ID: 952820415

View in Genome Browser
Species Human (GRCh38)
Location 3:37481535-37481557
Sequence ATGATGTAGCAGAAGCCATG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952820415_952820428 28 Left 952820415 3:37481535-37481557 CCCCATGGCTTCTGCTACATCAT 0: 1
1: 0
2: 2
3: 27
4: 194
Right 952820428 3:37481586-37481608 ACGCTGATCCCTTGCTATGAAGG 0: 1
1: 0
2: 1
3: 0
4: 46
952820415_952820424 5 Left 952820415 3:37481535-37481557 CCCCATGGCTTCTGCTACATCAT 0: 1
1: 0
2: 2
3: 27
4: 194
Right 952820424 3:37481563-37481585 CCAACCTCCAGGCCAAAGGCAGG 0: 1
1: 0
2: 8
3: 75
4: 420
952820415_952820421 1 Left 952820415 3:37481535-37481557 CCCCATGGCTTCTGCTACATCAT 0: 1
1: 0
2: 2
3: 27
4: 194
Right 952820421 3:37481559-37481581 CCCTCCAACCTCCAGGCCAAAGG 0: 1
1: 0
2: 1
3: 29
4: 280
952820415_952820418 -6 Left 952820415 3:37481535-37481557 CCCCATGGCTTCTGCTACATCAT 0: 1
1: 0
2: 2
3: 27
4: 194
Right 952820418 3:37481552-37481574 CATCATCCCCTCCAACCTCCAGG 0: 1
1: 0
2: 0
3: 33
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952820415 Original CRISPR ATGATGTAGCAGAAGCCATG GGG (reversed) Exonic
902156108 1:14487799-14487821 AGGATGGATCAGATGCCATGGGG + Intergenic
903277841 1:22233042-22233064 ATGATTTAGAAGCAGCCATTTGG + Intergenic
904370244 1:30043653-30043675 ATGATGTTGCAGGATCCTTGGGG - Intergenic
905745133 1:40409620-40409642 ATGAAGAGGCAGGAGCCATGTGG + Intronic
907880939 1:58548780-58548802 CTGAAGTAGTAGAAGCCAGGTGG - Intergenic
908065282 1:60396714-60396736 CTGATGTGGCAGAAGACATGAGG - Intergenic
910133142 1:83933284-83933306 ATGATGTGGTAGAAGCCAGGAGG + Intronic
912821389 1:112870668-112870690 AGAATGTAGCAGAAGGGATGTGG - Intergenic
912884666 1:113457861-113457883 ATGAGGAAGAGGAAGCCATGAGG + Intronic
919806489 1:201383737-201383759 TTGAGGTAGGAGCAGCCATGTGG - Intronic
919815764 1:201437744-201437766 ATGATGTCACAGAAGTCAAGGGG + Intergenic
924835646 1:247644456-247644478 ATGATGTAGAGAAAGCCAGGAGG + Intergenic
1063048038 10:2414346-2414368 ATGATCTAGCTTAAGCCAAGTGG + Intergenic
1063356322 10:5402427-5402449 CTGATGATGCAGAAGACATGGGG - Intronic
1063688987 10:8265573-8265595 AAGATGGAGAAGAAGCGATGTGG + Intergenic
1069154818 10:65015065-65015087 ATGATCTAACAGAAACAATGAGG + Intergenic
1070363957 10:75717645-75717667 ATGAGGTAGCTGAAGTCATCTGG - Intronic
1071481630 10:86069225-86069247 ATGATGTAACAGTTGCCAAGGGG + Intronic
1072542961 10:96412507-96412529 ATGATGATGCTGAAGCCAAGGGG + Intronic
1073572480 10:104592242-104592264 ATGACCTATCAGAAGGCATGCGG - Intergenic
1073701792 10:105935345-105935367 AGCATGTGACAGAAGCCATGGGG + Intergenic
1076566689 10:131404023-131404045 ATGGGGTAGCACAGGCCATGGGG + Intergenic
1078355454 11:10628787-10628809 AGGATGTAGGAGAAGCGCTGGGG + Exonic
1080649009 11:34208323-34208345 ATGATGGAGAAGAAAGCATGCGG + Intronic
1081554379 11:44144507-44144529 TTGAGGTGGCAGGAGCCATGAGG - Intronic
1084190415 11:67496101-67496123 AGGAGGTAGCAGAAGACATGAGG - Intronic
1088711083 11:112509454-112509476 CTGCTGAGGCAGAAGCCATGGGG - Intergenic
1089902720 11:122004750-122004772 AAAAACTAGCAGAAGCCATGAGG - Intergenic
1089951653 11:122534036-122534058 AGGAAGTAGCAGAATCCTTGTGG + Intergenic
