ID: 952819474

View in Genome Browser
Species Human (GRCh38)
Location 3:37473467-37473489
Sequence TTCCCACAGCACCCCCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 1, 2: 1, 3: 42, 4: 334}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952819474_952819483 16 Left 952819474 3:37473467-37473489 CCCTCCTGGGGGTGCTGTGGGAA 0: 1
1: 1
2: 1
3: 42
4: 334
Right 952819483 3:37473506-37473528 GAATGAATGATCTGTTAGGAAGG 0: 1
1: 1
2: 0
3: 11
4: 183
952819474_952819485 24 Left 952819474 3:37473467-37473489 CCCTCCTGGGGGTGCTGTGGGAA 0: 1
1: 1
2: 1
3: 42
4: 334
Right 952819485 3:37473514-37473536 GATCTGTTAGGAAGGCTGGATGG 0: 1
1: 0
2: 1
3: 16
4: 329
952819474_952819484 20 Left 952819474 3:37473467-37473489 CCCTCCTGGGGGTGCTGTGGGAA 0: 1
1: 1
2: 1
3: 42
4: 334
Right 952819484 3:37473510-37473532 GAATGATCTGTTAGGAAGGCTGG 0: 1
1: 0
2: 1
3: 8
4: 142
952819474_952819482 12 Left 952819474 3:37473467-37473489 CCCTCCTGGGGGTGCTGTGGGAA 0: 1
1: 1
2: 1
3: 42
4: 334
Right 952819482 3:37473502-37473524 CTGAGAATGAATGATCTGTTAGG 0: 1
1: 0
2: 1
3: 21
4: 208
952819474_952819486 29 Left 952819474 3:37473467-37473489 CCCTCCTGGGGGTGCTGTGGGAA 0: 1
1: 1
2: 1
3: 42
4: 334
Right 952819486 3:37473519-37473541 GTTAGGAAGGCTGGATGGCATGG 0: 1
1: 0
2: 3
3: 26
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952819474 Original CRISPR TTCCCACAGCACCCCCAGGA GGG (reversed) Intronic
900326574 1:2111211-2111233 TTCCCACAGCACCCTCCTGAGGG - Intronic
900587218 1:3439023-3439045 TTCCCCCAGCACCTCCAACAGGG - Intergenic
901438887 1:9265508-9265530 TTCCTACTGCACAGCCAGGATGG - Exonic
901664639 1:10819444-10819466 TCCCCAGAGCACCTCCAGGGAGG - Intergenic
901758655 1:11456563-11456585 TCCCAGCAGCACCCCTAGGATGG - Intergenic
902653141 1:17849859-17849881 TTCCCTCAACAGCCCCATGAGGG - Intergenic
902713018 1:18253480-18253502 TGCCCAGAGAACCCCCAGGCTGG + Intronic
903842610 1:26254702-26254724 CTCCAAAAGCTCCCCCAGGAAGG - Intronic
905515822 1:38561257-38561279 TTCCCTGACCACCCCCACGAGGG + Intergenic
906276758 1:44522647-44522669 GTCCCCCCGCCCCCCCAGGAGGG - Intronic
906524477 1:46486139-46486161 TTCCCCCTCCACCCCCACGAAGG - Intergenic
906574560 1:46876034-46876056 TTCCCATAGCACGACCAGAAGGG + Intergenic
906789572 1:48646844-48646866 TCCTCACAGCAGCCCCATGATGG - Intronic
907339116 1:53721358-53721380 TTCTCCCAGCAGCCCTAGGAAGG - Intronic
907708399 1:56852928-56852950 CTCCCACCCCACCCCCAGCACGG - Intergenic
909741710 1:79037368-79037390 TTCCCACAGCTCCACTAGGCAGG - Intergenic
909868994 1:80714790-80714812 CTCCCACAGAACCTCCAGAAAGG - Intergenic
910008687 1:82433329-82433351 CTCCCACAGAACCTCCAGAAAGG - Intergenic
910168013 1:84348360-84348382 CTCCCACACCATCCCCAGGGCGG - Intronic
910713349 1:90204279-90204301 TCCCTGCAGCACCTCCAGGAAGG - Intergenic
911249531 1:95559123-95559145 TTCCCATAAAACCCCCAGAAAGG - Intergenic
911269817 1:95787653-95787675 TTCCCCCAGCACCGCCCTGATGG + Intergenic
912084532 1:105982268-105982290 TTCTCACAGCTCCCCCAGGCAGG - Intergenic
912701263 1:111880005-111880027 TCCTCACAGCAACCCTAGGAGGG - Intronic
912872633 1:113323677-113323699 TTGTCACAGCACCACCAGAATGG - Intergenic
912996454 1:114536624-114536646 AGTCCACAGCAGCCCCAGGAAGG - Intergenic
913017969 1:114758149-114758171 TTCCCGCAGCACACCCAAGAAGG - Intronic
913598102 1:120396800-120396822 TTGCCACAGCACCCCAATGTGGG - Intergenic
914089227 1:144482520-144482542 TTGCCACAGCACCCCAATGTGGG + Intergenic
914309384 1:146451695-146451717 TTGCCACAGCACCCCAATGTGGG - Intergenic
