ID: 952816529

View in Genome Browser
Species Human (GRCh38)
Location 3:37452226-37452248
Sequence CGGGCGTCGGGCCCGCCACC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952816529_952816540 15 Left 952816529 3:37452226-37452248 CCCGGTGGCGGGCCCGACGCCCG 0: 1
1: 0
2: 0
3: 16
4: 92
Right 952816540 3:37452264-37452286 CAGGCGCAGAGCTCCCGCCCCGG 0: 1
1: 0
2: 0
3: 29
4: 220
952816529_952816541 16 Left 952816529 3:37452226-37452248 CCCGGTGGCGGGCCCGACGCCCG 0: 1
1: 0
2: 0
3: 16
4: 92
Right 952816541 3:37452265-37452287 AGGCGCAGAGCTCCCGCCCCGGG 0: 1
1: 0
2: 3
3: 16
4: 172
952816529_952816543 27 Left 952816529 3:37452226-37452248 CCCGGTGGCGGGCCCGACGCCCG 0: 1
1: 0
2: 0
3: 16
4: 92
Right 952816543 3:37452276-37452298 TCCCGCCCCGGGGAGCTTCCTGG 0: 1
1: 1
2: 0
3: 14
4: 160
952816529_952816534 -4 Left 952816529 3:37452226-37452248 CCCGGTGGCGGGCCCGACGCCCG 0: 1
1: 0
2: 0
3: 16
4: 92
Right 952816534 3:37452245-37452267 CCCGCATTCCGCCCGTGTCCAGG 0: 1
1: 0
2: 0
3: 0
4: 41
952816529_952816542 17 Left 952816529 3:37452226-37452248 CCCGGTGGCGGGCCCGACGCCCG 0: 1
1: 0
2: 0
3: 16
4: 92
Right 952816542 3:37452266-37452288 GGCGCAGAGCTCCCGCCCCGGGG 0: 1
1: 0
2: 0
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952816529 Original CRISPR CGGGCGTCGGGCCCGCCACC GGG (reversed) Exonic
901238531 1:7680143-7680165 CGGGCCTCTGGCCAGCCACGGGG + Intronic
905867046 1:41382191-41382213 CGGGCCGCGGGCCCGCGCCCAGG + Exonic
910935911 1:92484590-92484612 CGGGGGTCGGGCCCGGGCCCGGG + Intronic
911115034 1:94237675-94237697 CGGTCGCCGGCCCCGCCCCCGGG - Intronic
913047856 1:115089302-115089324 CCGGCCCCGCGCCCGCCACCCGG + Intronic
918228632 1:182509528-182509550 GGGGCGTCAGCCCCCCCACCCGG - Intronic
1064443133 10:15371155-15371177 CGGGCGGCGGGCCCGGCGCGCGG - Intergenic
1065177772 10:23095685-23095707 GCGGCGGCGGGCCCGGCACCGGG + Exonic
1066976935 10:42377736-42377758 CGGGCGCCAGGCCCGAAACCAGG - Intergenic
1077103181 11:831071-831093 CGCCCGTCGGCCCCGCCCCCGGG - Intronic
1083682806 11:64359106-64359128 CGGGCGCCGGCACCGCCTCCCGG - Intergenic
1083684558 11:64368649-64368671 CGCGCTTCGGCCCCGCCCCCGGG - Intronic
1083755973 11:64791927-64791949 CGGGCGTCAGGCCAGCCTCCAGG + Exonic
1087306848 11:96499305-96499327 CTGGCCCCGGGCCCGCCTCCAGG + Intronic
1089183178 11:116596787-116596809 CGGGCTTGGGGCTCCCCACCAGG + Intergenic
1090699171 11:129279214-129279236 AGGGCGTCGGGCCCGGCCCGCGG - Intronic
1090868165 11:130720461-130720483 TGGGCTGCGGGCCCTCCACCCGG + Intergenic
1092659477 12:10722967-10722989 CGGGCGCCGGGGCCGCGGCCTGG + Exonic
1095810848 12:46372321-46372343 CGGGTGTCGCGCCCGCGACGTGG - Intronic
1096695415 12:53345394-53345416 GGGGCTTCGGGCCAGCCAGCAGG - Intergenic
1107467834 13:40665901-40665923 CGGCCGCCGCGGCCGCCACCGGG - Exonic
1118319139 14:64743128-64743150 CGGGCGGAGGGCCGGCCCCCAGG - Exonic
1122506189 14:102233305-102233327 CAGGCGTCGGTCCCGCCAGCAGG + Intronic
1123012257 14:105355200-105355222 CCTGCGTCGGGCTGGCCACCTGG + Intronic
