ID: 952811016

View in Genome Browser
Species Human (GRCh38)
Location 3:37402727-37402749
Sequence CCTGATAAGCAGCTATTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952811016_952811020 29 Left 952811016 3:37402727-37402749 CCTTGCAATAGCTGCTTATCAGG 0: 1
1: 0
2: 0
3: 5
4: 116
Right 952811020 3:37402779-37402801 CTGTTTTTATTTTTCCCTTTTGG 0: 1
1: 2
2: 17
3: 211
4: 1982

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952811016 Original CRISPR CCTGATAAGCAGCTATTGCA AGG (reversed) Intronic
902127804 1:14231656-14231678 ACTGATAACCAGTTATTGCTAGG - Intergenic
904854177 1:33484063-33484085 ACTAATAAGCAGTTATAGCAAGG - Intronic
905003216 1:34689696-34689718 CCTGAGAAGGAGCAATTGTAGGG - Intergenic
907866956 1:58407730-58407752 TCTGATAGGAAGATATTGCAGGG - Intronic
908177790 1:61572867-61572889 CCTGAGAAGCAGCACCTGCATGG + Intergenic
909695254 1:78461333-78461355 CCTGATAAACAACTACAGCAAGG - Intronic
909824417 1:80109335-80109357 CCAGATAAATAGCTAATGCATGG + Intergenic
910430333 1:87153642-87153664 CTTGATAACCAGCTGTTGAATGG + Intronic
911460654 1:98185472-98185494 TCTGATAATTAGCAATTGCAAGG + Intergenic
912015999 1:105036405-105036427 TCTGATATGAAGCTATTGAATGG - Intergenic
913039545 1:115009146-115009168 CCTGATATGCAGCCATTGATTGG - Intergenic
913498849 1:119452270-119452292 CCTGATTTGCAGCAATGGCAGGG + Intergenic
920087882 1:203431146-203431168 ACTGATAAGCATCAGTTGCAGGG + Intergenic
922537576 1:226392531-226392553 CCTGATATGCTGCTCTTTCAAGG - Intronic
1065095604 10:22277947-22277969 CCTGCTAAGGAGCTATACCAAGG - Intergenic
1065530065 10:26660446-26660468 ACTAATAAGCAGTTATAGCAAGG - Intergenic
1068575553 10:58680315-58680337 GCTGATAAGCAGCTTCAGCAAGG + Intronic
1073991375 10:109265981-109266003 CCACACAAGGAGCTATTGCAAGG + Intergenic
1076583684 10:131531649-131531671 CCTGAACAGCAGCTATGGAAAGG - Intergenic
1077573010 11:3355413-3355435 CCTGGTGAGCAGCTATGGAAGGG + Intronic
1079423085 11:20312883-20312905 CCTCATAAGCAACTAGTACAAGG + Intergenic
1080368590 11:31608516-31608538 CCTGGTGAGCAGCTATGGAAGGG + Intronic
1091565335 12:1644018-1644040 ACGGATAAGCATCTCTTGCAGGG - Intronic
1093616305 12:21229726-21229748 ACTAATAAGCAATTATTGCAAGG - Intronic
1099038430 12:77619554-77619576 CCTTCTAAGCAGGCATTGCATGG + Intergenic
1099674012 12:85733325-85733347 CCTGAGAAGCGGCTGGTGCAAGG - Intergenic
1108586639 13:51875714-51875736 CCTGATCAGCAGCGCCTGCAAGG - Intergenic
1110346595 13:74455039-74455061 ACTAATAAGCAGTTATAGCAAGG + Intergenic
1112466178 13:99646890-99646912 ACTGAGAAGTAGCTATCGCAGGG - Intronic
1113342803 13:109443349-109443371 GCTGATAAGCAACTTTAGCAAGG - Intergenic
1118667342 14:68085398-68085420 CCTTATGAGCAGCTTTTTCAAGG + Intronic
1122449074 14:101789328-101789350 TCTGGTAAGCAGCCTTTGCAAGG + Intronic
1125242574 15:37592873-37592895 ACTGATAACAAGCTACTGCAGGG - Intergenic
1128716597 15:69913257-69913279 GCAGATAAGCAGCCCTTGCATGG - Intergenic
1137538466 16:49345257-49345279 CCTCATTATCAGCTAATGCATGG - Intergenic