914592727 1:149121442-149121464 TTGCCACAGCACCCCAATGTGGG + Intergenic
915038069 1:152945213-152945235 TTCCCCCTGCATCCCCAGCATGG + Intergenic
915588472 1:156857875-156857897 ATCCCCCAGCACCTCCATGAGGG + Intronic
916676182 1:167065977-167065999 TTCCCAGAGGACCCCTAGGATGG + Intronic
919042554 1:192410147-192410169 TTCCCACGGCACAGCCAGCAAGG - Intergenic
920399215 1:205666810-205666832 TTTCCACAGTACCCCCAAGAAGG + Intronic
920502574 1:206494493-206494515 ACCCCTCAGCACCCCAAGGAGGG - Intronic
920530136 1:206695851-206695873 CTCTGACAGCACCCGCAGGAAGG - Intronic
920934231 1:210416224-210416246 GTCCCACAGCACCCTGATGATGG + Intronic
921264936 1:213414573-213414595 GTCCCACAGAGCCTCCAGGAGGG + Intergenic
921822154 1:219629616-219629638 TTACCACAGCAACCCAGGGAAGG + Intergenic
922566694 1:226605822-226605844 ATCCCCCAACACCCTCAGGAAGG - Exonic
924632610 1:245754931-245754953 GCCCCACGGCACCCTCAGGAGGG + Intronic
1067061959 10:43082200-43082222 TTCCCACAGCTCCTCCTGGCTGG + Intronic
1067297724 10:44984359-44984381 TTCCCATAGCACACACAGGGCGG - Intronic
1067774279 10:49150921-49150943 TTCCCACAGCATTCAGAGGATGG - Intergenic
1069602632 10:69717790-69717812 TTCCTCCAGCTCCCCCAGGATGG + Intergenic
1069612374 10:69783055-69783077 TTTCCACTCCACCCCCAAGATGG - Intergenic
1069761649 10:70815765-70815787 ATACCACAGCCGCCCCAGGACGG + Intergenic
1069900386 10:71703463-71703485 TCCCCACAGCACAGCCAGGCAGG - Intronic
1070009274 10:72456429-72456451 TTCCCACAGCACAGCCAACAGGG - Intronic
1070337560 10:75468738-75468760 TCCCCACTCCACCCCCAGCAGGG - Intronic
1070981437 10:80651898-80651920 TTTCCACAGACCCCCGAGGATGG + Intergenic
1071032068 10:81196599-81196621 GTCCCATAGCATTCCCAGGATGG - Intergenic
1071493929 10:86154913-86154935 TCACCCCAGCAACCCCAGGAGGG + Intronic
1072214254 10:93274509-93274531 TTCTCACAGCAGCCCTATGAGGG - Intergenic
1072654940 10:97323420-97323442 TTCCCACAACATGCCCAGAAAGG + Intergenic
1072792348 10:98327385-98327407 CTCCCAAAGCTCTCCCAGGATGG - Intergenic
1073425662 10:103454182-103454204 TACACACAGCAACCCCATGATGG + Exonic
1074098705 10:110336096-110336118 CTCTCACAGGACCCCCAGCAGGG + Intergenic
1074826458 10:117218482-117218504 TTCCAACATCCTCCCCAGGACGG + Intergenic
1075464177 10:122639066-122639088 TTCCCACAGCTCCACCAGGCTGG + Intronic
1075574210 10:123566689-123566711 TTCCCACCCAACCTCCAGGATGG - Intergenic
1075649751 10:124119667-124119689 TTCCCCGTGCAACCCCAGGAAGG - Intergenic
1076423929 10:130354020-130354042 GTCCATCAGCACCCCCGGGATGG - Intergenic
1077234584 11:1473846-1473868 TGCCCCCAGCACCCCGGGGATGG + Intronic
1078386163 11:10894799-10894821 TTCCCCCAGCACCCCTTGCAAGG - Intergenic
1080822922 11:35824354-35824376 TCCTCACAGCACCCCCACAAGGG + Intergenic
1083508325 11:63182223-63182245 TCCCCTCAGCACCCAGAGGAAGG - Intronic
1083714753 11:64568818-64568840 TTCCCACCGCCCTCTCAGGACGG - Intronic
1084796001 11:71504457-71504479 TCTCCACAGCATCCCCAGGATGG - Intronic
1084946052 11:72639139-72639161 TTCCCACAGCTCTCTCTGGAAGG + Intronic
1085815036 11:79728158-79728180 GTAGCACAGCACCACCAGGAAGG - Intergenic
1090513402 11:127399172-127399194 TATCCACAGCTCCTCCAGGATGG + Intergenic
1091321934 11:134657785-134657807 CTCCCCCAGCACCTCCAGCATGG - Intergenic
1091940094 12:4471693-4471715 TTGCCACAGAAGCCCCAGGTAGG - Intergenic
1092337111 12:7642855-7642877 TTCCCATAGCACAACCAGAAGGG + Intergenic
1093374767 12:18411248-18411270 TTTCTACAGCACCCCTAGCAAGG - Intronic
1094422743 12:30288928-30288950 TTCCCACAGCACAGCAAGCAAGG + Intergenic
