ID: 952816968

View in Genome Browser
Species Human (GRCh38)
Location 3:37454047-37454069
Sequence TGGTGCCTAGTGTGGGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 167}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952816968_952816982 27 Left 952816968 3:37454047-37454069 CCAGATCCCCACACTAGGCACCA 0: 1
1: 0
2: 0
3: 15
4: 167
Right 952816982 3:37454097-37454119 GGAGGGCTGCTGTGGACAGCGGG 0: 2
1: 0
2: 8
3: 49
4: 489
952816968_952816977 6 Left 952816968 3:37454047-37454069 CCAGATCCCCACACTAGGCACCA 0: 1
1: 0
2: 0
3: 15
4: 167
Right 952816977 3:37454076-37454098 CGGGAAGCACTGTCAAAAATGGG 0: 1
1: 0
2: 0
3: 6
4: 76
952816968_952816976 5 Left 952816968 3:37454047-37454069 CCAGATCCCCACACTAGGCACCA 0: 1
1: 0
2: 0
3: 15
4: 167
Right 952816976 3:37454075-37454097 GCGGGAAGCACTGTCAAAAATGG 0: 1
1: 0
2: 3
3: 9
4: 87
952816968_952816980 19 Left 952816968 3:37454047-37454069 CCAGATCCCCACACTAGGCACCA 0: 1
1: 0
2: 0
3: 15
4: 167
Right 952816980 3:37454089-37454111 CAAAAATGGGAGGGCTGCTGTGG 0: 1
1: 1
2: 1
3: 28
4: 305
952816968_952816981 26 Left 952816968 3:37454047-37454069 CCAGATCCCCACACTAGGCACCA 0: 1
1: 0
2: 0
3: 15
4: 167
Right 952816981 3:37454096-37454118 GGGAGGGCTGCTGTGGACAGCGG 0: 1
1: 1
2: 5
3: 66
4: 628
952816968_952816979 10 Left 952816968 3:37454047-37454069 CCAGATCCCCACACTAGGCACCA 0: 1
1: 0
2: 0
3: 15
4: 167
Right 952816979 3:37454080-37454102 AAGCACTGTCAAAAATGGGAGGG 0: 1
1: 0
2: 2
3: 40
4: 358
952816968_952816978 9 Left 952816968 3:37454047-37454069 CCAGATCCCCACACTAGGCACCA 0: 1
1: 0
2: 0
3: 15
4: 167
Right 952816978 3:37454079-37454101 GAAGCACTGTCAAAAATGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952816968 Original CRISPR TGGTGCCTAGTGTGGGGATC TGG (reversed) Intronic
900148579 1:1168650-1168672 TGGGGCCTTGTGTGGGGGTGCGG - Intergenic
900174829 1:1287041-1287063 TGGTACCTCGAGTGGGGAGCGGG + Intronic
900655478 1:3754769-3754791 TGGTGTCTTGTGTGGGGACATGG - Intronic
900692142 1:3987347-3987369 GGGTGCCTCGTGTGGGGGTAAGG + Intergenic
900987952 1:6083974-6083996 TGGTCCCTGATTTGGGGATCAGG - Intronic
902163647 1:14552399-14552421 TGGTACGGAGGGTGGGGATCTGG - Intergenic
903687603 1:25143365-25143387 GGCAGGCTAGTGTGGGGATCTGG - Intergenic
904091833 1:27950281-27950303 TGGTGCCTGCTGTTGGGGTCAGG - Intronic
904747561 1:32720422-32720444 TGGGGCTTAGTGAGGGGATGGGG + Intergenic
905769659 1:40629283-40629305 TGGAGCCTGGTTTGGGGGTCAGG + Exonic
906523241 1:46479426-46479448 TGGAGCCTGGGGTGGGGAACTGG + Intergenic
911101620 1:94100152-94100174 CTGTGCCTCGTGTGGGGACCAGG - Intronic
911812923 1:102307315-102307337 TGGGGCCTGTTGTGGGGGTCGGG - Intergenic
912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG + Intronic
915910993 1:159915386-159915408 TGGTGCCTAGTCTGGGCCCCAGG + Intergenic
917265424 1:173216183-173216205 TGATGCCTAGGGTGGGGATGGGG - Intergenic
917918658 1:179730317-179730339 TGCTTCCTTGGGTGGGGATCGGG - Intergenic
