ID: 952812011

View in Genome Browser
Species Human (GRCh38)
Location 3:37412334-37412356
Sequence AGGAACAGCACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 5, 2: 45, 3: 100, 4: 363}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952812011_952812020 29 Left 952812011 3:37412334-37412356 CCCACAATCACTGTGCTGTTCCT 0: 1
1: 5
2: 45
3: 100
4: 363
Right 952812020 3:37412386-37412408 TCGTGGCTGGAGCTGAGAATGGG 0: 1
1: 0
2: 0
3: 14
4: 181
952812011_952812021 30 Left 952812011 3:37412334-37412356 CCCACAATCACTGTGCTGTTCCT 0: 1
1: 5
2: 45
3: 100
4: 363
Right 952812021 3:37412387-37412409 CGTGGCTGGAGCTGAGAATGGGG 0: 1
1: 0
2: 3
3: 35
4: 315
952812011_952812015 12 Left 952812011 3:37412334-37412356 CCCACAATCACTGTGCTGTTCCT 0: 1
1: 5
2: 45
3: 100
4: 363
Right 952812015 3:37412369-37412391 GATTATCTCTCCATACCTCGTGG 0: 1
1: 0
2: 0
3: 12
4: 98
952812011_952812016 16 Left 952812011 3:37412334-37412356 CCCACAATCACTGTGCTGTTCCT 0: 1
1: 5
2: 45
3: 100
4: 363
Right 952812016 3:37412373-37412395 ATCTCTCCATACCTCGTGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 62
952812011_952812019 28 Left 952812011 3:37412334-37412356 CCCACAATCACTGTGCTGTTCCT 0: 1
1: 5
2: 45
3: 100
4: 363
Right 952812019 3:37412385-37412407 CTCGTGGCTGGAGCTGAGAATGG 0: 1
1: 0
2: 3
3: 23
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952812011 Original CRISPR AGGAACAGCACAGTGATTGT GGG (reversed) Intronic
900616045 1:3566137-3566159 AAGAACAGGACAGTGACTGCAGG - Intronic
903274536 1:22212318-22212340 AGGAACAGCATGGGGGTTGTGGG - Intergenic
903600667 1:24536582-24536604 GGAAACAGCACAGTGAGTGGAGG - Exonic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907622701 1:55997747-55997769 TAGAACAGCACAGTGCTTGAAGG + Intergenic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910087192 1:83417553-83417575 AGGAAAAGTACAGAGATTGGAGG - Intergenic
910384225 1:86664350-86664372 AGGCAGAGCACAGTGATTACAGG + Intergenic
910384430 1:86665570-86665592 AGGCAGAGCACAGTGATTACAGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911012600 1:93297057-93297079 AGTAAGAGCGCAGTGATTTTGGG - Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
914639020 1:149584482-149584504 AGCAAGAGCACAGAGATTCTAGG - Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
916744401 1:167673484-167673506 AGGAAGCTCACAGTGAGTGTTGG + Intronic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917637062 1:176947658-176947680 AGCAATAGCACAGTGTTTCTAGG + Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
919971008 1:202578651-202578673 AGAAAACTCACAGTGATTGTAGG + Intronic
919972089 1:202587612-202587634 AGGAAAGGCACACTGATGGTGGG + Exonic
920570293 1:207011341-207011363 AGGTACAGAAGAGTCATTGTGGG - Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920953768 1:210598630-210598652 AGAAAGATCACAGTGACTGTGGG - Intronic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
921073513 1:211682005-211682027 GGGGGCAGCACAGTGATGGTAGG + Intergenic
921465730 1:215484781-215484803 ATCAACAGCACAGTGTTGGTAGG - Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
923216419 1:231852035-231852057 AGGAACAGCACTGTGAGGGAGGG + Intronic
923686132 1:236154998-236155020 AGAAACATAACAGTGATGGTAGG + Intronic
1063066025 10:2609631-2609653 AGGAGAACCACAGTAATTGTTGG + Intergenic
1063858235 10:10278966-10278988 TGGAGCAGGACAGTGATTCTAGG - Intergenic
1064717279 10:18189879-18189901 AGGCAAAGAAAAGTGATTGTTGG + Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065421780 10:25552746-25552768 AGGTACAGCACAGTGAGTCAGGG - Intronic