1096462035 12:51827149-51827171 CTCCCACAGGAGCCTCAGGAAGG + Intergenic
1096600994 12:52729343-52729365 TTCCCAAAGTAGCTCCAGGAAGG - Intergenic
1098284864 12:68896601-68896623 TTTCCAGAGCCCACCCAGGATGG - Intronic
1099054941 12:77827766-77827788 TTCTCACAGCACCCCTGTGAAGG + Intergenic
1100390621 12:94143417-94143439 TTCCCAGGGCTTCCCCAGGATGG + Intergenic
1100391426 12:94148823-94148845 TCCCCGCAGCTCGCCCAGGAAGG - Exonic
1100753035 12:97720396-97720418 TTAGCCCAGCACCCCAAGGAGGG + Intergenic
1101496724 12:105261709-105261731 CTCCCAAAGCAACCCCTGGAAGG - Intronic
1102013113 12:109631134-109631156 TTCACTCAGCACCCACAGGACGG - Intergenic
1102173542 12:110860029-110860051 AACCCAGAGCACCCCCAGCAGGG + Intronic
1102258781 12:111430904-111430926 TCCCCACAGCAACCCCTGGCTGG + Intronic
1103232115 12:119340227-119340249 TTCCCACAACACCCCTTTGATGG - Intronic
1106343615 13:28854917-28854939 TCACCAGAGCATCCCCAGGAGGG - Intronic
1107603807 13:42040152-42040174 AAGCCTCAGCACCCCCAGGAGGG + Intronic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1112309151 13:98302491-98302513 TTGCCTGAGCACGCCCAGGAAGG - Intronic
1113294794 13:108947220-108947242 TGTCCACAGCACCAACAGGAAGG - Intronic
1113480777 13:110619014-110619036 GTCGCCCAGCACTCCCAGGAGGG - Intronic
1113601879 13:111575430-111575452 TTCAAACAGGACCCCCAAGAAGG + Intergenic
1115142190 14:30184804-30184826 TTCCCAAACAAGCCCCAGGAAGG + Intronic
1117447279 14:55816273-55816295 TTCCCACAGCCCTCCCAACATGG + Intergenic
1118940605 14:70332748-70332770 TTCCCACAGCAGATCCAGAAGGG + Intronic
1119872918 14:78032355-78032377 TTGCCACAGAACCCCAAAGATGG - Intergenic
1119902904 14:78276545-78276567 TTCTCATAACACCCCCATGAGGG + Intronic
1121009233 14:90510148-90510170 TCCTCACAACAGCCCCAGGAGGG - Intergenic
1121252879 14:92513124-92513146 GACCCACAGCAACCCCAGGTGGG - Intergenic
1121407388 14:93727506-93727528 TGCCCACAGAATCCCCAGCAGGG - Intronic
1121735064 14:96212736-96212758 TTCCATCAGCACCCCCAGAAAGG + Intronic
1121794204 14:96722170-96722192 TTGACACAGCACCTGCAGGAAGG + Intergenic
1122356796 14:101127525-101127547 TGCCCACAACAACCCCAGGCAGG + Intergenic
1122557886 14:102591609-102591631 TCCCCCCGGCACCCCCACGAGGG - Intergenic
1123042849 14:105497479-105497501 TTCCCACAGCAGCCCCCAGGTGG + Intronic
1123163374 14:106301777-106301799 TGACCACAGCACTCACAGGAAGG + Intergenic
1123207063 14:106723956-106723978 TGACCACAGCACTCACAGGACGG + Intergenic
1123212083 14:106770959-106770981 TGACCACAGCACTCACAGGACGG + Intergenic
1124042534 15:26118541-26118563 TTCCCACATCACCCCAGGGCTGG - Intergenic
1124055609 15:26238489-26238511 TTCCCACAGCGAGGCCAGGAAGG + Intergenic
1128376929 15:67083386-67083408 TTCCCACATGAACCCCAGTAAGG - Intronic
1128984430 15:72208805-72208827 AGTCCACAGCAGCCCCAGGAAGG + Exonic
1130157432 15:81363828-81363850 TTCCCCCAGTATCCCGAGGAAGG + Intronic
1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG + Intronic
1132625966 16:891650-891672 CTCCCCCATCACCCTCAGGACGG - Intronic
1132744845 16:1432297-1432319 GTCTCACAGCACCCCCTGGCCGG + Intergenic
1132931748 16:2462296-2462318 TTTGCAGAGCAGCCCCAGGAGGG + Intronic
1133093764 16:3426725-3426747 TTCCCAGTTTACCCCCAGGAAGG - Intronic
1133722563 16:8508551-8508573 CTCTGACAGCACTCCCAGGAAGG + Intergenic
1136034105 16:27525677-27525699 GACCCACAGCACCCCCAGGGCGG - Intronic
1136750226 16:32628888-32628910 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1137683149 16:50368607-50368629 TTCCCACGGCAGGCCCAGGCCGG - Intronic
1138348971 16:56336356-56336378 TGCCCAGAGCAAACCCAGGAAGG + Intronic
