGGGGCTAAAGGGCAGACGG - Intergenic
1116829142 14:49700634-49700656 ATATGGATTTAAAGGGAAGAAGG + Intronic
1118911614 14:70066491-70066513 ATCTGGGTCTTAAAGGCAGAAGG - Intronic
1119386380 14:74260237-74260259 ATATAGGCCCAGAGGGCAGGTGG - Intronic
1119472235 14:74907307-74907329 ATGTGGGTGCAGAGGGCAGTAGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1202889638 14_KI270722v1_random:143911-143933 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1124078965 15:26473866-26473888 ATATGAGTGAAGAGGGCACAAGG + Intergenic
1124530434 15:30500750-30500772 ATTTGTGTCTGGAGGGCAGGGGG - Intergenic
1124768225 15:32506938-32506960 ATTTGTGTCTGGAGGGCAGGGGG + Intergenic
1125993164 15:44130132-44130154 TGATGGGTTTAGAGGGGAGAGGG - Intronic
1128045556 15:64614709-64614731 ATATAGGTATACAGGGCAGAGGG - Intronic
1130891940 15:88140842-88140864 ATATGGGCCTAGAGTGGAGTGGG + Intronic
1131809925 15:96162473-96162495 ATATTTCTCTGGAGGGCAGAGGG - Intergenic
1139421058 16:66849793-66849815 ACAGGGGTCTAGGGGGCAGTGGG + Intronic
1140063946 16:71594121-71594143 CTTTAGGTCTAGAGGGCAGGAGG - Intergenic
1142109936 16:88325843-88325865 AGATGGGGCTGCAGGGCAGAAGG + Intergenic
1144610934 17:16714600-16714622 ACATGCATCTAGAGAGCAGATGG - Intronic
1144901805 17:18600767-18600789 ACATGCGTCTAGAGAGCAGATGG + Intergenic
1144929262 17:18845178-18845200 ACATGCATCTAGAGAGCAGATGG - Intronic
1145130698 17:20345303-20345325 ACATGCATCTAGAGAGCAGATGG - Intergenic
1145852382 17:28113270-28113292 GTATGGATCCAGAGGGCACAGGG - Intronic
1146635613 17:34502103-34502125 GAATGGATCTGGAGGGCAGATGG + Intergenic
1146722930 17:35136073-35136095 AGCTGGGTCTAGAAGGGAGAAGG + Intronic
1151700580 17:75740613-75740635 ATCTGTTTCCAGAGGGCAGAAGG + Intronic
1153543750 18:6185321-6185343 GTATGGATCTGGAGGGGAGAAGG - Intronic
1157241435 18:46013700-46013722 ATATGAGTCTGGAGGGGAAATGG - Intronic
1157577677 18:48754577-48754599 ATATGGAGCTAAATGGCAGATGG - Intronic
1158024264 18:52877346-52877368 CTATTGGTCTAGAGGGAGGAGGG + Intronic
1158423594 18:57319071-57319093 ATGTAGGTCTGGAGGCCAGAAGG - Intergenic
1158587798 18:58756384-58756406 AGACGAGACTAGAGGGCAGAGGG + Intergenic
1160075228 18:75668043-75668065 ATGTGGGTTTACTGGGCAGATGG + Intergenic
1161866573 19:6836909-6836931 TTATGGGTTTAGATGGCAGGTGG + Intronic
1163207659 19:15815430-15815452 ATGTGAGTCTACAGGGCAGTGGG - Intergenic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1168035320 19:53714656-53714678 ATATGGGACTAGTGTGCATATGG + Intergenic
1202665039 1_KI270708v1_random:110678-110700 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
925291524 2:2751461-2751483 AGAGGGGTCTGGAGGGAAGAGGG - Intergenic
926531310 2:14049672-14049694 ACATGGGCCTTGAGGGCAGAGGG - Intergenic
928242500 2:29598554-29598576 CCATGGGTCTAGAGAGCAAAGGG + Intronic
929763612 2:44826212-44826234 AGATTTGTCTGGAGGGCAGAAGG - Intergenic