1066622645 10:37374576-37374598 AGAAACAGCACAGGGACTGTGGG + Intronic
1067497511 10:46773747-46773769 AGGAATAGAACAGTGTGTGTAGG - Intergenic
1067597140 10:47566668-47566690 AGGAATAGAACAGTGTGTGTAGG + Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1068926068 10:62539996-62540018 AGGAGCAGCACAGGGAATTTTGG + Intronic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069994996 10:72336513-72336535 AGAAGCAGCAGAGTGAGTGTGGG - Exonic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1072197024 10:93125043-93125065 ATGAACAGCACAGCCTTTGTGGG - Intergenic
1074087594 10:110220262-110220284 AGGAGCAGCACCGTGCATGTTGG + Intronic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1078855027 11:15200352-15200374 AGGAATAGCATGGTGACTGTTGG + Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1083683975 11:64365215-64365237 AGGAACTGCCCAGTGAGGGTGGG + Intronic
1085686909 11:78631717-78631739 AGGCACAGCAAAGCGAGTGTGGG - Intergenic
1085980404 11:81717867-81717889 AGGAAAACTGCAGTGATTGTGGG + Intergenic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087030928 11:93703615-93703637 AAGAACAGAACAGTGAAGGTAGG - Intronic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089535294 11:119157161-119157183 AGGAACAGCACTGTGACCTTAGG + Intronic
1089700462 11:120241057-120241079 AGGAACAGCAAGGTGAATGGAGG - Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094471549 12:30806211-30806233 AGAACCAGCACAGCCATTGTGGG + Intergenic
1095072807 12:37876926-37876948 AGGAACTGCAAAGTGATATTTGG - Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095250587 12:39974337-39974359 ATGAACAGCACAGAGAGGGTTGG + Intronic
1095718914 12:45378787-45378809 AGCAGCAACACAGTGATTATGGG + Intronic
1096738291 12:53673418-53673440 GGGATCAGCAAAGAGATTGTTGG - Intronic
1097187326 12:57202819-57202841 AGGCACAGCACAGGGATGGGGGG - Intronic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1098395201 12:70010213-70010235 AGGGACAGCACAGCAACTGTAGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1099885416 12:88524004-88524026 AGGAACAGCACAGGGGTTTGGGG + Intronic
1100904808 12:99285756-99285778 AGGAAGAGAGCAGTAATTGTGGG + Intronic
1101252100 12:102946556-102946578 AGGGACAGCAAAGGGATTGTGGG - Intronic
1101552027 12:105772193-105772215 GGGAAGAGCTCAGCGATTGTTGG - Intergenic
1101651050 12:106677342-106677364 GGGAACAGCACTGTGGATGTGGG + Intronic
1102262109 12:111449440-111449462 TAGAACAGAACACTGATTGTGGG - Exonic
1103346243 12:120252248-120252270 GAGAACAGCACAGTGCTTGGTGG + Intronic
1103588869 12:121976373-121976395 AGGAAGAGCTCAGTGAATGGAGG + Intronic
1105238161 13:18581540-18581562 AGAAACAGCTCTGTGTTTGTAGG - Intergenic
1107453694 13:40535609-40535631 CGGAACAGCACAGGGAGTGTCGG - Intergenic
1107654320 13:42575303-42575325 AGGAACTGCAGAGAGATAGTAGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1107908050 13:45079973-45079995 AAGAACAACACATTGATGGTAGG + Intergenic
1108315372 13:49231774-49231796 AGCAACAGAACAGTGATGTTGGG + Intergenic
1108492704 13:50997352-50997374 TGAAACAGCACAGTGAAAGTTGG + Intergenic
1109639560 13:65172005-65172027 AGGAAAAACACAATGATGGTTGG - Intergenic
1109914358 13:68961477-68961499 AGCAATAGCACAGTGATAGGAGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112785708 13:102949788-102949810 AGGAGCAGAACAATGATTCTGGG + Intergenic
1112823707 13:103366629-103366651 AAAACCAGCACAATGATTGTTGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1115930085 14:38481842-38481864 AGGCACAGCAAAATGATTATGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116504906 14:45665908-45665930 AGGAAGAACACAGCAATTGTGGG - Intergenic