918434020 1:184492361-184492383 TTGTCCATAGTGTGGGGAGCAGG - Intronic
918459181 1:184757752-184757774 TGGTCCCTGGTATGGTGATCTGG - Intergenic
919728680 1:200899647-200899669 TGGAGCCACGTGTGGGGATGCGG + Intronic
919829697 1:201531730-201531752 TGGTGCCCAGGGAGGGGGTCAGG + Intergenic
920099598 1:203508594-203508616 TGGTGTCTAGTGTGGGGGAGAGG - Intronic
920195135 1:204221797-204221819 AGATGCTTGGTGTGGGGATCTGG - Exonic
921257113 1:213352458-213352480 TGGTGGCAAGACTGGGGATCTGG + Intergenic
921838817 1:219806770-219806792 TGGTGACTAGTTTGGGGAAAAGG + Intronic
923427818 1:233889971-233889993 TTTAGCCTAGTGTGGGAATCAGG + Intergenic
923964438 1:239121517-239121539 TGGGGCCTGTTGTGGGGTTCAGG + Intergenic
924855855 1:247874425-247874447 TGGGGCCTAGTGGGGGGTGCTGG - Intronic
1064928193 10:20593661-20593683 TGGTGCTGAGTGTGGGGAGTGGG - Intergenic
1067475212 10:46560450-46560472 TGGTTCCTCCTGTTGGGATCTGG - Intergenic
1068822053 10:61388694-61388716 TGGTGTCTAGTGAGGGGAAACGG - Intergenic
1069875793 10:71562143-71562165 TGGTGTCTGGGGTGGGGTTCGGG - Intronic
1072748749 10:97960900-97960922 TAGGACATAGTGTGGGGATCAGG - Intronic
1072852447 10:98910220-98910242 TGGTGCCCAGGGTGGAGATAAGG + Intronic
1075639804 10:124056527-124056549 TGGTGCCAAGTGTGGGGACAGGG + Intronic
1076354523 10:129842206-129842228 TGTTGCCCAGGGTGGGGATCTGG + Exonic
1077082168 11:729024-729046 TGGGGCCTAGGGCTGGGATCTGG - Intergenic
1077649694 11:3959013-3959035 TGGGGCCTAGAATGGGGATGAGG - Intronic
1078675220 11:13405746-13405768 TAGTGCCCAGAGTGGGGAACGGG - Exonic
1079444203 11:20545172-20545194 TGGAGCTTACCGTGGGGATCAGG + Intergenic
1079815620 11:25053572-25053594 TGAGGCTTAGTGTGGGGATGAGG - Intronic
1081051004 11:38341606-38341628 TGGGGCCTATTGTGGGGTTGGGG - Intergenic
1083470245 11:62879561-62879583 TTGTTCCTAGGGTGGGGATGGGG + Intronic
1084105194 11:66976245-66976267 TGGTGCCCAGTGTGGGCTACGGG - Exonic
1084462203 11:69302341-69302363 TGGTGACTTGTGTGGGCACCTGG + Intronic
1085469877 11:76750896-76750918 TGGTGCCCAGCCTGGGGATAGGG + Intergenic
1085493628 11:76946531-76946553 TGGTGCCTAGGGTGGGGACTAGG + Intronic
1087025085 11:93641771-93641793 TGGTGCTTAGAGTTTGGATCAGG - Intergenic
1089677869 11:120102323-120102345 TGGTCCCTGGAGAGGGGATCTGG - Intergenic
1090578386 11:128133244-128133266 GGGAGCCTAGAGTGGGGCTCTGG - Intergenic
1090946469 11:131433950-131433972 CGGTGCCTATTGTGGGGTTGGGG - Intronic
1091900912 12:4143168-4143190 TGGTGCCAAGGGTGGGGCTCAGG - Intergenic
1092911977 12:13153537-13153559 TGATGCCTTATGTGGAGATCTGG + Intergenic
1093121282 12:15274491-15274513 TGGTGTGTGGTGTGGGCATCTGG - Intronic
1096621029 12:52865634-52865656 TGGTGCCTGATGTGGGGATAAGG + Intergenic
1099066247 12:77983528-77983550 TGGTGACTAGTATGTGGCTCCGG + Intronic
1099501636 12:83420515-83420537 TGGTGCCTGTTGTGGGGTTGGGG - Intergenic
1102591027 12:113956925-113956947 TGGTGCCTAGTGTGTAGCGCAGG + Intronic
1103248195 12:119476586-119476608 TGGGGCTTAGTGTGGGGAATGGG - Intronic
