ID: 952803963

View in Genome Browser
Species Human (GRCh38)
Location 3:37328362-37328384
Sequence CTTGCAGCTTGTTCTTTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952803963 Original CRISPR CTTGCAGCTTGTTCTTTGTG TGG Intronic
900037595 1:430376-430398 TTTGCAAATTGTTGTTTGTGGGG - Intergenic
900059223 1:666117-666139 TTTGCAAATTGTTGTTTGTGGGG - Intergenic
902887972 1:19420206-19420228 CTTGCCACTTGTTCTTTGCCTGG - Intronic
903404062 1:23081635-23081657 TTTGCAGCATGTTCTTGGTCAGG + Intronic
903710751 1:25322289-25322311 CTTCCAGCTTTTGCATTGTGGGG - Intronic
903952634 1:27005190-27005212 CTGGGAGCTTGTTCTTTGGAAGG - Exonic
905957494 1:42011012-42011034 CTTGCAGTTTGTTATTTCAGTGG - Intronic
906163989 1:43672065-43672087 CTCCCAGCTTGTTCTTTGCTGGG + Intronic
906754248 1:48293472-48293494 CTATCAGATTGTTGTTTGTGGGG + Intergenic
908001041 1:59679486-59679508 CTTGCATTTTTTTCTTTGTCTGG + Intronic
911826634 1:102495128-102495150 TTTTCAGCCTGTTCTTTGTTTGG - Intergenic
916668111 1:166985417-166985439 CTTTCAGGTTGTTCTTTCTTTGG - Intronic
917097014 1:171408768-171408790 CTTGCTGCTTGTTATTGGTCTGG - Intergenic
917358580 1:174152548-174152570 TTTGCAGCTTATTTTTTATGTGG + Intergenic
918152801 1:181812839-181812861 CTTGCATCTTACTCTTTGTGAGG - Intergenic
918172175 1:182008682-182008704 CTTGCTGCTTGTTATTGGTGTGG - Intergenic
918334642 1:183496609-183496631 CTTGAAGCTTTTTCTTTATTTGG + Intronic
920429632 1:205909438-205909460 CTTGCAACTTATAGTTTGTGAGG - Intergenic
920665491 1:207959806-207959828 CTTCCAGCGGGTTCTTGGTGGGG + Intergenic
920816003 1:209332642-209332664 CTTGCAGCTTGGTGTTGGTAAGG - Intergenic
1063222971 10:3988269-3988291 CTTGCAGGGTGGTCATTGTGGGG - Intergenic
1063464258 10:6232762-6232784 CTTGGATCATGTTCTTTGTCTGG + Intronic
1064154946 10:12896365-12896387 GTTGCTGCTTGTCCCTTGTGAGG + Intergenic
1065430982 10:25655193-25655215 TTTGTAGTTTGTCCTTTGTGTGG + Intergenic
1068153977 10:53171365-53171387 TTTAGAGCTTGTTCTTTGTTTGG - Intergenic
1068958187 10:62840057-62840079 CTTGCACCTTTTCCTATGTGAGG - Intronic
1075411718 10:122233413-122233435 CCTGAAGCTTGTTATTTGTATGG - Intronic
1075513847 10:123093924-123093946 CTGGCAACTTGTTCTTTGAGGGG + Intergenic
1076964321 11:68299-68321 TTTGCAAATTGTTGTTTGTGGGG - Intergenic
1081227333 11:40540454-40540476 TGTGCAGCTTCTTCTTTGTCAGG + Intronic
1084560374 11:69902119-69902141 TTTTCAGCTTGTTCTTCTTGAGG + Intergenic
1085743672 11:79097140-79097162 CTAGCAGCTTGTTCTGTGAAAGG - Intronic
1086430306 11:86730976-86730998 CTTGAAGCTTTTCCTTTTTGAGG - Intergenic
1088011259 11:105003580-105003602 GTTGCATCTTCTTCTTGGTGGGG - Intronic
1088108708 11:106235883-106235905 CATGCTTCTTGTTCTTTGTTTGG - Intergenic
1090011145 11:123046998-123047020 CTTGCAGCTGCTTCCTTGTGAGG - Intergenic
1090366729 11:126212342-126212364 CTTTCAGCTTTTTCTTTAGGAGG - Intronic
1091324724 11:134677594-134677616 CTTGCAGCTGCCTCTGTGTGAGG + Intergenic