1090715277 11:129424830-129424852 ATGATTGAGCACAAGCTATGAGG + Intronic
1091579126 12:1770643-1770665 AGTATGTTCCAGAAGCCATGGGG + Intronic
1091750260 12:3017823-3017845 ATGAGGAAGCTGAAGCCAAGGGG + Intronic
1094605173 12:31943533-31943555 AGGAAGTAGCAGAAGCCAAGGGG - Intergenic
1098119402 12:67220263-67220285 ATGAAGTGGCAGAAGCCAGGTGG - Intergenic
1098714281 12:73810015-73810037 CTGGTGTAGCAGATGCCAAGAGG + Intergenic
1099324505 12:81196969-81196991 ATAATGTAGTTGGAGCCATGAGG - Intronic
1099813908 12:87620968-87620990 ATGTTGTGGCAGAGGCCAAGTGG - Intergenic
1101520037 12:105474164-105474186 ATGATATACCAGAAGCCAAGGGG - Intergenic
1101657753 12:106738265-106738287 ATTATGAAGCAGAAACCATTTGG + Intronic
1101809510 12:108095501-108095523 ATCCTGTAGAAGAAGCCAAGAGG - Intergenic
1101853538 12:108423575-108423597 GTGGAGTAGCAGAAGCCAGGTGG - Intergenic
1101964210 12:109271275-109271297 TTGAGTTAGCAGAAGCCATAGGG - Intergenic
1102811784 12:115830714-115830736 ATAATGCAGCAGACACCATGGGG + Intergenic
1102882050 12:116493077-116493099 ATGAGTCAGCAGAAGCCATGAGG + Intergenic
1102912791 12:116731282-116731304 CTGATGGTGCAGAAGTCATGGGG - Intronic
1108476588 13:50824883-50824905 GTGATATAGCAGATGCAATGTGG + Intronic
1108586724 13:51876183-51876205 AAGATGTTCCAGAAGCCAAGAGG - Intergenic
1108784357 13:53877054-53877076 ATGATGTGTCAGACGCTATGGGG + Intergenic
1112171563 13:96977658-96977680 GTGAGGGAGCAGAAGCTATGTGG - Intergenic
1112191285 13:97180344-97180366 ATGATTTACCAGAAGTCATTTGG + Intergenic
1112219527 13:97473907-97473929 AGGATGCATCAGAATCCATGTGG + Intergenic
1113373253 13:109741422-109741444 ATGAGGGAGCTGAAGTCATGGGG + Intergenic
1115347414 14:32358140-32358162 ATGATGTTTCAGAACCCTTGAGG - Intronic
1117445617 14:55801197-55801219 ATGATGTTCCAAAAGCCATTTGG + Intergenic
1118127787 14:62928201-62928223 ATGATCCTGCAGAAGTCATGCGG + Intronic
1120153803 14:81068113-81068135 ATAATTTGGCAGAATCCATGAGG + Intronic
1125881709 15:43201261-43201283 ATTATGTAGCAGAAGACATATGG + Intronic
1128273237 15:66330539-66330561 ATGTTGTAGCACTAGCCATGTGG + Intronic
1128552474 15:68607314-68607336 ATGAGGAAGCTCAAGCCATGTGG - Intronic
1129465566 15:75722527-75722549 ATGATGGGGCAGAAGCAGTGAGG + Intergenic
1130333876 15:82942438-82942460 ATGTTGTACCAGGGGCCATGTGG - Intronic
1132090118 15:98941185-98941207 ATAATGTAACAGACCCCATGGGG + Intronic
1132267380 15:100486231-100486253 ATAATCTAGCAGAAGCTATCCGG - Intronic
1133405455 16:5520888-5520910 ATGAAGGAGCAGACCCCATGTGG - Intergenic
1133585599 16:7191428-7191450 ATGATGTGTTACAAGCCATGAGG - Intronic
1134289751 16:12894439-12894461 AAAATGTAGCAGAAGTGATGGGG + Intergenic
1134786938 16:16953091-16953113 TTGATGTTGCAGCAGCCATTGGG + Intergenic
1137352219 16:47723453-47723475 ATGATGCAGCAAAAGGCACGTGG - Intergenic
1137448764 16:48550990-48551012 ATTATGTAGAAGAAACCCTGAGG + Intronic
1137633664 16:49966882-49966904 ATGATGTACTAGAAGAAATGAGG - Intergenic
1138444191 16:57053194-57053216 TAGATGTGGCAGAAGCCATCAGG + Intronic
1139132134 16:64159243-64159265 GAAATGAAGCAGAAGCCATGAGG + Intergenic
1139188965 16:64839612-64839634 ATCATGTTGGAGAAGCCAAGTGG - Intergenic
1140702956 16:77599336-77599358 AAACTGTAGGAGAAGCCATGAGG + Intergenic