934139464 2:89031663-89031685 ATATAGGTCAGGTGGGCAGAGGG + Intergenic
937247502 2:120503124-120503146 ATGTGGGGCTAGATGGCACATGG - Intergenic
937437751 2:121893241-121893263 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
939129513 2:138217529-138217551 ATATGTGTGTGGAGGGCAGTGGG - Intergenic
941598118 2:167503885-167503907 ATATGGGTCTAGTGTGTAAATGG - Intergenic
943322520 2:186463103-186463125 ATAAGGGTGTGGAGGGCAGGGGG - Intergenic
945804529 2:214474296-214474318 ATATGGCTTTAGAGGACTGAGGG + Intronic
946127092 2:217572461-217572483 CTAAGGGTCTGGAGGGCACAGGG + Intronic
946200212 2:218067260-218067282 ATATGGATTGGGAGGGCAGAAGG - Intronic
946305367 2:218854000-218854022 AAATGGGTCTGGAGCTCAGAGGG - Intergenic
948130970 2:235600399-235600421 ATGGGGGTCTATAGGGCAGAGGG - Intronic
948353094 2:237356981-237357003 ATAAGGGGCAAGAGGGCTGAGGG - Intronic
948969958 2:241417839-241417861 TTGTGTGTTTAGAGGGCAGATGG - Intronic
1169311006 20:4539963-4539985 AAATGGGACTTGAAGGCAGATGG - Intergenic
1169927677 20:10799947-10799969 ATCTTGGTCTAGAAGGCAGGAGG - Intergenic
1170759352 20:19236151-19236173 ATATGGGTCTAAATAGCATATGG + Intronic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1174194336 20:48762407-48762429 ATTTGTATCTAGAGGGTAGAGGG - Intronic
1175252281 20:57616790-57616812 AGAGGGGAGTAGAGGGCAGAAGG + Intronic
1178150298 21:29786463-29786485 ATAGGGGTGTAGAGGGTCGAAGG - Intronic
1178169917 21:30028896-30028918 ATATGTGTTTAGAGTGGAGAGGG + Intergenic
1179060175 21:37972379-37972401 ATATGGGTCAAGACCACAGATGG + Intronic
1180331765 22:11487598-11487620 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1180590348 22:16931973-16931995 TTATGGTTCCAGAGGGTAGAAGG + Intergenic
1184180168 22:42816385-42816407 ATATGGGCCCAGGGGCCAGATGG - Intronic
1184394058 22:44222236-44222258 ACATGGGCCCAAAGGGCAGAGGG + Intergenic
1185305413 22:50112686-50112708 ATCTGTTTCTAGAGTGCAGAGGG - Intronic
1185309881 22:50148354-50148376 ATCTGTTTCTAGAGTGCAGAGGG - Intronic
951026620 3:17837873-17837895 ATGTGGGTAAAGAGGGCTGAAGG + Intronic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
951954902 3:28242970-28242992 ATTTGGTTCTTGAGGGTAGAAGG + Intronic
952413706 3:33071824-33071846 ATGAGGGTCTAGAAGGGAGAAGG - Intronic
952796956 3:37247905-37247927 ATATGGGTCTAGAGGGCAGAGGG - Intronic
952866054 3:37855828-37855850 TTATGGGTGTTGAAGGCAGAAGG + Intergenic
953449801 3:42996703-42996725 CTCTGGGCCTAGAGGGGAGATGG - Intronic
953624534 3:44559897-44559919 ACAAGGGTCTAGAGAGCAGCTGG + Intronic
953830110 3:46289709-46289731 AGATGGGTGTGGAGAGCAGAGGG + Intergenic
955043226 3:55336449-55336471 ATAAGGGTTTGGAGGGCTGATGG + Intergenic
957331735 3:78773740-78773762 ATATGAGACTAGAGGGAGGAAGG - Intronic
960454982 3:117860066-117860088 ATATGGGTCTGGAGCACAGCGGG - Intergenic
961871027 3:129988410-129988432 GAATGGGTCTGGAGGGCAAATGG - Intergenic