1092535908 12:9386874-9386896 CTCCCACCTTGTTCTTTGTCAGG + Intergenic
1092979569 12:13780407-13780429 ATTGCAGAATGTTATTTGTGTGG + Intronic
1096711988 12:53464362-53464384 TTTGCAGCTTCTTCTATGAGTGG + Intronic
1098768240 12:74517347-74517369 CTTGCAGATGGTTTATTGTGGGG - Intergenic
1100203254 12:92322104-92322126 CTTGCTGCTTGTTATTGGTCAGG + Intergenic
1100265859 12:92975223-92975245 GTTGCAGCTTGTTGGTTTTGTGG + Intergenic
1101802081 12:108031267-108031289 CTCTCAGCTTATTCTTTGTCTGG - Intergenic
1102005511 12:109586926-109586948 CTTGCAGCTAGTGCACTGTGAGG - Intronic
1103083618 12:118044545-118044567 CTTGCTGTTTGATCCTTGTGCGG - Intronic
1103150401 12:118633323-118633345 CTTGGAGCTTATACTTTGTGGGG + Intergenic
1103167468 12:118782753-118782775 CCTCCAGCTTGTGCTTGGTGGGG - Intergenic
1103856780 12:123976115-123976137 CTTGAAGCTTATGATTTGTGAGG + Intronic
1105889118 13:24669380-24669402 CTGGCACCTTCTTCTCTGTGAGG + Intergenic
1106309330 13:28539910-28539932 CTTGCATATAGGTCTTTGTGTGG - Intergenic
1108457439 13:50630431-50630453 CTTGCTGCTGGTCCTCTGTGTGG - Intronic
1109626860 13:64985672-64985694 TTTGCATCTTCTTCTTTTTGTGG - Intergenic
1110484581 13:76023109-76023131 CTTTCATCTTTTTCTTTGAGGGG + Intergenic
1110839001 13:80120000-80120022 TTGGCTGATTGTTCTTTGTGGGG + Intergenic
1111995201 13:95158641-95158663 ATTGCAGAGTGTTCTTTGAGTGG - Intronic
1112994670 13:105558927-105558949 CTTACTGCTTGTTATCTGTGAGG - Intergenic
1113424422 13:110196212-110196234 CTTGCCTCCTGTGCTTTGTGGGG - Intronic
1113823771 13:113234199-113234221 CTTACAGCTTTTTACTTGTGGGG - Intronic
1114141868 14:19921364-19921386 CTTGCATCTTCATCTATGTGTGG + Exonic
1114287919 14:21262692-21262714 GCTGCAGCTTGTGGTTTGTGAGG + Intronic
1114750351 14:25197734-25197756 CTTGCTGCTTGTATTATGTGGGG + Intergenic
1115958275 14:38806940-38806962 CTTGGATTTTGTTCTCTGTGAGG - Intergenic
1116539757 14:46086713-46086735 CTAGCAGCTTGTTTTTTTTCTGG + Intergenic
1118208769 14:63747683-63747705 ATTTCAGCTAGTTATTTGTGAGG + Intergenic
1119637378 14:76286681-76286703 TTCCCAGCTTGTTATTTGTGGGG - Intergenic
1120266171 14:82253383-82253405 CTTGCAGTTTTATGTTTGTGAGG - Intergenic
1122098165 14:99386588-99386610 ATTCCAGCGTGATCTTTGTGGGG - Intergenic
1123140268 14:106070148-106070170 TTTGCACCTTTTTCTTTCTGAGG - Intergenic
1123803087 15:23841961-23841983 TTTGCTGCTTGTGCTTTCTGAGG + Intergenic
1124137378 15:27046805-27046827 CTTTCAGCTTTTTCTTTTGGAGG + Intronic
1124401931 15:29356113-29356135 AGTGCATCTTGTTCTATGTGAGG + Intronic
1125148231 15:36498493-36498515 CTAGCAGTTTGTTCCATGTGAGG - Intergenic
1126673237 15:51135635-51135657 CTTCCAGATTGTTCCTTGTGTGG - Intergenic
1127880842 15:63157447-63157469 CTTGCAGCTTGCTAGCTGTGTGG - Exonic
1128224819 15:65994357-65994379 CTTCCTGCTTATTCTTAGTGGGG - Intronic
1129976357 15:79825304-79825326 TTTGCCTCTTGTTCTCTGTGAGG - Intergenic
1132094018 15:98968835-98968857 CTGGCACCATGTTCTTTCTGAGG - Intronic
