ID: 952808726

View in Genome Browser
Species Human (GRCh38)
Location 3:37382087-37382109
Sequence AGAACTCCTCTCTCTAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952808726_952808728 4 Left 952808726 3:37382087-37382109 CCTTGGCTAGAGAGAGGAGTTCT No data
Right 952808728 3:37382114-37382136 TGGAGATTATTTTTTTTTTTTGG No data
952808726_952808729 25 Left 952808726 3:37382087-37382109 CCTTGGCTAGAGAGAGGAGTTCT No data
Right 952808729 3:37382135-37382157 GGTCTGAATTCAGCATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952808726 Original CRISPR AGAACTCCTCTCTCTAGCCA AGG (reversed) Intergenic
No off target data available for this crispr