961871278 3:129990085-129990107 AAATGGGTCTGGAGGGCAAATGG + Intergenic
963372515 3:144419334-144419356 TTATAGTTCTAGAGGTCAGAAGG + Intergenic
963844217 3:150139179-150139201 ATATGGATCTGGAGCTCAGAAGG + Intergenic
967578988 3:191129677-191129699 AAAAGGGTCTAAAGTGCAGATGG - Intergenic
968238823 3:197056243-197056265 TTATGGAGCTAGAGGGAAGATGG - Intronic
968939523 4:3630795-3630817 ATAGGGTTCTGGAGGGCAGCAGG + Intergenic
971079817 4:23196544-23196566 ATATGGGTTTAGCAGGCATAGGG - Intergenic
974403413 4:61433723-61433745 ATATGAGTCTGGAGCTCAGAAGG - Intronic
974629086 4:64459577-64459599 AATTGTGTGTAGAGGGCAGAAGG + Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976770411 4:88646213-88646235 ATATGAGTCTAGGGGGTAGATGG - Intronic
977557134 4:98497750-98497772 AGCTGAGTCTAGAGGGGAGACGG + Intronic
978007403 4:103634069-103634091 AAATAGGACTAGAAGGCAGATGG + Intronic
980088538 4:128416982-128417004 ACAAGGGGCTAGTGGGCAGAGGG + Intergenic
982930071 4:161393585-161393607 ATATTGGTCTAGATGCCAGAAGG + Intronic
983354863 4:166644073-166644095 AGATTGGTCTAGAGGGGAAAGGG - Intergenic
983983909 4:174034935-174034957 ATATTGATTTAAAGGGCAGAAGG - Intergenic
985699337 5:1361110-1361132 CTAGGGGTTTTGAGGGCAGAGGG + Intergenic
985880222 5:2633653-2633675 ATCTGTGTTCAGAGGGCAGAGGG + Intergenic
986565673 5:9111299-9111321 AAATGGGTATGGAAGGCAGAGGG + Intronic
987486258 5:18531329-18531351 ATTTGTGTCTAGTGGGCAGGGGG - Intergenic
988599651 5:32627764-32627786 ACATGAGTCTAAAAGGCAGATGG + Intergenic
989359497 5:40584570-40584592 ATATGTGTCTACAGGGGAGCAGG - Intergenic
989986996 5:50712760-50712782 ATATGGATCTGGTGGTCAGAAGG + Intronic
990149261 5:52798726-52798748 ATTTGTGTCAGGAGGGCAGAGGG + Intronic
990203043 5:53399173-53399195 GTATTGGTCTAGTGGTCAGAAGG + Intergenic
990266724 5:54084630-54084652 ATCTGGCTCTGGAGGGGAGATGG - Intronic
990442644 5:55861932-55861954 ATATGAGTATAGAGGGAAGGAGG + Intronic
990449466 5:55921088-55921110 GTGTGGATCTAGAAGGCAGAGGG - Intronic
992058851 5:73021358-73021380 ATAGGGGTCAAGAAGGGAGAGGG + Intronic
992282855 5:75200095-75200117 ATAGGGGTCAAAAGGACAGAGGG + Intronic
995535508 5:113131732-113131754 ACATGGGTTTGGAAGGCAGAGGG - Intronic
995636829 5:114202264-114202286 ATAAGGATCTAGTGGGCTGAGGG + Intergenic
996110658 5:119562677-119562699 ATCTGAGTCAAGAGGGCAGGCGG + Intronic
1001326037 5:170725476-170725498 ATATGAAGATAGAGGGCAGAAGG + Intronic
1001340647 5:170841354-170841376 ATATGGGTGTAAAGGACTGATGG + Intergenic
1002521222 5:179794191-179794213 ACCTGGGCCTAGGGGGCAGAGGG - Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1009926615 6:70128245-70128267 ATATGGGTCTAAAACTCAGAAGG + Intronic
1010042081 6:71396788-71396810 ATACGGGTGGAGAGTGCAGAAGG - Intergenic
1012487175 6:99735315-99735337 ATCTGGGTCTAGAGGATAAAGGG + Intergenic
1012668120 6:102004668-102004690 ATGTTGCACTAGAGGGCAGACGG - Intronic