1105667908 13:22580657-22580679 TGGGGCCTGTTGTGGGGATGGGG + Intergenic
1108437985 13:50420233-50420255 TGTTGCCTTGAGGGGGGATCTGG + Intronic
1108497897 13:51043208-51043230 TGGGGCCTGTTGTGGGGGTCGGG - Intergenic
1120090695 14:80329726-80329748 TGGGGCCTAGTGTGGGGTGGGGG + Intronic
1125196811 15:37056797-37056819 TTGTGCCCAGGGTGGGGGTCAGG - Intronic
1125495479 15:40189053-40189075 TGGTTGCTAGGGTGGGGATTGGG - Intronic
1127711552 15:61604144-61604166 AGGTGCCTACTGTGTGTATCAGG - Intergenic
1129677455 15:77639892-77639914 GGGTTCAAAGTGTGGGGATCAGG - Intronic
1131218553 15:90561008-90561030 CAGTCCCTAGAGTGGGGATCTGG + Intronic
1132196563 15:99918300-99918322 TGGTGCCCAGGGTGGGGGTAGGG - Intergenic
1134309278 16:13061001-13061023 TGGTGCATGGTATGGGGATCGGG + Intronic
1134400761 16:13907712-13907734 TGGTGCCTTTGGTGGGGATGAGG - Intergenic
1135063411 16:19289941-19289963 TGGGGCCTAGTATGGGGACTGGG + Intronic
1135415557 16:22265898-22265920 TGGTGCCTTATATGGGGAGCTGG + Intronic
1136171809 16:28494515-28494537 TGGGGGCTACTGTGGGCATCAGG + Intronic
1136545929 16:30954718-30954740 TGGTGCATAGCGTGGGGCTAGGG - Exonic
1137248041 16:46721371-46721393 TGGTGTAGAGTGTGGGGAACTGG + Intronic
1137479526 16:48840188-48840210 TGGTGCATGGTCTGGGGCTCTGG - Intergenic
1138158422 16:54728749-54728771 TGGTCCCTATGGTGGGGATGAGG + Intergenic
1139674388 16:68513079-68513101 TGGTGGCTAGTTTGGGGAAGAGG + Intergenic
1142233547 16:88910908-88910930 CTGTGCCAAGTGTGGGGATCTGG + Intronic
1146891835 17:36511353-36511375 TGATGCCAAGTGTGAGGGTCAGG - Exonic
1147914513 17:43878570-43878592 AGGTGCCCAGAATGGGGATCAGG + Intronic
1147946596 17:44083805-44083827 TGCTGCCTTGTGGGGGCATCGGG - Exonic
1149258972 17:54858520-54858542 TGGAGCACAGTGTGGAGATCTGG + Intergenic
1151084524 17:71365145-71365167 AGGTGCCTACTGTGGGAATGTGG + Intergenic
1151170174 17:72239150-72239172 GGGTGCCTAGTGTAGAGAACTGG - Intergenic
1151697914 17:75727504-75727526 AGGTGCCTGGTGTGGGGACTGGG + Exonic
1152318301 17:79593745-79593767 TGGTGCCCAGTGTGCCCATCGGG - Intergenic
1152819355 17:82428671-82428693 TGGTGCCAGGTGTGGGGTCCAGG + Intronic
1157086544 18:44586169-44586191 TGGTGGTTAGTGTGGGGACCTGG + Intergenic
1158373977 18:56842082-56842104 TGATGACTAGCGTGGGGGTCAGG - Intronic
1160148568 18:76383452-76383474 AGGTGCCTGGTGTGGGGAAGAGG - Intronic
1160761762 19:789043-789065 TGGGGCCTCGTGTGGTGATGGGG - Intergenic
1161041187 19:2111509-2111531 GGGTGCCTAATGTGGGGCTGCGG + Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1163472241 19:17504438-17504460 AGGTGCCTATAGTGGGGATGGGG - Exonic
1163786029 19:19275385-19275407 AGGTGCCAAGTGTGGGGACCAGG - Intergenic
1166791317 19:45400345-45400367 TGGTGGCTAGCATGGGGATAGGG - Intronic
928023564 2:27722132-27722154 TGGGTCCTTGTGTGGGGCTCAGG + Intergenic
931061447 2:58533993-58534015 TGGTGAGTAGCGTGGAGATCAGG + Intergenic
932472096 2:71966342-71966364 TGGTCTCTAGTGGGGGGATCAGG - Intergenic
932666468 2:73702429-73702451 TGTTGCCAAGTGTGGGGACTCGG - Intergenic