1123048216 14:105528490-105528512 CGGGCCTCGTTCCCGCCGCCAGG - Intronic
1124623779 15:31296784-31296806 CGGGCATCTGGCCTGCCACCAGG + Intergenic
1125079304 15:35656366-35656388 GGGGGGTCAGGCCCCCCACCCGG + Intergenic
1128496113 15:68199577-68199599 CTGGCGTCGGGCTGGCCCCCAGG + Exonic
1131367697 15:91853834-91853856 CGGGTGTCGGGGCCGCTGCCGGG - Exonic
1132931252 16:2460221-2460243 CGGGCCTCGGGCCCCGCGCCTGG - Intronic
1132934968 16:2475430-2475452 CGGGCCGCGGGCCAGCGACCGGG - Intronic
1133212540 16:4271639-4271661 CGGACCTCGGGCCACCCACCCGG + Intronic
1133286740 16:4694232-4694254 CGGGCGGCGGCCCCACCTCCAGG - Exonic
1134849828 16:17470755-17470777 CGAGCGCCGGGCCAGCCTCCGGG + Exonic
1139597934 16:67968803-67968825 CAGGAATCGGGCCCGCCCCCAGG - Intronic
1140051329 16:71484207-71484229 GGGGCGTGGGCCCCGCCCCCAGG - Intronic
1140478658 16:75251230-75251252 CGGGCGCGGGGGCCGCCAGCCGG - Intronic
1142395430 16:89828835-89828857 GGGGCGTCCGTCCCGCCCCCTGG + Intronic
1144109976 17:12021385-12021407 GGGGCGTCGGGCCTGCCCCCTGG + Intronic
1146400217 17:32495553-32495575 CGGGCGTCCGGCCGGGCTCCAGG + Intronic
1152644816 17:81463870-81463892 CTGGCGTCGGCCAAGCCACCGGG + Exonic
1152708798 17:81860120-81860142 CGGGCATCGGGACGGCCCCCCGG + Intronic
1153854848 18:9136226-9136248 CGGCCGTCTGGCCCCGCACCAGG - Intronic
1157419331 18:47531957-47531979 TGGGCGTCGGGGCAGCCCCCTGG + Intergenic
1160861126 19:1237608-1237630 CGGGCCTTGCGCCCCCCACCCGG - Intronic
1160864173 19:1249820-1249842 GGGGCGGCGGCCCCGCCCCCTGG + Intronic
925308680 2:2866686-2866708 AGTGCGTTGGGGCCGCCACCTGG - Intergenic
927591280 2:24360235-24360257 CGGGCGCCGCGCCCGCTGCCCGG - Intronic
929966994 2:46543314-46543336 CGGGGGTGGGGCCGGCCGCCTGG - Intronic
931719310 2:65055920-65055942 CGGGCCTCGGTCGCGCCGCCGGG + Intergenic
932607820 2:73176297-73176319 GGGGCGGCGGGCACGACACCCGG + Intergenic
933666832 2:84971204-84971226 GCGGCGTCGGACCCGCCTCCTGG + Exonic
946327669 2:218993143-218993165 CGGGCGCCGGGCCCGGCGCGGGG + Exonic
1168756870 20:324529-324551 CGCGCCTCGTGCCGGCCACCCGG + Intergenic
1171010907 20:21508984-21509006 CGGGCGCCGGGTCCACCTCCCGG + Intergenic
1172474471 20:35226716-35226738 CGGGCGCGGGCCCCGCCGCCGGG + Exonic
1173552873 20:43945688-43945710 CTGGCGTGGAGACCGCCACCAGG + Intronic
1175349520 20:58308878-58308900 CGGGCGGGGGGTCCGCCACCTGG - Intergenic
1175955667 20:62607886-62607908 CGGGGGTCGGGCCCGTGACCCGG + Intergenic
1176005649 20:62861138-62861160 CGGGCCTCGGGCGCGCCGTCGGG + Exonic
1176550078 21:8217162-8217184 CGGGCGTCGCGGCCGCCCCCGGG + Intergenic
1176555762 21:8253417-8253439 CGGACGTCGGGGCCGCCCCGCGG + Intergenic
1176569005 21:8400197-8400219 CGGGCGTCGCGGCCGCCCCCGGG + Intergenic
1176574699 21:8436451-8436473 CGGACGTCGGGGCCGCCCCGCGG + Intergenic
1176576919 21:8444432-8444454 CGGGCGTCGCGGCCGCCCCCGGG + Intergenic
1176611280 21:8987643-8987665 CGGGCCCCGGGCCCTCGACCGGG + Intergenic
1176611313 21:8987744-8987766 CGGACGTCGGGGCCGCCCCGCGG + Intergenic