1116541806 14:46109268-46109290 CTGAAGAGCACAATGATTGTGGG + Intergenic
1116862970 14:50009051-50009073 CAGAACAGCACAGTGAGTTTGGG - Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117483204 14:56169162-56169184 TGGAACAGCCCAGGGAGTGTTGG - Intronic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1122518026 14:102322140-102322162 AGGAACAGCCCAGAGGTGGTGGG - Intronic
1125266921 15:37892268-37892290 AGGAAGAGGACAGTAACTGTTGG - Intergenic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127140270 15:55969129-55969151 ACGAAGGGCAAAGTGATTGTGGG + Intronic
1127187048 15:56490911-56490933 ATGAACAGAGCAGTGATTCTCGG + Intergenic
1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG + Intronic
1130336250 15:82959437-82959459 AGGCAGAGCACAGTCATTGCAGG + Intronic
1131863911 15:96686316-96686338 ACGATCAGCACAGTGAATGTTGG - Intergenic
1132148268 15:99441469-99441491 AGGAGAAGGAAAGTGATTGTGGG - Intergenic
1134407164 16:13970585-13970607 TGGGACAGCACAGTGATTGCAGG - Intergenic
1136119144 16:28118805-28118827 AGGAAGTGCTCAGTGACTGTTGG - Intronic
1140250288 16:73289141-73289163 AGGAACAGGCCAGCGATTGGAGG - Intergenic
1142714148 17:1738838-1738860 AGGAGCAGGACAGTGAGGGTAGG + Intergenic
1142714261 17:1739333-1739355 AGGAGCAGGACAGTGAGGGTGGG + Intergenic
1142714282 17:1739423-1739445 AGGAGCAGGACAGTGAGGGTGGG + Intergenic
1142714332 17:1739646-1739668 AGGAGCAGGACAGTGAGGGTGGG + Intergenic
1142714396 17:1739916-1739938 AGGAGCAGGACAGTGAGGGTGGG + Intergenic
1142714439 17:1740096-1740118 AGGAGCAGGACAGTGAGGGTGGG + Intergenic
1142714470 17:1740231-1740253 AGGCACAGGACAGTGAGGGTGGG + Intergenic
1142714523 17:1740456-1740478 AGGAGCAGGACAGTGAGGGTGGG + Intergenic
1142714762 17:1741446-1741468 AGGAGCAGGACAGTGAAGGTGGG + Intergenic
1142714792 17:1741581-1741603 AGGAGCAGGACAGTGAGGGTGGG + Intergenic
1142714812 17:1741671-1741693 AGGAGCAGGACAGTGAGGGTGGG + Intergenic
1142714835 17:1741761-1741783 AGGAGCAGGACAGTGAGGGTGGG + Intergenic
1142714888 17:1741984-1742006 AGGAGCAGGACAGTGAGGGTGGG + Intergenic
1142714900 17:1742029-1742051 AGGAGCAGGACAGTGAGGGTGGG + Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146242678 17:31244616-31244638 ACGGACAGCACAGTGATTATGGG - Intronic
1148037730 17:44680722-44680744 AGGAAAAGCACACTGAATGGAGG + Intronic
1148498954 17:48074384-48074406 AGGAAAATTACAGAGATTGTTGG + Intronic
1148605912 17:48928649-48928671 AGGAACTGGACAGGGATTGGTGG + Exonic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1152296365 17:79469489-79469511 AGGGACGGCACAGGGAATGTAGG - Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1156222947 18:35072108-35072130 AAGAACAGCACAGTAATATTTGG - Intronic
1156357056 18:36350975-36350997 AGGAAGAACACAGTGCTTCTTGG - Intronic
1159285042 18:66337554-66337576 GGGAAGAGCTCAGTGACTGTGGG - Intergenic
1159303815 18:66613836-66613858 AGGAAAAGTACAGTGATTGAAGG - Intergenic
1159508650 18:69367386-69367408 AGGAACAGCAAAGTGTGTCTGGG - Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1160411257 18:78676979-78677001 AGGAACATCACAGTGAACGGAGG + Intergenic
1161933879 19:7359075-7359097 AGGAACAGCACAGAGATACCAGG + Intronic
1164564191 19:29314443-29314465 AGGAACTGCAGAGGGATGGTTGG + Intergenic
1166623919 19:44332318-44332340 TGGGGCAGCACACTGATTGTGGG + Intronic
925338138 2:3113851-3113873 AGCAAGAGAACAGTGGTTGTGGG + Intergenic
925484838 2:4316526-4316548 AAGGACAGTACAGTAATTGTGGG - Intergenic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