946890958 2:224276105-224276127 TGGGGCCTGTTGTGGGGATGTGG - Intergenic
1172304049 20:33869095-33869117 TGGTGCCAAGGGTGGGGGACTGG + Intergenic
1172785783 20:37467717-37467739 TGGTGTGTAGTGTGTGGCTCAGG - Intergenic
1173252848 20:41373808-41373830 TGGTGGCTAATCTGGGGCTCTGG + Intergenic
1179908294 21:44435337-44435359 TGGTGCCTACTGGGGGGATGCGG + Intronic
1180138140 21:45874760-45874782 TGCTGGCTGGTGTGGGGATGTGG + Intronic
1181404524 22:22673269-22673291 TGATGCAGAGTGTGGGGCTCTGG + Intergenic
1183134713 22:35875555-35875577 TGGTGCATAGTTTGGGGAGTGGG - Intronic
1183211443 22:36453919-36453941 GGATGCCTGGAGTGGGGATCTGG + Intergenic
1183275512 22:36894683-36894705 TGGTGTCTTGTGTGGGGGCCAGG - Intergenic
949473720 3:4422324-4422346 TGGTGCTTAGTGTTGGGGACAGG - Intronic
949564507 3:5232366-5232388 TGGTGGGCAGTGTGGGGATGGGG + Intergenic
949753596 3:7383067-7383089 TGGGGGCTAGAGTGTGGATCTGG - Intronic
951325459 3:21297178-21297200 TGGTTCCTTGTGTGGGGATGGGG - Intergenic
952816968 3:37454047-37454069 TGGTGCCTAGTGTGGGGATCTGG - Intronic
953064464 3:39456326-39456348 TGCTGCCTGGTGCGGGGATGGGG - Intergenic
954801946 3:53192312-53192334 TGGTGCTTATCGTGGGGAGCGGG - Exonic
955641060 3:61084824-61084846 TGCTGCCTGGTGTGGGGAGTGGG - Intronic
959079574 3:101785721-101785743 GGGAGCCGAGTCTGGGGATCTGG + Intronic
960730912 3:120725785-120725807 TGGGGCCTATTGTGGGGAGGAGG + Intronic
960733099 3:120747400-120747422 TGGGGCCTATTGTGGGGAGGAGG - Intronic
962349277 3:134644858-134644880 GGCTGACTAGTGTGGGGCTCAGG - Intronic
966541660 3:181098166-181098188 TGGAGCCTTTTGTGGGTATCAGG - Intergenic
966572395 3:181459972-181459994 TGGTGCCTAGTGTCAGTGTCAGG - Intergenic
966749541 3:183309069-183309091 TGCTGACTTGTGTGCGGATCTGG + Intronic
970584550 4:17502624-17502646 TGGTGCTTTGTGAGGTGATCAGG - Intronic
974592814 4:63976030-63976052 TGCAGCTTAGTGTGGGGAACTGG - Intergenic
976691514 4:87872618-87872640 TGAAGCCTGGTGTGGGGATATGG - Intergenic
979931037 4:126630935-126630957 TTGTGACTAGTGTGTGCATCGGG - Intergenic
985812195 5:2098369-2098391 TGGTGCCAGGTGAGGGGACCAGG + Intergenic
985977508 5:3432334-3432356 TCTTGTCTAGTGTGGGGTTCAGG + Intergenic
986971375 5:13340981-13341003 TGGGGCCTATTGTGGGGTTCAGG - Intergenic
989801760 5:45550484-45550506 CGGTGCCTATTGTGGGGTTGGGG + Intronic
990238477 5:53793382-53793404 TGTTGCCTAGTGTCAGGATAGGG + Intergenic
992012622 5:72544367-72544389 TGGGGCCTGTTGTGGGGTTCGGG - Intergenic
994956655 5:106541628-106541650 TGGTGCCTTGTGTCTGTATCTGG + Intergenic
996014798 5:118521122-118521144 TCGAGCTTAGTGTGGGAATCAGG - Intergenic
997353682 5:133248728-133248750 TGCAGCCTAGTGTGGCCATCAGG - Intronic
997381219 5:133439848-133439870 TGGTGCCAGGTGTGGGGAAGAGG - Intronic
997599164 5:135127613-135127635 TGGTGACTTGTGTGGGGATGAGG + Intronic
1005984717 6:30864169-30864191 TGGCCCCTAGTGTGGGCAGCAGG + Intergenic
1006312082 6:33268041-33268063 AGCGGCCTAGTGTGGGCATCTGG - Intronic