1139029137 16:62858202-62858224 GCTTATAAGCAGCTCTTACATGG + Intergenic
1139836329 16:69841568-69841590 CTTGAGAAACAGCTATTGAAGGG + Intronic
1140623483 16:76764384-76764406 ACTAATAAGCAGTTATAGCAAGG + Intergenic
1140842797 16:78856516-78856538 CCTGAGTAGCTGCTATTACAGGG - Intronic
1143226037 17:5304277-5304299 CATTATAAGTAGCCATTGCATGG + Intronic
1150865511 17:68845175-68845197 CCTGATAAGCAACTTCAGCAAGG + Intergenic
1156250425 18:35346896-35346918 GCTTGTAAGCAGCTAGTGCAAGG + Intergenic
1157980326 18:52372368-52372390 CCTCATAACCAGCCAATGCATGG - Intronic
1158198392 18:54913048-54913070 CCAGATAAGCAGATATTGATGGG + Intronic
1164438648 19:28254356-28254378 CCTCAAAAGCAGCTGTTCCATGG - Intergenic
1167956549 19:53069944-53069966 CCTGAACTGCAGCTATTTCAAGG - Exonic
927446362 2:23165537-23165559 CGTGATAAGAAGCTGTTGCAGGG + Intergenic
928379076 2:30802701-30802723 CCTAAAAACCAGCTCTTGCAGGG + Intronic
929636052 2:43521645-43521667 CCTGAATAGCAGCTATAGCCTGG - Intronic
930987287 2:57605793-57605815 GCTGATAAGCAACTTTGGCAAGG - Intergenic
935171571 2:100614532-100614554 CCTGCTAAGAATCTATTGCAAGG - Intergenic
935418388 2:102842419-102842441 CCTGATAAGCAGCTGTGTGAGGG - Intronic
935869020 2:107424998-107425020 GCTGATAAACAGCTATTTCTGGG - Intergenic
940120021 2:150253938-150253960 CCTTATATGCAGCTCTTCCAGGG - Intergenic
940491952 2:154373775-154373797 CCTGTTAAGTGGCTATTACAAGG - Intronic
942102875 2:172603423-172603445 CCTGATAATTGGCTAATGCAAGG + Intronic
943605522 2:189972844-189972866 GCTGATAAGCAACTTTAGCAAGG - Intronic
945971171 2:216233688-216233710 CCTGAGAAGCAGTTATGGTATGG + Intergenic
949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG + Intergenic
1173193409 20:40894239-40894261 CCTGAGAGGCAGGTATGGCAGGG + Intergenic
1177371629 21:20211422-20211444 CTTTATAAGCAGATATTGTAAGG - Intergenic
1179281961 21:39941377-39941399 CCTGGGAAGCAGCTATCCCAAGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
950352108 3:12365391-12365413 CCAGATAATCAGTTATTTCATGG + Intronic
951748065 3:26001430-26001452 GCTGATAAGCAACTACTGCTAGG - Intergenic
951821804 3:26822125-26822147 CCTAATAAGCAGATATAGCTAGG - Intergenic
952422415 3:33144078-33144100 CCTGTTAGGAAGCTACTGCAAGG + Exonic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
953129371 3:40123758-40123780 CCTGAGAAGCAGCTCATCCAAGG + Intronic
954413070 3:50379630-50379652 CGGGGTAGGCAGCTATTGCATGG + Intronic
955467448 3:59252022-59252044 CTTGACAAGAAGCTTTTGCATGG - Intergenic
959667733 3:108940545-108940567 CATGATTGGCAGCCATTGCAAGG + Intronic
967547955 3:190753974-190753996 ACTGATAAGCAATTATAGCAAGG - Intergenic
974125076 4:57686111-57686133 CCAGATAAGCAGATAGTGCAGGG - Intergenic
976254727 4:83088157-83088179 ACTAATAAGCAGTTATGGCAAGG + Intergenic
977622363 4:99152139-99152161 CCTGATAAGAACCTTTTACAAGG - Intronic
979325870 4:119378868-119378890 CCTGAACAGCAGCTAAAGCAAGG - Intergenic
980941922 4:139282985-139283007 CCTGATAAGCATATTTTTCATGG + Intronic
981435655 4:144718471-144718493 TGAGATAAGAAGCTATTGCAGGG + Intronic