925967256 2:9077517-9077539 AGGGACAGCAATGTGATTGATGG - Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
928293443 2:30060606-30060628 AGGGAAAACACAGTGATTCTGGG + Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928822678 2:35380897-35380919 ATTAACAACACAGGGATTGTGGG + Intergenic
929002316 2:37359757-37359779 TGGAACAACAGAGTGTTTGTAGG + Exonic
930072169 2:47375432-47375454 AAGAATAGCACAGAGATTCTGGG + Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
931139135 2:59438003-59438025 AACAACAGCACAGGGACTGTGGG - Intergenic
932101144 2:68900382-68900404 AAGGACAGCAAGGTGATTGTAGG + Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937369339 2:121286649-121286671 AGGAACAGCAGAGTGAGGGAGGG - Intergenic
937664964 2:124476426-124476448 AGTGACATCACAGTGTTTGTGGG + Intronic
939186492 2:138867115-138867137 AGAACCAGCACAGTTATTATGGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942564244 2:177250834-177250856 AGGAACAGCACAGGGAGGTTCGG - Intronic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943530528 2:189074640-189074662 AGGAACAGCATACCGTTTGTGGG - Intronic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944046046 2:195413426-195413448 AGGAAGAGCACAGCAATCGTGGG + Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944677071 2:202042502-202042524 ATGAAAAGCACAGTGTTTTTTGG - Intergenic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945010652 2:205459625-205459647 AGGAGCACAACAGTGACTGTAGG - Intronic
946786360 2:223248361-223248383 AGGAAAAGCAAATTGGTTGTGGG - Intergenic
946812330 2:223539127-223539149 AGGAACAGCCCACAGATTGATGG - Intergenic
947246938 2:228058969-228058991 GGGAACAGATCAGTGATTGCTGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
947594358 2:231401411-231401433 AGGATCAGCACAGTGGCTGAAGG + Intergenic
947870609 2:233435833-233435855 ACGCACAGCACAGCGCTTGTGGG - Exonic
948402613 2:237694525-237694547 AGGCACAGGAAAGTGGTTGTGGG + Intronic
948811694 2:240481698-240481720 TGGAACAGCAGAGTGAGTGCAGG + Intronic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1170722653 20:18897567-18897589 GGAAACAGCACAGTGAGTCTAGG + Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172450617 20:35020158-35020180 AGGACCAGCACATTGATGGTGGG - Intronic
1172838890 20:37890201-37890223 AGGAACAGCGCAGTGAATGTGGG + Intergenic
1173462502 20:43254536-43254558 GTGAAAAGCACAGTGCTTGTAGG - Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1174525478 20:51167331-51167353 AAGAACAGCTCAGTGAGTCTGGG + Intergenic
1175549412 20:59807351-59807373 AGGAAGATGACAGTGATTGATGG - Intronic
1176782146 21:13209817-13209839 AGAAACAGCTCTGTGTTTGTAGG - Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177692699 21:24531890-24531912 AGAGACAACACAGTAATTGTGGG + Intergenic
1180234468 21:46449255-46449277 ATGAACAGAACAGCGATTTTAGG - Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1181860844 22:25816958-25816980 AGCAACAGCACAGCTATTGTTGG + Intronic
1183458044 22:37933325-37933347 AGGAACCGCACAGACAGTGTAGG + Intronic
949962388 3:9323194-9323216 AGGGACAGCACAGGGAGTTTTGG + Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
954473363 3:50719371-50719393 AGCAAGAGCACAGTGATTATAGG + Intronic
954724626 3:52597101-52597123 AGTTAGAGCACAGTGATTGAGGG - Intronic
954877990 3:53815742-53815764 AGGGTCAGCACAGTCATGGTTGG + Exonic
956098303 3:65740588-65740610 AGGAAAATCCCAGTGATAGTGGG + Intronic
956416163 3:69032278-69032300 AGGAATAGCACAGAGATAGTTGG + Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957219061 3:77358905-77358927 AAGATGAGCACAGTCATTGTAGG + Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957954772 3:87172174-87172196 TGAAACAGCACAGAGAATGTTGG - Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