1142269136 16:89080029-89080051 CTGATTTGGCACAAGCCATGGGG + Intergenic
1146552213 17:33791150-33791172 ATGAGATGGAAGAAGCCATGAGG + Intronic
1146657169 17:34641400-34641422 ATGCTGCAGCAGAAAGCATGAGG + Intergenic
1148814179 17:50314786-50314808 ATGCTGGAGCAGAAGCCAGTGGG + Intergenic
1149269884 17:54966848-54966870 ATGATGAAGCAGAAGACAAAAGG - Intronic
1155345975 18:24857235-24857257 CAGATATAGCAGAAGCCAAGTGG + Intergenic
1155612144 18:27677866-27677888 TTGCTGTAGCAGAAGGCATGTGG + Intergenic
1157709479 18:49840289-49840311 ATTTTGTAACAGAAGTCATGGGG + Intronic
1158644067 18:59228729-59228751 TTCATGTTGCAGAAACCATGGGG - Intronic
1161482133 19:4516570-4516592 CTGATGTGGCAGGAGCCCTGGGG - Intronic
1162082110 19:8224452-8224474 ATGAGGTAGGAGAACCCAGGAGG + Intronic
1164740884 19:30574843-30574865 AGGATTTAGCAGAAGTCAGGAGG - Intronic
1164903151 19:31945495-31945517 ATGATGGAACAGAAGGCAAGAGG - Intergenic
1167651070 19:50729280-50729302 ATGATGAAGCCAAAGCAATGAGG - Intergenic
1168329628 19:55559729-55559751 ATGATGTGGCAAAGGACATGTGG - Intergenic
1168415297 19:56163982-56164004 CTGATGGAGCAGGTGCCATGAGG + Intergenic
926999637 2:18780433-18780455 ATGATCTAACAGAAGGTATGTGG - Intergenic
930393056 2:50785751-50785773 AGGATGAAGCAGAAGTCACGTGG + Intronic
931214737 2:60230390-60230412 TTGATGGAGCAGAAGCACTGGGG - Intergenic
931997966 2:67857114-67857136 ATACGGTAGCAGAAGTCATGAGG + Intergenic
934770977 2:96907460-96907482 AGGAGGAGGCAGAAGCCATGGGG + Intronic
935135883 2:100301372-100301394 TGGATGCAGCTGAAGCCATGAGG - Intronic
935507215 2:103920418-103920440 AAGATGTGTTAGAAGCCATGGGG + Intergenic
938239597 2:129733158-129733180 ATGGTGTCGCAGGAGCCAAGAGG - Intergenic
938340466 2:130532729-130532751 ATGATCTATCACATGCCATGAGG - Intergenic
938349364 2:130587990-130588012 ATGATCTATCACATGCCATGAGG + Intergenic
938743353 2:134253564-134253586 ATGCTGTAGCACAAGAAATGTGG - Intronic
939646235 2:144702338-144702360 ATAATGGAGCAGAAGTCATAGGG - Intergenic
941894337 2:170614110-170614132 AGGGTGTAGTAGAAGCAATGGGG + Intronic
942750118 2:179277338-179277360 CTGAGGTAGCAGTGGCCATGGGG + Intergenic
943569842 2:189560264-189560286 ATGAAATAAGAGAAGCCATGTGG - Intergenic
944332235 2:198484097-198484119 AACAAGTTGCAGAAGCCATGTGG + Intronic
945886139 2:215377708-215377730 AAGATATAGCAGAAGCCAGTGGG + Intronic
1169854107 20:10084731-10084753 ATGGTGTGGCAGAAACCAAGAGG - Intergenic
1169997016 20:11569928-11569950 TTGATTAAGCAGAATCCATGAGG + Intergenic
1170815810 20:19713393-19713415 ATAATGTTCCAGAAGCAATGTGG - Intronic
1170849184 20:19988508-19988530 ATGCTGCAGCAGAACCCAAGGGG + Intronic
1172138557 20:32705178-32705200 ATTGTCTAGTAGAAGCCATGTGG - Intronic
1172805525 20:37609099-37609121 ATGGTGTAGGTGAAGCCATGGGG - Intergenic
1173900121 20:46581528-46581550 GTGAGGAAGCAGAAGCCAGGAGG + Intronic
1174962158 20:55170772-55170794 TTAATGTAGCAAGAGCCATGAGG + Intergenic
1175883889 20:62277302-62277324 ATGATAGAGAAGAAGCCTTGTGG + Intronic
1176869704 21:14075040-14075062 CTGTTGTAGCAGAGGGCATGGGG + Intergenic
1177888466 21:26775806-26775828 ATGAAGGAGCTGAAGCCATCTGG - Intergenic
1177924184 21:27193568-27193590 ATGATGTGGCAGAAGACAAGAGG + Intergenic