1010034797 6:71312334-71312356 TGGTTTCCAGTTTGGGGATCAGG - Intergenic
1010620827 6:78071922-78071944 TGGGGCCTGTTGTGGGGTTCGGG + Intergenic
1015231548 6:130920854-130920876 TGTTGGCTAGATTGGGGATCAGG - Intronic
1019492273 7:1321118-1321140 TGGGGCCGAGTGGGGGGACCTGG + Intergenic
1019783221 7:2957142-2957164 TGGAGCCTAGCCTGGGGGTCTGG - Intronic
1021882202 7:25105933-25105955 GGGAGGCTAGTTTGGGGATCTGG + Intergenic
1024754864 7:52518019-52518041 TAGAGCCTAGTTTGGGGATGGGG - Intergenic
1024816955 7:53282553-53282575 TGGGGCCTATTGTGGGGTTGGGG - Intergenic
1028320189 7:89450170-89450192 TGGGGCCTGTTGTGGGGAGCAGG + Intergenic
1028832874 7:95345442-95345464 TGGTGCCTACTCTGGGGGTGGGG + Intergenic
1028962782 7:96768576-96768598 TTGTTCATAGTTTGGGGATCAGG - Intergenic
1029852762 7:103481924-103481946 AGGAGGCTAGTGTGGGGACCAGG + Intronic
1030832939 7:114249367-114249389 TGGGGCCTACTGGGGGGAACGGG - Intronic
1032430260 7:131855310-131855332 TGGTGGGGAGTGTGGGGACCAGG - Intergenic
1032519390 7:132532254-132532276 TAGAGCCTAGTTTGGGGGTCAGG + Intronic
1035035536 7:155891789-155891811 TGGTGGCTGTTGTGGGGATGGGG + Intergenic
1035756600 8:2037438-2037460 TGGTGCTTAGGATGGGGATACGG - Intergenic
1057041296 9:91849489-91849511 TGTGGCCTAGGGTGGGAATCAGG - Intronic
1062057474 9:134475986-134476008 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057479 9:134476006-134476028 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057492 9:134476066-134476088 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057497 9:134476086-134476108 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057502 9:134476106-134476128 TGGCGCCTAGAGTGAGGAACTGG - Intergenic
1062057505 9:134476126-134476148 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057510 9:134476146-134476168 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057515 9:134476166-134476188 TGGCGCCTAGAGTGAGGAACTGG - Intergenic
1062057518 9:134476186-134476208 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057527 9:134476226-134476248 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057540 9:134476286-134476308 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057545 9:134476306-134476328 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057550 9:134476326-134476348 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057559 9:134476366-134476388 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057573 9:134476446-134476468 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1186647850 X:11526185-11526207 TGGTGACTACTGTGGGCACCTGG + Intronic
1192032479 X:67528895-67528917 TGGTGCCTGTTGTGGGGGTTGGG + Intergenic
1192139104 X:68632461-68632483 TGGTGCCTCATGTAGGGAGCTGG - Intergenic
1195160458 X:102165815-102165837 TGGTGGATAGCATGGGGATCTGG - Intergenic
1198271374 X:135059255-135059277 TGGTGCCTGATGTGGGGCTAGGG + Intergenic
1199931433 X:152527071-152527093 TGGAGCCTGGTGTGGGAATAGGG - Intergenic