1180046890 21:45310707-45310729 CGGGAGACAGACCCGCCACCTGG + Intergenic
1183969962 22:41469302-41469324 CGGGTGCCGGGCCCACAACCGGG - Intronic
1185339891 22:50286529-50286551 CGGGTGTCGGGCGCAGCACCGGG + Intronic
1203252714 22_KI270733v1_random:125401-125423 CGGGCCCCGGGCCCTCGACCGGG + Intergenic
1203252747 22_KI270733v1_random:125502-125524 CGGACGTCGGGGCCGCCCCGCGG + Intergenic
1203254968 22_KI270733v1_random:133488-133510 CGGGCGTCGCGGCCGCCCCCGGG + Intergenic
1203260803 22_KI270733v1_random:170588-170610 CGGACGTCGGGGCCGCCCCGCGG + Intergenic
1203263024 22_KI270733v1_random:178567-178589 CGGGCGTCGCGGCCGCCCCCGGG + Intergenic
950544074 3:13628695-13628717 AGGGCGTAGGGCCAGCCATCAGG + Intronic
952816529 3:37452226-37452248 CGGGCGTCGGGCCCGCCACCGGG - Exonic
959711849 3:109393536-109393558 CCGGCGTCAGGCCCGAAACCAGG + Intergenic
961820375 3:129572771-129572793 TGGGCCTCGGGCCAGCCCCCGGG + Intronic
967981765 3:195070050-195070072 CGGGGGGCGGGCCCCCAACCCGG + Exonic
973281399 4:48363784-48363806 CGGGGGTCAGCCCCCCCACCCGG - Intronic
978646980 4:110945746-110945768 CAGCCATCGTGCCCGCCACCTGG - Intergenic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
997470668 5:134115257-134115279 CGGGGGTCGGGGCCGACGCCGGG - Intronic
1002051229 5:176572729-176572751 CTGGCATGGGGCCCCCCACCTGG - Intronic
1002925195 6:1601855-1601877 CCGGGGTCCGGCCCGCCACAGGG - Intergenic
1012465850 6:99515508-99515530 CGGGCCCCGGGCGCGCCGCCTGG - Intronic
1019577500 7:1744529-1744551 CTGGCGCCTGGCCCCCCACCTGG + Exonic
1020065222 7:5183210-5183232 TGGGCATCGGGCCGGTCACCTGG + Intergenic
1023966383 7:44965071-44965093 CAGCTGCCGGGCCCGCCACCTGG + Exonic
1029159393 7:98540977-98540999 CGGGAGGCAGGCCCGCCTCCTGG + Intergenic
1029169103 7:98618126-98618148 CGCGCGTCGGGACTGCCAGCGGG + Intronic
1035167410 7:156999980-157000002 CCGGCCCCGGGCCCGCCCCCCGG - Intronic
1035619666 8:1027879-1027901 CGGGCGCCTGGCACCCCACCTGG - Intergenic
1035619820 8:1028479-1028501 CGGGCGCCTGGCACCCCACCTGG - Intergenic
1037819876 8:22130464-22130486 CGGTCGTCGTGGCCGGCACCGGG + Exonic
1040496804 8:47972905-47972927 CAGGCGTCTGGCTCACCACCTGG + Exonic
1049021145 8:139958434-139958456 CGGGGGTGGGGGCAGCCACCTGG - Intronic
1049211137 8:141386959-141386981 CGGGCCTCAGGCACGCCACACGG - Intergenic
1049554705 8:143276046-143276068 CGGCCGGCGGGCCAGCCGCCTGG + Exonic
1049767200 8:144360407-144360429 CGGGCGTCTGGCCTACCACCTGG + Exonic
1062191248 9:135248988-135249010 AGGGCCTCGGGCACCCCACCAGG + Intergenic
1062592113 9:137278828-137278850 CCGACGTCGGGCCCCCCACCCGG - Exonic
1203469150 Un_GL000220v1:108653-108675 CGGACGTCGGGGCCGCCCCGCGG + Intergenic
1203471370 Un_GL000220v1:116634-116656 CGGGCGTCGCGGCCGCCCCCGGG + Intergenic
1203476971 Un_GL000220v1:152625-152647 CGGACGTCGGGGCCGCCCCGCGG + Intergenic
1203479191 Un_GL000220v1:160606-160628 CGGGCGTCGCGGCCGCCCCCGGG + Intergenic
1190776838 X:53559447-53559469 CCGGGGTCGGGCCCGCCTCCTGG - Exonic
1200065343 X:153502029-153502051 AGGGAATCGGGCCCTCCACCAGG - Intronic