981531927 4:145761794-145761816 GCTGACAAGCAGCTCTGGCAAGG + Intronic
982405018 4:155009698-155009720 CCTCATTTGCAGCTATGGCATGG + Intergenic
982597889 4:157407807-157407829 CCTGGTATGCAGCTATTGATTGG - Intergenic
983243786 4:165264016-165264038 CCTGAAGAGCAGCTAAAGCAAGG - Intronic
984663898 4:182405035-182405057 CCAGGTAAGAAGCTAGTGCAAGG - Intronic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
993566929 5:89488085-89488107 TCTAATAAGCAGCTTTTGCTGGG + Intergenic
994224294 5:97234521-97234543 CATTCTAAGCAACTATTGCAAGG - Intergenic
998540514 5:142977188-142977210 CCTCATAATGAGCAATTGCAAGG + Intronic
1001499709 5:172220898-172220920 CCTAATAAGCAATTATAGCAAGG + Intronic
1004249015 6:14007109-14007131 TCTGATAAGCAGTTATTACTTGG - Intergenic
1004594619 6:17087218-17087240 CCTGATAGGCAGCATTTCCATGG + Intergenic
1004866518 6:19858243-19858265 CCTGATAATCATTTATTCCATGG + Intergenic
1008473557 6:51911253-51911275 CCTATTAAGCATCTATTTCAGGG - Intronic
1009318504 6:62255486-62255508 CCTGCTCTGCAGCTAGTGCATGG - Intronic
1014211176 6:118709781-118709803 CCTGATAAGCAGCCCTGTCAGGG - Intronic
1015518256 6:134106105-134106127 CCTGACAAGCTGGTATAGCATGG - Intergenic
1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG + Intronic
1020941574 7:14545645-14545667 CCTGCTGAGCAGCTATTGTGAGG - Intronic
1023170921 7:37389688-37389710 CCTGATATTCAGCTTTTGCTGGG + Intronic
1025875837 7:65478986-65479008 CCTGGTGAGCAGCTATGGCAGGG - Intergenic
1025957037 7:66190980-66191002 CCTGAGAAGCAGAGGTTGCAGGG - Intergenic
1028440195 7:90850764-90850786 CCTGTTAAGCAGCTGTTGAGAGG + Intronic
1037684811 8:21129746-21129768 CCAGATTAGCAGCTAGTGCCTGG - Intergenic
1038752526 8:30309453-30309475 ACTGATAAGTAACTATAGCAAGG - Intergenic
1039838446 8:41276449-41276471 TCTGTTAAGCTGCCATTGCAAGG - Intronic
1045446869 8:102275652-102275674 CCTGATAAGCATGTATTTCAGGG - Intronic
1048420805 8:134276568-134276590 CCTGGCAAGCTGCTATTGGAAGG - Intergenic
1049880428 8:145058327-145058349 CCTGCTAAGCAGGTCTTTCATGG - Intergenic
1050602976 9:7271551-7271573 CCTGCTAAGCAGCCAAGGCATGG - Intergenic
1050951851 9:11607106-11607128 CTTGACAAGTAGATATTGCAAGG + Intergenic
1056214847 9:84397457-84397479 CCTGCTAAGCAGCTCTTAGATGG - Intergenic
1059592710 9:115679357-115679379 CATGATAAGGAGCTAAGGCAGGG - Intergenic
1187003493 X:15206679-15206701 TCTGATAAGGAGCTAATACAGGG - Intergenic
1187495959 X:19796034-19796056 CCTGACAAGCATCTGTTGAATGG + Intronic
1187652331 X:21422274-21422296 CAGGATCAGCAGCTACTGCATGG + Intronic
1189907494 X:45776680-45776702 CCTGACCAGCATCTATCGCAAGG + Intergenic
1192859447 X:75050687-75050709 CTTGAAAAGCAGTTATTGTAGGG - Intergenic
1196561616 X:117155962-117155984 GCTGATAAGCAGCTTCAGCAGGG + Intergenic
1197706022 X:129635022-129635044 CCTGACAAGCAGCATTTCCATGG - Intergenic
1198000743 X:132433282-132433304 CCTGACAAGCTGTTATGGCATGG + Intronic
1201770978 Y:17616584-17616606 CCTGATAAGCTGGGATTACAGGG + Intergenic
1201830577 Y:18289402-18289424 CCTGATAAGCTGGGATTACAGGG - Intergenic