1132444229 15:101896884-101896906 TTTGCAAATTGTTGTTTGTGGGG + Intergenic
1134076448 16:11295353-11295375 ATTGCCTCTTGTTTTTTGTGGGG + Intronic
1135307089 16:21376679-21376701 CTTGCAGCTCGTGCTTGTTGAGG - Intergenic
1136303835 16:29355818-29355840 CTTGCAGCTCGTGCTTGTTGAGG - Intergenic
1137070786 16:35903077-35903099 CTTTCAGTTTCTTCTTTGTAAGG - Intergenic
1139274621 16:65716023-65716045 CTTGCAACTTGTTATTTTTGAGG - Intergenic
1139491091 16:67286435-67286457 CTTGCTGCTTGTCCTGTGGGCGG - Exonic
1139832294 16:69809931-69809953 CTTGCCCCTTGCTCTTGGTGTGG + Intronic
1139848422 16:69936306-69936328 CTTCCAGGTTGTTCTCTCTGGGG - Exonic
1140949333 16:79801245-79801267 CCTGAAGATTTTTCTTTGTGTGG + Intergenic
1144188707 17:12823086-12823108 ATAGCAGCTTGTTTTTTGGGAGG + Intronic
1146961195 17:36981333-36981355 TTTGCAGCTTATTCTCTGGGTGG + Intronic
1148569672 17:48658196-48658218 CTTGTACCTTGTACTTTGTGTGG + Intergenic
1150057265 17:62029549-62029571 ACTGCAATTTGTTCTTTGTGTGG + Exonic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1150358130 17:64505862-64505884 CTTCAAGCTTGCTTTTTGTGTGG - Intronic
1154197572 18:12277765-12277787 TTTGCAGCTTGTTATTTTTGTGG - Intergenic
1154382332 18:13863685-13863707 CTCTCTGCTGGTTCTTTGTGTGG + Intergenic
1156695344 18:39759875-39759897 CGTGCAGTTTGGTCTTGGTGAGG - Intergenic
1159156427 18:64589188-64589210 CCTGCAGCTGGTTATCTGTGTGG + Intergenic
1159185672 18:64969863-64969885 CTTGCAACTTATTCTTTGGTTGG + Intergenic
1159709747 18:71742156-71742178 CTTGGAACATGTTCTATGTGTGG - Intronic
1160303824 18:77712601-77712623 CTTTCAGCGTTTTCCTTGTGTGG - Intergenic
1160641124 19:137931-137953 TTTGCAAATTGTTGTTTGTGGGG - Intergenic
1161724136 19:5918683-5918705 CTTGGAGCTGGCTGTTTGTGAGG - Intronic
1163264387 19:16209764-16209786 CCTGCAGCTTGTTTTTTTGGTGG + Intronic
1163726796 19:18927758-18927780 CCTCCAGCTTCTTCTCTGTGGGG - Exonic
1165995806 19:39843137-39843159 TTTGGAGCTTGATCTTAGTGGGG - Intronic
1166422282 19:42647510-42647532 CTTGCTGCCTGTTGATTGTGTGG - Intronic
924980814 2:219448-219470 CTTGCACCTTCCTCCTTGTGAGG + Intronic
925943861 2:8842911-8842933 CATGCAACTTGTTCTTTCTTAGG + Intergenic
928301512 2:30129595-30129617 CCTGCAGCTGGTTCTTTTGGAGG - Intergenic
929896913 2:45968745-45968767 TTTCCAGCTTGCTTTTTGTGTGG + Intronic
930202665 2:48559962-48559984 AATGCAGCTTGTTTTGTGTGTGG + Intronic
930800034 2:55434267-55434289 CTTTCATCTTGTTATTTGTTTGG - Intergenic
932391856 2:71398615-71398637 CTTACATCTTTTTCTCTGTGAGG + Intronic
934753423 2:96809165-96809187 CGTGCACCTTGTTCTTTGTAAGG + Intronic
935998400 2:108799615-108799637 CTTTCAGTTTGTTCTGTTTGTGG + Intronic
939977385 2:148733867-148733889 CCTGCAGCTTGTTTTTGGTAAGG - Intronic
940004159 2:148996359-148996381 CTTGTAACATGTTCTTTGTGTGG + Intronic
940083123 2:149827612-149827634 CATGCAGCTTGCTGTGTGTGTGG - Intergenic
942944428 2:181657208-181657230 CTTGCAGCTGGGTCTTTTTGTGG - Intronic