957976229 3:87448189-87448211 AGGAAGAGTAGAGTGATTTTGGG - Intergenic
957977087 3:87460578-87460600 AGGGACAGAAAAGTAATTGTAGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
959868991 3:111304871-111304893 AGGAAAAGCACAGTGCATCTAGG + Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
960840933 3:121957918-121957940 AGGGAAAGCACCGTAATTGTGGG + Intergenic
961764931 3:129202432-129202454 AGGCAGAGCACAGAGATTTTGGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963701282 3:148629986-148630008 AGGAAAAGCAAAGTGATTATGGG + Intergenic
964052482 3:152412765-152412787 AGGAAGACCACAGTTAGTGTTGG + Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964475271 3:157092271-157092293 AGGAAGAGCCCAGTGTTGGTCGG + Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
966769784 3:183493433-183493455 ATGTACAACACAGTCATTGTAGG - Intronic
967608831 3:191481054-191481076 AGGAAGAGCACAGTGATAAAGGG + Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
967807659 3:193729863-193729885 ACCAACAGGCCAGTGATTGTAGG + Intergenic
967865530 3:194187018-194187040 CGGAACAGCACTGAGATTGGTGG + Intergenic
968096043 3:195931515-195931537 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096053 3:195931577-195931599 AGGCAGAGCACAGTGATGATGGG + Intergenic
968096064 3:195931639-195931661 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096075 3:195931701-195931723 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096083 3:195931763-195931785 AGGCAGAGCACAGTGATGATAGG + Intergenic
968218459 3:196914930-196914952 AGGAAGAGCAAAATGATTGTGGG + Intronic
969197783 4:5576849-5576871 AGGCACAGGACAGTGATTTCAGG - Intronic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972928330 4:44040054-44040076 AGGAAGAGCATAGTGACTGGGGG + Intergenic
973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG + Intergenic
973169468 4:47121265-47121287 AAGAAAAGCACAGCAATTGTGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974594330 4:63996989-63997011 CTGAGCTGCACAGTGATTGTGGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976684166 4:87792512-87792534 AGGTACATTACAGTGAGTGTGGG + Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978733686 4:112061326-112061348 AGGGACAGCACAGTGATCATGGG + Intergenic
979111271 4:116761152-116761174 AGGGGAAGCACGGTGATTGTGGG + Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
981466316 4:145076317-145076339 AGGCTCAGCTCAGTGCTTGTGGG - Intronic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982911454 4:161148057-161148079 AGGAAGAGTACATTGACTGTAGG + Intergenic
983188648 4:164730158-164730180 TGGAACAGCAGAGTGGATGTTGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983568773 4:169182327-169182349 AGCAACTGCTCAGTGATTTTTGG - Intronic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
985187256 4:187331120-187331142 AGAAAAAGAACAATGATTGTGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986677052 5:10195156-10195178 AAGCACAGCTCAGTGATTGGTGG + Intergenic
987537289 5:19205968-19205990 AGGAAGAACACAGCGATTGCAGG + Intergenic
988249789 5:28741872-28741894 AAGAATAGCACAGTGATGATAGG - Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
988489456 5:31694098-31694120 AGGAACAAAACAGTGCTTGTAGG + Intronic
988777991 5:34494479-34494501 AGAAACAGCACAGTGATCCAGGG + Intergenic
989398118 5:40980364-40980386 AGAAACAGCATAGTCAATGTTGG - Intronic