1140611230 16:76601701-76601723 TGCTCAAAGCACCACCAGGAGGG - Intronic
1140961002 16:79912842-79912864 TTCTCACAACAACCCCACGAGGG - Intergenic
1141219071 16:82052187-82052209 TTCCCACAGCCCACCAAGGAAGG - Intronic
1141860371 16:86712298-86712320 CTGCCACAGCACCCACGGGAGGG - Intergenic
1141910606 16:87056279-87056301 TGCTCACAGCACCCCTATGAGGG + Intergenic
1142244403 16:88962933-88962955 TTTCCACAGGGCCTCCAGGAGGG + Intronic
1142307936 16:89295842-89295864 TGCACAGAGCACCCCAAGGAAGG - Intronic
1142307951 16:89295893-89295915 TGCACAGAGCACCCCCAGGAAGG - Intronic
1203052357 16_KI270728v1_random:888093-888115 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1142619548 17:1156100-1156122 TCCCCACAGCACCCCCATTGAGG - Intronic
1142968398 17:3595223-3595245 TTCCCACAACATCCCTAAGAGGG + Intronic
1143503825 17:7353145-7353167 TTCCCGCAGCGCGTCCAGGAGGG - Exonic
1143733842 17:8896768-8896790 TACCCACATCACCCTCAGCATGG - Intronic
1143886400 17:10068156-10068178 ATCACACAGCACCCCAAAGAGGG + Intronic
1144080955 17:11763374-11763396 GTCCAACAGCACCACCAGAATGG + Intronic
1144122167 17:12165704-12165726 TTCCCACAGCTCCACTAGTATGG + Intergenic
1144482743 17:15640918-15640940 TTCCCACAACACCCTCATGCTGG - Intronic
1144582510 17:16466900-16466922 TCCCCACAGCACCCCTAAAATGG - Intronic
1144915945 17:18724114-18724136 TTCCCACAACACCCTCATGCTGG + Intronic
1146397944 17:32483775-32483797 TTCCCATAGCATCCCGAGGGAGG - Intergenic
1146459333 17:33033344-33033366 TTGCAGCTGCACCCCCAGGAAGG - Intronic
1146594364 17:34156395-34156417 TGCCCACAGCACACGCCGGATGG + Intronic
1147033573 17:37662364-37662386 TTCCCTCCCCAGCCCCAGGAGGG + Intergenic
1147261141 17:39210343-39210365 TTCCTCCAGCAGCCCGAGGAGGG - Intergenic
1147412627 17:40264706-40264728 CTCCCCCACCACCCCCAGGGCGG + Exonic
1147466565 17:40615545-40615567 TTCTCAGAGCTCCCCCAGGTGGG + Intergenic
1147912585 17:43864878-43864900 TTCCCACAGTACCACCAAGAGGG + Intergenic
1147923971 17:43935502-43935524 TGCCCACACCAACCCCAGAAGGG - Intergenic
1147983087 17:44287059-44287081 TTCTCACAACAGCCCCATGAAGG - Intergenic
1148160001 17:45444299-45444321 CTCTCCCAGCACCCTCAGGAGGG - Intronic
1148193375 17:45695843-45695865 TTGTCCCAGAACCCCCAGGAGGG - Intergenic
1148893098 17:50821867-50821889 TGCCTACACCACCACCAGGAAGG - Intergenic
1148894744 17:50833175-50833197 ACCCCACGGCAGCCCCAGGAGGG - Intergenic
1149271462 17:54983068-54983090 TTCCCACAGGAGCCCCACAAGGG - Intronic
1150391293 17:64791178-64791200 CTCTCCCAGCACCCTCAGGAGGG - Intergenic
1150622609 17:66819517-66819539 TTCACACAGCCCGCTCAGGAGGG - Intergenic
1151451750 17:74202407-74202429 TATCTCCAGCACCCCCAGGAAGG + Intergenic
1151819757 17:76491129-76491151 TACCCACAGCAGGGCCAGGATGG + Intronic
1152327126 17:79647995-79648017 CTCCTACTGCACCCCCAGGTGGG - Intergenic
1152390905 17:80003139-80003161 TCCCGGCAGCACCCCCAGGTGGG + Intronic
1152592126 17:81218843-81218865 TTCCCACAGGAACCCCTGGCAGG - Intronic
1153039128 18:794543-794565 TTTCTACAGCAGCCCTAGGAGGG - Intronic
1155376585 18:25164739-25164761 CTCCCTGGGCACCCCCAGGAGGG + Intronic
1158288657 18:55913975-55913997 TTCCTACCCTACCCCCAGGAGGG - Intergenic
1159941650 18:74413055-74413077 TTCACCCTGGACCCCCAGGAGGG + Intergenic
1160042864 18:75361149-75361171 TTCCCTCTGCACCACCTGGACGG - Intergenic
1160417482 18:78721315-78721337 CTTCCACAGCTCCTCCAGGACGG - Intergenic
1160972183 19:1774580-1774602 TTTCCCCAACACCCCCAGGTTGG + Intronic
1160979538 19:1810670-1810692 CTCCCACAGCCCCACCAGCATGG - Exonic