943423778 2:187703199-187703221 CTTGGAGAATGTTCTATGTGTGG - Intergenic
943780681 2:191820331-191820353 CTGGCAGCTTTTTCTTCATGCGG + Intergenic
944267533 2:197745427-197745449 CTTATAACTTGTACTTTGTGTGG - Intronic
944428218 2:199605759-199605781 CTTGCTTCTTTTTCTTTCTGAGG - Intergenic
944685791 2:202116656-202116678 CTTGCAACTCTTTCTTGGTGTGG + Intronic
944964815 2:204918730-204918752 TGTGCAGTTTGTTCTTTTTGAGG + Intronic
948061993 2:235048914-235048936 CTTGCAGCTTCCTCTTTTTATGG - Intronic
948229822 2:236341733-236341755 CTTCCAGCCTGTGCTGTGTGTGG + Intronic
1169898553 20:10530304-10530326 CTTTGAGCTTTTTCTTTGTGAGG + Intronic
1174957936 20:55121759-55121781 CTTGCAGTTTCTCCTTTGTTGGG + Intergenic
1177592849 21:23194794-23194816 TTTGGAGCTTGTTGCTTGTGGGG - Intergenic
1178053295 21:28771158-28771180 CTTGCCACTTGCTATTTGTGTGG - Intergenic
1180132280 21:45834450-45834472 CATGCAGCTTGTGCTTTGGGAGG + Intronic
1181182747 22:21079047-21079069 CTTGCTGCCTGTTCTTTCTCAGG - Intergenic
1181444592 22:22959214-22959236 CTTGGAGCTTGTTCACTGAGGGG - Intergenic
1181966987 22:26663634-26663656 CTCACAACTGGTTCTTTGTGCGG + Intergenic
1182268038 22:29134777-29134799 CTATCAGCTTGTGCTTAGTGTGG + Intronic
1183204706 22:36410628-36410650 CTTGCCTCTTGTTCTCTGAGAGG - Intergenic
1183210110 22:36445939-36445961 CTTGCCTCTTGTGCTATGTGAGG - Intergenic
1183402819 22:37614565-37614587 CCTGCAGCCAGTGCTTTGTGGGG + Intronic
1184357522 22:43992493-43992515 TTTCCAGCTTGGGCTTTGTGTGG - Intronic
949094517 3:70220-70242 ATTGCAGCTTGTGCTTTATTCGG - Intergenic
950472537 3:13194972-13194994 CTTCCTGCTTTTTCTTTGTGTGG - Intergenic
952070804 3:29633571-29633593 CTTCCAGCTTGTTTTTTCTTGGG + Intronic
952803963 3:37328362-37328384 CTTGCAGCTTGTTCTTTGTGTGG + Intronic
957214731 3:77304818-77304840 TTAGCAGATTGTTCTTTGAGGGG + Intronic
958095547 3:88939453-88939475 TTTGCAGGTTGTTCTTTGTTAGG + Intergenic
958512974 3:95073101-95073123 CTTTCAGCTTATTCATTGGGAGG - Intergenic
959942627 3:112095507-112095529 CTTGCAGACTGCTCTTTGTGAGG - Intronic
961935902 3:130583409-130583431 ATTTCAGCTTTTCCTTTGTGGGG + Intronic
963282972 3:143404979-143405001 CTTGCTGATGGATCTTTGTGTGG + Intronic
963617809 3:147565169-147565191 CTTGAAGAATGTTCTATGTGTGG - Intergenic
965084180 3:164073147-164073169 CTAGCAGTTTTTTCTTTGTTAGG - Intergenic
965259925 3:166468795-166468817 CTTTCAGCTTGTGCTGTATGTGG - Intergenic
967890429 3:194360701-194360723 CCTGCAGCTTGTTGTTGGCGAGG + Exonic
968419069 4:467599-467621 CATGCAGCTTGGTCTTACTGAGG + Intronic
969371955 4:6737402-6737424 CATGCAGCTTGTTTTTTTTGAGG + Intergenic
970433193 4:16007868-16007890 CCTGGAGCTCGTTGTTTGTGGGG + Intronic
976845721 4:89487215-89487237 CTTACAGATTTTTGTTTGTGTGG - Intergenic
977325043 4:95564363-95564385 CTTGAAGGTTTTTCTTTGTAAGG + Intergenic
977343122 4:95785629-95785651 CGTGCAGATTCTTATTTGTGAGG - Intergenic
978295041 4:107195249-107195271 ATTGGAGCTTATCCTTTGTGAGG - Intronic