990202965 5:53398311-53398333 AGGAAGACCATAGTGATTGTGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995613893 5:113940155-113940177 AATAACAGCACAGTCATTCTTGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
996906691 5:128608971-128608993 AAGAACAGCACAGTGACTGTGGG - Intronic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
998351632 5:141505652-141505674 AGGAACAGCAGAGGGGTTGGGGG + Intronic
998498517 5:142611928-142611950 AGGAACAGCACAGCACGTGTTGG - Intronic
999551743 5:152695080-152695102 AAGAACAGCAAAGGGATAGTGGG - Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1001904250 5:175458145-175458167 AGAAACAGAATAGTGGTTGTGGG + Intergenic
1004017088 6:11742013-11742035 GGGAAAAGCTAAGTGATTGTAGG - Intronic
1004017092 6:11742046-11742068 GGGAAAAGCTAAGTGATTGTAGG - Intronic
1008174388 6:48249421-48249443 TGGAACAGCACAGTGTTCTTAGG + Intergenic
1009197829 6:60708645-60708667 AGGAACAGTTTAGGGATTGTGGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011322935 6:86116723-86116745 AGGAACAGCACAAGGATTGTGGG - Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012180263 6:96144016-96144038 AGGAAGAGCACAGGGATTAAGGG - Intronic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013386843 6:109640283-109640305 TGGAAAAGCACAGTATTTGTGGG + Intronic
1013570344 6:111417487-111417509 AGGAACAGCACAGTGAGAGCGGG - Intronic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015890770 6:137967812-137967834 TGGGACAGCAGAGTGATGGTGGG - Intergenic
1015890787 6:137967882-137967904 TGGGACAGCAGAGTGATGGTGGG - Intergenic
1015890810 6:137967983-137968005 TGGGACAGCAGAGTGATCGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016859341 6:148701198-148701220 AGCATCAGCACACTGATTCTTGG + Intergenic
1019844638 7:3485433-3485455 AGGGAAAGCAAAGTGAGTGTGGG - Intronic
1020566169 7:9798487-9798509 ATGAATAGGACTGTGATTGTTGG - Intergenic
1020765137 7:12310446-12310468 AGGAACAGAGCAGTTCTTGTAGG - Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021884984 7:25129436-25129458 AGGGACAGGGCAGTGATTGCAGG - Intergenic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022749992 7:33214290-33214312 AGGGACAGCACAGTGACTTGAGG - Intronic
1022956209 7:35383799-35383821 GGGAACAGAACACTGATTTTTGG + Intergenic
1022996454 7:35760403-35760425 AGGAACAGAACAGAAATTGAAGG + Intergenic
1023469446 7:40498701-40498723 GGGAACAGCACAAGGATTGCAGG + Intronic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1024158610 7:46651500-46651522 ACGCACAGCACAGTGGTGGTGGG - Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024945193 7:54800916-54800938 AGAAATGGCACAGTGAGTGTGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1024981315 7:55159596-55159618 GTGAAGAGCACAGTGAGTGTGGG - Intronic
1026226047 7:68442052-68442074 ATAAACATTACAGTGATTGTAGG - Intergenic
1026271003 7:68836814-68836836 AAGAACAACACAGAAATTGTAGG + Intergenic
1027304066 7:76874035-76874057 AGGAAAAGTACAGAGATTGGAGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1027921286 7:84399125-84399147 AGGAAAAGCACGGTGAGTGTGGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1029652787 7:101905244-101905266 AGGAAAAGCACTATGATTTTAGG + Intronic
1030079118 7:105762277-105762299 AGGAAAAGAACAGGGATTGAAGG - Intronic
1030431723 7:109456350-109456372 AAGAACAGCACAGTGATTATCGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032331710 7:130986611-130986633 AGGAAATGCCCATTGATTGTTGG - Intergenic
1033252323 7:139771575-139771597 AGGAACTGCACGGCTATTGTAGG + Intronic
1033814120 7:145051648-145051670 AGAGAAAGCACGGTGATTGTGGG - Intergenic