1161102143 19:2426525-2426547 TTCCCAGAGACCCCTCAGGAGGG + Exonic
1161431240 19:4233525-4233547 TTCCCACAGCAGCCACCAGAGGG + Intronic
1161578293 19:5066893-5066915 TGTCCACAGCACCCCCAGCGGGG - Intronic
1161664382 19:5565948-5565970 TTCCCAGAGCTGCCCCAGGCCGG + Intergenic
1161871792 19:6876097-6876119 CACTCACAGCAGCCCCAGGATGG + Intergenic
1162028985 19:7909364-7909386 GGGCCACAGCACCCACAGGATGG - Intronic
1162059298 19:8085329-8085351 TGCCCTCAGGACCCCCAGGGAGG - Intronic
1162061202 19:8096565-8096587 TGCTCTCTGCACCCCCAGGACGG - Exonic
1162248082 19:9419578-9419600 TTCCCAAAGCACACACAGCAGGG + Exonic
1162308599 19:9891002-9891024 TTCCCTCAGCAACCGCAGAAGGG + Intronic
1162453574 19:10769037-10769059 TTCCCCCAGCACACACAGGCAGG - Intronic
1162740505 19:12771068-12771090 TTCCCCCAACACCCCCAGGCTGG - Exonic
1162823089 19:13235165-13235187 TTCCCAGAGCCTCCCAAGGAGGG - Intronic
1163210485 19:15836608-15836630 CTCCCACAGGATCCCCAGGCCGG + Intergenic
1163388840 19:17017221-17017243 GTCTCACATCACCCCCAGGTGGG + Intronic
1164137186 19:22426347-22426369 TCCCCTAAGCAACCCCAGGAAGG + Intronic
1164161001 19:22625287-22625309 TCCCCTAAGCAGCCCCAGGAAGG - Intergenic
1164565569 19:29323689-29323711 TTCCCACCGGAGGCCCAGGAGGG - Intergenic
1166214510 19:41326429-41326451 TGCTCACAGCACCCACAGGCTGG + Intronic
1166966453 19:46532002-46532024 TCCCACCAGCACCCCCAGGGTGG - Intronic
1168261539 19:55197811-55197833 TTCCCACAGGAACCCCAGGTAGG + Intronic
1168279541 19:55297420-55297442 TTCCCTCAGCAGTCCCAGGGAGG + Intronic
1168583686 19:57576109-57576131 TTCCCACAGCACCAACAGGCAGG + Intronic
925049017 2:796695-796717 TGCCAGCTGCACCCCCAGGAAGG + Intergenic
925225585 2:2181720-2181742 TTCACACAGCAACCACAGGAGGG + Intronic
925995434 2:9288833-9288855 GTCTCAGAGCACCCCTAGGAGGG + Intronic
926616383 2:15000864-15000886 TTCTCACAGCACCTTCAGAAGGG + Intergenic
926630896 2:15135454-15135476 CTCCCACTGCACCCCAAGCACGG - Intergenic
926703932 2:15823074-15823096 GTCCCACAGCTATCCCAGGAAGG + Intergenic
927756837 2:25715426-25715448 TTCCCACAGCCCCCCCAAACTGG - Intergenic
931247177 2:60500900-60500922 TTCCATCAGCAACCCCAGGTTGG - Intronic
932318184 2:70800443-70800465 TTGTCACAGCACCCCCACGAAGG + Intergenic
934783929 2:96990954-96990976 TTCACCCAGCACTCCCAGAAGGG - Intronic
934989640 2:98912311-98912333 TACCCCCAGCACACCCAGGCAGG - Intronic
936065961 2:109332402-109332424 CTCCCCCAGCACCCCGAGCAGGG + Intronic
937832965 2:126444034-126444056 CTCTCACAGCATCTCCAGGAGGG + Intergenic
937895315 2:126973333-126973355 TTCCCTCAGCAACCCTGGGAGGG + Intergenic
938611238 2:132949486-132949508 TTCCCACAGAAACCACAGTAAGG + Intronic
938723155 2:134084302-134084324 TTCTCACAACACACCCAGGTTGG + Intergenic
942657221 2:178226344-178226366 TGCCCACTGCACCACCAGCATGG - Intronic
944680490 2:202072766-202072788 TTTCCAGAGCACCCCCATCAGGG + Intergenic
945922514 2:215770201-215770223 CTGCCACAGCACCCCAAGGAAGG + Intergenic
946458682 2:219850696-219850718 TTCCCACAACAGCCCCACGAAGG - Intergenic
946766469 2:223045267-223045289 TCCCCACATCTTCCCCAGGAAGG + Intergenic
948906425 2:240981804-240981826 CTCCCACAAAACCCTCAGGAAGG + Intronic
949023172 2:241752761-241752783 CCCCCACACCACCCCCAGGAGGG + Intronic
949058672 2:241943827-241943849 TTCCCAGATCACCACCAGCAGGG - Intergenic
1168822306 20:783222-783244 GTACTACAGCACCCTCAGGATGG + Intergenic
1169933534 20:10858678-10858700 TTTCCACTGCACCCCAAGGTTGG - Intergenic
1171143413 20:22762501-22762523 CTCCCACCGCCACCCCAGGAAGG + Intergenic