978631621 4:110753516-110753538 CTGGCAACTTGTTCTTTATGAGG - Intergenic
982584623 4:157221646-157221668 CTTGCTGTTTGTTCTTTGCAGGG + Exonic
985919733 5:2960909-2960931 TTAGCAGCATGTTCTTTCTGTGG + Intergenic
985930883 5:3056915-3056937 CTTACAGAGTGTTCTTTGGGAGG + Intergenic
986611666 5:9574109-9574131 CGTGCTGCTTTTTCTTTGTTTGG + Intergenic
986702070 5:10420176-10420198 GATGCAGCTTCTTGTTTGTGGGG - Intronic
986777198 5:11026988-11027010 TTTGCATGTTTTTCTTTGTGTGG - Intronic
988499197 5:31770132-31770154 TTTGGAGCTTGTTCTGTTTGTGG + Intronic
991408740 5:66326495-66326517 CTTACAAATTGTTCTATGTGAGG - Intergenic
993428882 5:87805630-87805652 CTTTCAGTTGGTTCTTTCTGTGG + Intergenic
994219240 5:97175695-97175717 GATTCAGCTTGTTCTTTGAGTGG - Intronic
1000493899 5:161953176-161953198 TTTGCTGATTGTTCTTTCTGTGG - Intergenic
1000999075 5:167988074-167988096 CATGCAGGTTGTTTTTTCTGTGG + Intronic
1001146987 5:169193525-169193547 CTTGCAGCTTATTCTTGTTCAGG + Exonic
1001392007 5:171387266-171387288 ATTGCGGCTTATTCTTTGTTAGG - Intronic
1002018559 5:176346689-176346711 CTTGCAGCTAGTTCTTCATGTGG - Exonic
1002736226 5:181388490-181388512 TTTGCAAATTGTTGTTTGTGGGG + Intergenic
1002748471 6:86334-86356 TTTGCAAATTGTTGTTTGTGGGG - Intergenic
1003529008 6:6922057-6922079 CCTGCAGCCTGTCCTTTGAGGGG + Intergenic
1005898204 6:30195997-30196019 TTTCCATCTTGTTCTCTGTGTGG + Intronic
1007157162 6:39756690-39756712 CTTGCAGCAAGTTCTTTGAAAGG - Intergenic
1008147162 6:47905954-47905976 CTTGTTGCTTGTTGTCTGTGGGG + Intronic
1008428670 6:51389055-51389077 CTTGCAGCTGGTTCTTCATATGG - Intergenic
1008525184 6:52400470-52400492 CATGCAGCTTGTTGATGGTGGGG + Intronic
1008780447 6:55097067-55097089 CTTGAAGATTTTTCTTTTTGTGG + Intergenic
1009644510 6:66380371-66380393 CTTGCAGCTTGTTATTAGTCTGG + Intergenic
1009705142 6:67239634-67239656 CTTGAAGCTGTTTCTTTCTGTGG + Intergenic
1011726458 6:90215085-90215107 AGTGCAGCTTATTCTTTTTGAGG + Intronic
1012394004 6:98774881-98774903 CTTTCACCTGGCTCTTTGTGTGG - Intergenic
1012644198 6:101659278-101659300 CTTACTGCTTGTTTTTTGTCAGG + Intronic
1014947247 6:127514234-127514256 CTTGCAGCCTGTTTGGTGTGAGG - Intronic
1015365087 6:132388339-132388361 CTTGCTGCTTATTCATTGTGTGG - Intronic
1017211562 6:151862684-151862706 CCTGCTGCTTGTTCTTTGCTGGG + Intronic
1019241324 6:170664018-170664040 TTTGCAAATTGTTGTTTGTGGGG + Intergenic
1019274303 7:167693-167715 CTTGGAGCTTGTGATGTGTGTGG - Intergenic
1020920833 7:14262400-14262422 CTTGCCCCTTCTACTTTGTGAGG + Intronic
1020951599 7:14685749-14685771 TTTGCAGGTTTTTCTTTGTCAGG - Intronic
1023154622 7:37236204-37236226 CTTGCAGCCTGTTCTGTCTGAGG - Intronic
1023248171 7:38229553-38229575 CTGGCAGCTTTTTCCTTCTGTGG - Intronic
1027665451 7:81038913-81038935 TTTGCAGCTTGTAGTATGTGTGG - Intergenic
1027806060 7:82824340-82824362 CTTTCAGTCTGTTCTTTGAGAGG + Exonic
1028366801 7:90041551-90041573 ATTGCTGCTACTTCTTTGTGTGG - Intergenic