1033839533 7:145357051-145357073 AGGAACAGAACATTGATGGTTGG + Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035355747 7:158275177-158275199 AGGGACAGCACCGTGGCTGTGGG + Intronic
1038429309 8:27486915-27486937 AAGAACAGCACAGTGACCGCAGG + Intergenic
1038863039 8:31408577-31408599 AGGAACTGCACAGCAACTGTGGG - Intergenic
1039727532 8:40235230-40235252 AGGCACAGAGCTGTGATTGTAGG - Intergenic
1039831056 8:41215353-41215375 GAGAACAGGTCAGTGATTGTGGG + Intergenic
1040699002 8:50038574-50038596 AGGAACAGCAAATTCATTGATGG - Intronic
1040929994 8:52723551-52723573 AGGGACAGAATAGTGACTGTTGG - Intronic
1041156893 8:54996724-54996746 AGGGCCAGCACAGTGGTAGTTGG + Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044616682 8:94149616-94149638 AGGAACAGCATGGTGAGTGTGGG + Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047352540 8:124089311-124089333 AGGAAGAACACAATAATTGTGGG - Intronic
1047874329 8:129118928-129118950 AGAAGCAGCCCAGTGATTGTGGG - Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1049879043 8:145049523-145049545 AGGGGCTGCACAGTAATTGTAGG - Intergenic
1050609688 9:7338637-7338659 AGGAACAGAAAATTGAATGTTGG - Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051593019 9:18795530-18795552 ATGAACAGAACAGGGATTTTTGG - Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052744124 9:32423099-32423121 AGGAACAGCACATTCATTAATGG + Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054978084 9:71171666-71171688 AGGAAAAGCACAGGGTGTGTTGG + Intronic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056254005 9:84779661-84779683 AAGAACATCACAGTAGTTGTGGG + Intronic
1057317046 9:93976185-93976207 AGGAACAAAGCAGTGATTCTGGG - Intergenic
1058086284 9:100752028-100752050 AGGGGTTGCACAGTGATTGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059795055 9:117685406-117685428 AAGAACAGCACGGTGACTCTTGG - Intergenic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060564176 9:124575043-124575065 AGGAACATCACAGTGACTCAAGG - Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185927162 X:4160384-4160406 AGGTGCATCACAGTGATTCTGGG - Intergenic
1186036967 X:5434015-5434037 ATGAACAGCACAGTTGTTTTTGG - Intergenic
1186382356 X:9074200-9074222 AGGCAAAGCACAGTGACAGTGGG - Intronic
1186434820 X:9533659-9533681 AAGAAAGGCACAGTGATGGTGGG + Intronic
1186853740 X:13605771-13605793 AGGAACAACACACCTATTGTTGG + Intronic
1187132591 X:16517163-16517185 AGAGACAGCCCAATGATTGTGGG + Intergenic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1188071920 X:25727688-25727710 AGAGACAGCATAGTGATTATGGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188902850 X:35755999-35756021 AGGAAAAGCCCAGGGATAGTTGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192958903 X:76104971-76104993 GGAGACAGCACAGTGATTATGGG - Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193931694 X:87561371-87561393 GGGGAAAGCAAAGTGATTGTAGG + Intronic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196117077 X:112009534-112009556 AGGAACAGTACAGTTATCATTGG - Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196290125 X:113930070-113930092 GGGGACAGCAAAGTGAGTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197053802 X:122093477-122093499 GGGAAGAGCACAGCGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198697362 X:139355765-139355787 GAGAAAAGCACAGTGATTGTGGG - Intergenic
1199172147 X:144744645-144744667 CCGAACTGCACAGTGATCGTGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic
1201760901 Y:17537086-17537108 AGGAAGAGCACAATGACTGAAGG - Intergenic
1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG + Intergenic