1171188182 20:23138344-23138366 TACCCAAAGGACCACCAGGATGG - Intergenic
1171457735 20:25281388-25281410 CTCCGACTGGACCCCCAGGAAGG - Intronic
1172901786 20:38340497-38340519 TTCCAAAAGGAACCCCAGGAAGG - Intergenic
1173528113 20:43748271-43748293 CTCACACAGGACCCCCTGGATGG + Intergenic
1175222724 20:57426626-57426648 CTCCCACAGCACCCCCAGGAGGG + Intergenic
1175601756 20:60279903-60279925 TTTCCACAACCCCCTCAGGATGG - Intergenic
1176246992 20:64102179-64102201 AGCCCACAGCGCCCCCTGGAGGG - Intergenic
1178618535 21:34154361-34154383 GGCACACAGCACCCCAAGGAAGG - Intergenic
1178784486 21:35640373-35640395 AACCCACAGAACCCCAAGGATGG - Intronic
1179189898 21:39115037-39115059 TGCCAAAGGCACCCCCAGGAGGG + Intergenic
1179610966 21:42549651-42549673 TGCCCTCAGCTCCCTCAGGAAGG - Intronic
1179632640 21:42688307-42688329 TCCCCACATTAACCCCAGGAAGG + Intronic
1179718557 21:43302616-43302638 TTCCTGGGGCACCCCCAGGACGG - Intergenic
1179800925 21:43811197-43811219 TTCCCACTGCACACCCACCAGGG - Intergenic
1180983251 22:19889260-19889282 GGCCCAGAGGACCCCCAGGAAGG + Intronic
1181479894 22:23192082-23192104 TTCACACCCCAGCCCCAGGAAGG - Intronic
1181490128 22:23256383-23256405 TTCCCACAGCACCCCGGGCAAGG - Intronic
1182520429 22:30881722-30881744 TCCCCACAGCACAGCCAGGATGG + Intronic
1182902630 22:33911046-33911068 TTCTCACAGCAACCCTGGGAGGG - Intronic
1183470989 22:38006668-38006690 CTCCCACAGACCCCCCAGGAAGG + Intronic
1183597672 22:38822281-38822303 TTTTGACAGCACCCCCAGTAGGG - Exonic
1184556608 22:45236602-45236624 TACCCTCAGCACCCTGAGGACGG + Intronic
1184644803 22:45889974-45889996 TTCCCACAGGTCCCACAGGCAGG + Intergenic
1184828915 22:46971768-46971790 TTCCCACGGCAGCCCAAGGTGGG - Intronic
1184943236 22:47783724-47783746 TTCCCACAGCCACCCCTGGCTGG + Intergenic
1185156754 22:49197695-49197717 TTCCAACAGGATCCCCAAGAAGG + Intergenic
950556627 3:13699936-13699958 TTCTCTCAGCAGCCCTAGGAAGG + Intergenic
952220608 3:31320475-31320497 TTCTCAAAGCATCCCCAGTAAGG + Intergenic
952819474 3:37473467-37473489 TTCCCACAGCACCCCCAGGAGGG - Intronic
953375871 3:42428199-42428221 TGCCCATAGTACCCCCTGGATGG + Intergenic
953656990 3:44861994-44862016 TTCCCTCCGCACCTCCAGGCGGG + Exonic
954135415 3:48580034-48580056 GTCCCCCAGGACCCCCGGGACGG - Exonic
956828492 3:73021274-73021296 TTGCCACTGCACCCCCAGCCTGG - Intronic
956844511 3:73170038-73170060 TTCCCAAAGCACCTCCCAGAAGG - Intergenic
957460901 3:80518958-80518980 TTCCTACTTCACCCCCAAGAGGG - Intergenic
957762141 3:84572520-84572542 TTCTCACAGCTCCACTAGGAAGG + Intergenic
960173298 3:114488168-114488190 TTCCCACAACACTCCCCTGAAGG + Intronic
961352770 3:126314609-126314631 TTCCCACAGTGACCCCAGCAGGG + Intergenic
962616138 3:137128485-137128507 TTCCCAGAGTTCCCCGAGGATGG - Intergenic
962741157 3:138363434-138363456 CTTCCGCAGCACCCCCAGGCTGG + Intronic
962959012 3:140292754-140292776 TTCTCCCAGCAGCCCCATGACGG - Intronic
965519173 3:169655903-169655925 CTCTCACAGCAGCCCAAGGAGGG + Intronic
968234687 3:197024550-197024572 CTCCCACAGCCCGCCCAGGCAGG - Intronic
968494519 4:907938-907960 TTCCCACACCACCCCATGCAGGG + Intronic
968513433 4:1005153-1005175 TGCACACAGCACCCACAGGCTGG - Intergenic
968549097 4:1213336-1213358 CTCTCACTGCACCCCCAGCAGGG - Intronic
968949400 4:3682822-3682844 CTCCCAAAGCACACCCAGGAGGG + Intergenic
969227998 4:5811682-5811704 TTCACACACCACAGCCAGGAGGG + Exonic
969300291 4:6293412-6293434 TTCCAACAGAACTCCCAGAAAGG + Intronic
969471987 4:7394449-7394471 GACTCACACCACCCCCAGGAAGG - Intronic
969497208 4:7533061-7533083 ATCCCACAGCAGCCCAAAGAGGG + Intronic