1012779288 6:103536199-103536221 AAATGGATCTAGGAGGCAGAAGG - Intergenic
1014080114 6:117276095-117276117 ATTTGGGTCTGGATGGGAGATGG + Intergenic
1015206877 6:130650334-130650356 ATCTGGGGCTAGGGGGCAGTGGG - Intergenic
1016542039 6:145177540-145177562 TTATGGATATAGAGAGCAGAAGG + Intergenic
1018923898 6:168193762-168193784 ATATGGGCCTGGTGGGCAGGAGG + Intergenic
1020431247 7:8118589-8118611 ATTTGGGTCTAGAAGGAAAATGG - Intronic
1026776012 7:73231557-73231579 ACCTGGGTGTAGGGGGCAGAGGG + Intergenic
1026963558 7:74425018-74425040 ATATGGGACTAGGAGGCACAGGG + Intergenic
1027016869 7:74784928-74784950 ACCTGGGTGTAGGGGGCAGAGGG + Intronic
1027071158 7:75161008-75161030 ACCTGGGTGTAGGGGGCAGAGGG - Intergenic
1028630399 7:92927452-92927474 AAAAGGGTCTAGAGGGATGATGG + Intergenic
1029340442 7:99939487-99939509 TTATGGGTCTAGTGGCCAAAGGG + Intergenic
1035938452 8:3868728-3868750 ATGTGGGTTGAGAGAGCAGAGGG - Intronic
1037686273 8:21142101-21142123 AGATGGTGCTAGAGGGTAGAGGG + Intergenic
1040546763 8:48404053-48404075 CTACGGGCCTGGAGGGCAGAGGG - Intergenic
1043968507 8:86505451-86505473 ATATGAGTGTGGAAGGCAGACGG + Intronic
1046200524 8:110921846-110921868 ATCTGAGTCTATAGGGAAGAAGG + Intergenic
1046678237 8:117137027-117137049 ATGTGTTTCTTGAGGGCAGATGG + Intronic
1047683276 8:127277024-127277046 GCATTGGACTAGAGGGCAGAGGG - Intergenic
1047775515 8:128067309-128067331 ATGTGGGGCTAGAGAGTAGAAGG + Intergenic
1049702447 8:144021316-144021338 AACTGGGTCATGAGGGCAGAGGG - Intronic
1051100356 9:13514006-13514028 AGATGAGTCCAGAGGGCAGATGG - Intergenic
1051221529 9:14853282-14853304 TTAAGGGCCTAGTGGGCAGAGGG + Intronic
1054778742 9:69147054-69147076 ATATGCGTGGAGAGGGCAGGGGG + Intronic
1054805881 9:69395630-69395652 ATACGGGTGCAGAGGGAAGAGGG - Intergenic
1057081547 9:92177678-92177700 TCCTGGGTGTAGAGGGCAGAGGG - Intergenic
1057206678 9:93177766-93177788 ATGGGGGTCTGGAGTGCAGAGGG - Intergenic
1057721064 9:97532291-97532313 TCATGGGTCCAGAGGGCAGAGGG - Intronic
1057843810 9:98506660-98506682 ATATGGGGCCTGAGGGCAGCTGG + Intronic
1059286575 9:113177764-113177786 ACATGGGACTAGTGGGCAGGGGG - Intronic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1185585042 X:1236494-1236516 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
1186319435 X:8408096-8408118 AAGTACGTCTAGAGGGCAGATGG - Intergenic
1187392485 X:18895280-18895302 ATATGGGTTTCCAGGGCAGAGGG - Intronic
1187901043 X:24026586-24026608 ATATTGGTCTAGAGAGAAAATGG - Intronic
1189123865 X:38425077-38425099 ATATGGCTCTATAAGGCCGAGGG + Intronic
1190322691 X:49187911-49187933 GTAGGGGTCTGGAGGGGAGAAGG + Exonic
1191024968 X:55904532-55904554 ATATGGATCTAGAGTTTAGAGGG + Intergenic
1191942480 X:66496361-66496383 ACATGGGTATAGAGAGTAGAAGG - Intergenic
1196251326 X:113463515-113463537 TTATGGGGATAGAGGGTAGAAGG - Intergenic
1197183708 X:123563347-123563369 TTATGGGTCTAGAGGTAAAATGG - Intergenic