ID: 952811020

View in Genome Browser
Species Human (GRCh38)
Location 3:37402779-37402801
Sequence CTGTTTTTATTTTTCCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2213
Summary {0: 1, 1: 2, 2: 17, 3: 211, 4: 1982}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952811016_952811020 29 Left 952811016 3:37402727-37402749 CCTTGCAATAGCTGCTTATCAGG 0: 1
1: 0
2: 0
3: 5
4: 116
Right 952811020 3:37402779-37402801 CTGTTTTTATTTTTCCCTTTTGG 0: 1
1: 2
2: 17
3: 211
4: 1982
952811018_952811020 2 Left 952811018 3:37402754-37402776 CCAAATTGCTAGAGTAGTGCCTG 0: 1
1: 0
2: 2
3: 31
4: 242
Right 952811020 3:37402779-37402801 CTGTTTTTATTTTTCCCTTTTGG 0: 1
1: 2
2: 17
3: 211
4: 1982

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952811020 Original CRISPR CTGTTTTTATTTTTCCCTTT TGG Intronic
Too many off-targets to display for this crispr