969611506 4:8229846-8229868 ATCCCCCAGCACCCCGGGGAGGG - Intronic
969658119 4:8509668-8509690 GCCCCACACCACACCCAGGAGGG + Intergenic
970999304 4:22304160-22304182 TTCCCACAGCTCCCTCAGTAGGG - Intergenic
971362637 4:25951641-25951663 TTCTCACAGTATCCCCAGGCTGG + Intergenic
973802671 4:54494561-54494583 TTCTCACAACAACCCCATGAAGG + Intergenic
977101578 4:92822747-92822769 ATCCCACAGCATGCCCTGGAGGG - Intronic
979151805 4:117326381-117326403 TTTCCACAGCGCCTCTAGGAAGG + Intergenic
981725348 4:147841935-147841957 CTCCCACGTCACCCCCAAGATGG + Intronic
981733522 4:147924800-147924822 TTCTCACAACAACCCCATGAAGG - Intronic
982647010 4:158037100-158037122 TTTCCACTCCACCCCCAGGAAGG + Intergenic
984402322 4:179282286-179282308 TTCCCTGAGAGCCCCCAGGAAGG + Intergenic
985478214 5:91707-91729 TTCCCACAGCGGCCCCTGGACGG + Intergenic
985699725 5:1363311-1363333 CTCCCACAGCAGCCCCAGGGAGG - Intergenic
985744662 5:1639197-1639219 GCCCCACAGCAGCCTCAGGAAGG - Intergenic
985858771 5:2452690-2452712 TTGTCACAGCAACCCCAGGTTGG + Intergenic
985892499 5:2726546-2726568 TCCCCTCAGAACCCCCTGGAGGG + Intergenic
986136451 5:4984027-4984049 TTCCCCCAGCAGCCCCAGCAGGG + Intergenic
986176772 5:5359221-5359243 TTTCAGCAGCACCCCCAGGACGG + Intergenic
986216429 5:5723807-5723829 GTCTCCCATCACCCCCAGGAGGG - Intergenic
988984166 5:36600583-36600605 ATCCCACTGCCTCCCCAGGAAGG - Intergenic
991644795 5:68791016-68791038 TTCCCACATCACCACTTGGAGGG + Intergenic
993636397 5:90349392-90349414 TTGACACAGCACCTCCTGGATGG - Intergenic
995852746 5:116562965-116562987 CTCTGACAGCACCCGCAGGAAGG + Intronic
996330100 5:122318925-122318947 TTCTCACAGCAGCCCTAGGTAGG + Intronic
999546347 5:152632709-152632731 TTCCCACCCCACCACCTGGAAGG - Intergenic
999626397 5:153525223-153525245 TTGCCACATGTCCCCCAGGAAGG - Intronic
1001101807 5:168820452-168820474 TTCTCACAGCAGCCCTAGGAAGG - Intronic
1001546902 5:172575885-172575907 TTCTCACAGCAACCCCTCGAGGG - Intergenic
1002076538 5:176711909-176711931 ATCCCCCAGCACTCCCTGGATGG - Intergenic
1002419487 5:179138181-179138203 TCCCCACAGGAACCCCAGGAGGG - Intronic
1004696958 6:18042857-18042879 CACCCTCAGCAGCCCCAGGAAGG + Intergenic
1006470595 6:34226647-34226669 GTCCCACAGGTCCCCCAGGAAGG - Intergenic
1012397777 6:98819633-98819655 TTCCAACAGCACCACCATCATGG + Intergenic
1015804261 6:137092493-137092515 TTGTTACAGCAGCCCCAGGAAGG - Intergenic
1016384293 6:143515670-143515692 TTCTCACAACACCCCTAGGAGGG - Intergenic
1016908795 6:149177122-149177144 TCCACACAGGAACCCCAGGAAGG + Intergenic
1019409265 7:899549-899571 TGACCACAGCACACCCCGGAGGG + Intronic
1019481857 7:1270578-1270600 TGCCCTCAGCACCCCTGGGAAGG + Intergenic
1019538713 7:1541856-1541878 TTCCGCCAGCTCCCCCAGGCAGG - Exonic
1019932588 7:4233826-4233848 CTCCCCCAGCACCACCAGCAAGG + Intronic
1020094599 7:5361499-5361521 GTCCCCCAGCACCCCGAGGCAGG + Intronic
1020180689 7:5920193-5920215 TTCCCTCAGCTCCCCCCGAATGG + Intronic
1020302241 7:6804689-6804711 TTCCCTCAGCTCCCCCCGAATGG - Intronic
1020461548 7:8434317-8434339 TTCCCACAGCTGCCTGAGGATGG - Exonic
1020660335 7:10974082-10974104 TTCCCACAGCGCTCCCTGGCCGG - Exonic
1023605603 7:41928026-41928048 TTTGCACATCAGCCCCAGGAGGG + Intergenic
1024512582 7:50215321-50215343 TTCCCTCAGCAGCTCCAGCATGG - Intergenic
1024943103 7:54782603-54782625 TGACCACTGCACCTCCAGGAAGG + Intergenic
1027260656 7:76462185-76462207 TTCCCAAAGTACCCAGAGGAGGG + Intronic
1027312035 7:76960298-76960320 TTCCCAAAGTACCCAGAGGAGGG + Intergenic