1031253998 7:119424539-119424561 CTTGGAGAATGTTCTATGTGTGG - Intergenic
1031490167 7:122377579-122377601 TTTGCACCTTCTTCTCTGTGAGG - Intronic
1032185362 7:129720514-129720536 CTTGCAGCTTGCTCTGTTTTGGG + Intronic
1033567262 7:142591260-142591282 CTTGCAATTTGTTCTGGGTGTGG - Intergenic
1034834703 7:154341244-154341266 CCTGCAGCTCTTTCCTTGTGTGG + Intronic
1035506794 8:144077-144099 TTTGCAAATTGTTGTTTGTGGGG - Intergenic
1037149791 8:15622640-15622662 GTTGCAGCTTTGTGTTTGTGGGG + Intronic
1037435799 8:18861878-18861900 CTGGCAGCTTGTTCTCGGGGAGG - Intronic
1038525847 8:28272678-28272700 CTTGCATCTACTTCTCTGTGTGG - Intergenic
1038700497 8:29845327-29845349 GTTGGATTTTGTTCTTTGTGTGG + Intergenic
1039744868 8:40415613-40415635 CTAGCAGCTTTTCCTATGTGTGG - Intergenic
1039858809 8:41438876-41438898 CTTTCATCTTGTCTTTTGTGTGG - Intergenic
1040585383 8:48735718-48735740 CTAGAAGCTTGCTCTTTGGGCGG + Intergenic
1042594067 8:70426681-70426703 CTTGCACCTTGTTCTGTGCCCGG + Intergenic
1043391784 8:79798844-79798866 CTTGGAGCTTTCTCTTTATGTGG - Intergenic
1043876104 8:85488216-85488238 CTTGCTGCTTGTTATTGGTCTGG + Intergenic
1047871726 8:129090491-129090513 TTTGTAGCTTGTTATTTGTGTGG - Intergenic
1047984293 8:130216485-130216507 CTTGAAACATGTTCTTTGTCTGG + Intronic
1048385923 8:133912506-133912528 TCTGCAGCTTGTTGTGTGTGTGG + Intergenic
1052264937 9:26561252-26561274 CTTCCAGGTTGTTCTTTCTGTGG - Intergenic
1053349858 9:37406402-37406424 GTTGCAGCTTGTTCTTTGTCAGG + Intergenic
1055893852 9:81152870-81152892 CTTGCACCTTCTGCTATGTGAGG - Intergenic
1056511006 9:87305620-87305642 CTTGAAACTTGTTCCTTGAGGGG + Intergenic
1057364256 9:94404039-94404061 CTTCCACCTTCTGCTTTGTGAGG + Intronic
1057659078 9:96984032-96984054 CTTCCACCTTCTGCTTTGTGAGG - Intronic
1060820743 9:126660228-126660250 CTTAGAGATTGTTCTGTGTGGGG + Intronic
1061478501 9:130884781-130884803 TTTCCAGCTTCTTCCTTGTGGGG - Exonic
1203601516 Un_KI270748v1:13252-13274 TTTGCAAATTGTTGTTTGTGGGG + Intergenic
1186450331 X:9667268-9667290 TTTATAGCTTGTTCTTTTTGGGG - Intronic
1186835769 X:13436255-13436277 CTTCCAGTTTGGTGTTTGTGGGG - Intergenic
1188136998 X:26503716-26503738 CTTGCAGCTTGAGCTTTGAGGGG - Intergenic
1189205972 X:39239098-39239120 CTGGAAGCTTCTTCATTGTGTGG + Intergenic
1194758080 X:97761531-97761553 CTTGATGCTTTTTCTTTGTTTGG + Intergenic
1195801402 X:108715841-108715863 CTTTCAGGTTGTTCTTTCTTTGG + Intergenic
1197148508 X:123194118-123194140 CCTGCTGCCTGTTCTGTGTGTGG + Intronic
1197462335 X:126757656-126757678 CTTGCATCTAGTTCTCTCTGGGG + Intergenic
1197774043 X:130108858-130108880 CTTGCATCTGGTTGTTTTTGGGG - Intronic
1197957769 X:131971404-131971426 CTTTCAGCTGGTTCTTTCTATGG + Intergenic
1198683919 X:139207967-139207989 CTGGCAGCTTGTTCTGTGAAAGG + Intronic
1202343365 Y:23892868-23892890 CTTCCTGCTTTTGCTTTGTGAGG - Intergenic
1202527403 Y:25777217-25777239 CTTCCTGCTTTTGCTTTGTGAGG + Intergenic