1031642965 7:124188356-124188378 TTCACAAAGGACCCTCAGGAAGG + Intergenic
1032062774 7:128738972-128738994 TTCCCACAAGACCACCAGGGCGG - Intergenic
1034678573 7:152910717-152910739 GACACCCAGCACCCCCAGGAGGG + Intergenic
1034823327 7:154237144-154237166 TTCCAACAGCAGCCAGAGGAGGG + Intronic
1035279277 7:157767057-157767079 TTGCCACAGCTCCCCCTGCAGGG + Intronic
1035355644 7:158274615-158274637 TTTCCACAGCGTTCCCAGGAAGG - Intronic
1035357400 7:158284701-158284723 TACCCACACCTCCCGCAGGAAGG + Intronic
1035655497 8:1302043-1302065 TTCCCCCAGCACACACAGGTTGG - Intergenic
1035682306 8:1496900-1496922 TTGCTACAGCTCCCCCAAGATGG + Intergenic
1036038182 8:5043037-5043059 GTCCCCCATCACCCCCAGAAGGG - Intergenic
1037496359 8:19444688-19444710 TTATCCCAGCAACCCCAGGAAGG - Intronic
1037673740 8:21037115-21037137 CTCCCACAGCATTCCCAGGATGG + Intergenic
1037882449 8:22579682-22579704 TCCCCAGGGCAGCCCCAGGATGG + Intronic
1037961699 8:23102794-23102816 CTCCCCTAGCACCTCCAGGAAGG - Exonic
1037969826 8:23164127-23164149 CTCCCCCAGCACCTCCAGGAGGG + Intergenic
1038570641 8:28659126-28659148 TTGGCACAGCACCCCATGGAGGG - Intronic
1038577486 8:28717435-28717457 CTCCCCCAGCACCACCGGGACGG - Exonic
1038615308 8:29088503-29088525 TTCCTGTAGAACCCCCAGGAGGG + Intronic
1040007529 8:42632829-42632851 TTCCCCCAGGCTCCCCAGGACGG + Intergenic
1040072585 8:43200708-43200730 TTCCCACAGAACACCCAGGAGGG - Exonic
1049341171 8:142113418-142113440 TTCCCACATCACCCACGGGAAGG - Intergenic
1049377689 8:142296798-142296820 TCCCCACAGGCTCCCCAGGACGG + Intronic
1049420350 8:142513681-142513703 TCCCCACACCACACTCAGGAGGG - Intronic
1049438723 8:142599516-142599538 TTCCCATAGCAACGCCTGGATGG + Intergenic
1051652931 9:19348156-19348178 TTTTCACAGCAACCCCATGAGGG + Intronic
1052584956 9:30415006-30415028 TTCCCACAGCACATCCTGAAGGG - Intergenic
1056539240 9:87557080-87557102 TTCCCGCAACACCGCCAAGAGGG - Intronic
1056886580 9:90449000-90449022 TACCCCCAGCAACCCCAAGAAGG - Intergenic
1057035814 9:91811144-91811166 TTCCCACACCTCCCCTAGGCCGG + Intronic
1057199669 9:93133499-93133521 TGCCCACAGCCCTCCCAGGCCGG + Intronic
1057801697 9:98195079-98195101 CAGCCACAGCAACCCCAGGAAGG - Intergenic
1059157497 9:112002949-112002971 TTCTCACAGCAACCCTATGAGGG - Intergenic
1060246744 9:121952777-121952799 TTCCCCCTGCAACCCCAGGCAGG - Intronic
1060852697 9:126890346-126890368 TCCACACAGAGCCCCCAGGAAGG - Intergenic
1061130880 9:128707063-128707085 TTCCCATACCACCCTCAGCAGGG + Intronic
1061236243 9:129344230-129344252 CTCCCACAACATCCCCGGGAGGG + Intergenic
1061389752 9:130310881-130310903 TCCTCACAGCAACCCAAGGAGGG - Intronic
1062057070 9:134474311-134474333 TTCCCACAGCCTCCCCTGGCTGG + Intergenic
1062057261 9:134475092-134475114 ATCCCCCAGCACCCGGAGGAAGG - Intergenic
1062188277 9:135230154-135230176 TTCCCCCAGGAATCCCAGGATGG + Intergenic
1062525788 9:136977613-136977635 GTCGCCCAGCACCCCCAGCAGGG - Exonic
1062526833 9:136981320-136981342 TTCACCCACCACCCCCAGGAGGG + Intronic
1062610744 9:137372351-137372373 CTCCCACAGCACCCCCAGAGTGG - Intronic
1186276323 X:7942012-7942034 TTCCCAAACCAACTCCAGGAAGG + Intergenic
1187285769 X:17902207-17902229 TGCCCACAGCATTGCCAGGAAGG - Intergenic
1187461498 X:19491358-19491380 TGAACAGAGCACCCCCAGGAGGG + Intronic
1188699899 X:33246275-33246297 TCACCACAGCAACCCCAGGGAGG - Intronic
1196811767 X:119634661-119634683 TTCCCACAGCACAGCCGGAATGG - Intronic
1199227435 X:145394245-145394267 TTTCCACTGCACGCCCAGGCAGG - Intergenic
1201530550 Y:14986139-14986161 TTCCCATAGCAGCTCAAGGAAGG - Intergenic