1180168137 21:46040595-46040617 ATGATGGAGAAGAAGGCCTGTGG - Intergenic
1182762218 22:32731805-32731827 ATGATGTAGTAGAGGCCATATGG + Intronic
949203642 3:1411529-1411551 ATGGTGTCACAGAAGCCATGAGG + Intergenic
950117005 3:10457465-10457487 ATGATGTATCAGTGGACATGTGG + Intronic
950585128 3:13886881-13886903 AGGAGGTGGCAGAAGCCATTAGG + Intergenic
951047672 3:18059172-18059194 AGGATGTAGCAGCTGCCATAAGG - Intronic
952820415 3:37481535-37481557 ATGATGTAGCAGAAGCCATGGGG - Exonic
953645186 3:44747075-44747097 ATCCTGTAGGAGTAGCCATGTGG - Intronic
954046861 3:47939033-47939055 AGGCTCTAGCAGGAGCCATGAGG - Intronic
954711336 3:52506477-52506499 CCCATGTGGCAGAAGCCATGTGG + Intronic
956185161 3:66555527-66555549 ATGTTTTACCAGAAGCCAAGAGG + Intergenic
956204857 3:66744661-66744683 ATCATTTAGGAGAAACCATGTGG + Intergenic
956514566 3:70032891-70032913 ATGATGTAGCAGATGCTTTGGGG + Intergenic
957241345 3:77664853-77664875 GAGATGTAGCTGAAGTCATGGGG - Intergenic
957830201 3:85506690-85506712 AGTAAATAGCAGAAGCCATGGGG - Intronic
957997151 3:87705250-87705272 ATGATACAGCAGAAGACAAGTGG + Intergenic
959622232 3:108410887-108410909 AGGAGGCAGCCGAAGCCATGGGG - Exonic
962835204 3:139183650-139183672 ATGAGATAGCAAAAGCCTTGAGG - Intronic
963855096 3:150245184-150245206 ATGATGCAGTAGAAGCTATGAGG - Intergenic
964476412 3:157101644-157101666 ATGCTGTTGCAGATGCCATGAGG - Intergenic
966175812 3:177136822-177136844 ATGATTTAGTAAAAGCCCTGGGG - Intronic
966748435 3:183300113-183300135 ATTATGCAGCAGATGCCATCAGG - Exonic
972149018 4:36065294-36065316 CTGCTGTAGCTGCAGCCATGAGG - Intronic
972163611 4:36255725-36255747 AGGATGCCACAGAAGCCATGTGG - Intergenic
973141014 4:46768052-46768074 ATGCTGTAGCACACGCCATTTGG - Intronic
976108122 4:81641242-81641264 ATGATTTAGCAGAAAGAATGGGG - Intronic
977333084 4:95662534-95662556 ATGACGTAGCAGCAACCATGTGG - Intergenic
977567079 4:98591836-98591858 AAGATTTAGCAAAAGCCCTGTGG - Intronic
977979962 4:103309744-103309766 ATGGTGTAGCAGGAACCATGAGG + Intergenic
977984841 4:103370898-103370920 AAGCTGAAGCAGAATCCATGAGG - Intergenic
978994658 4:115135463-115135485 ATGATGTAGCTGGAGCAATCAGG + Intergenic
979163076 4:117488761-117488783 ATGAAGAAGCAGAAGCCTAGAGG + Intergenic
979289771 4:118966575-118966597 ATGAACTAGCAGCAGCCCTGGGG - Intronic
979560435 4:122095840-122095862 ATGATTTTGGAGCAGCCATGAGG + Intergenic
983593966 4:169445184-169445206 CTGATGTAGGAGAATCCTTGAGG + Intronic
986403155 5:7398510-7398532 ATGATTTAGCTGAAGGCAAGAGG - Intronic
987163506 5:15170011-15170033 ATGAGTTGGCAGAACCCATGAGG + Intergenic
988666507 5:33334218-33334240 ATGATGAAGCATAATCCCTGTGG - Intergenic
988679143 5:33467438-33467460 TTAATGTATCAGAAGCTATGGGG + Intronic
990949755 5:61286902-61286924 ATGAGGGAGCAGAAGCCATGAGG + Intergenic
991204104 5:64030331-64030353 AGGATGTATCAGAATCCCTGGGG + Intergenic
993025040 5:82635662-82635684 ACGATGTAAATGAAGCCATGTGG - Intergenic
994044310 5:95291081-95291103 ACCATGTAGCAGAAGCCGTCAGG + Intergenic
994388313 5:99159412-99159434 ATGATGTGCCAGAGGCTATGGGG - Intergenic
996947456 5:129087828-129087850 ATGAGGAAGCAGAAGCTGTGTGG + Intergenic
997901877 5:137774165-137774187 ATGGGGTATCAGAACCCATGTGG - Intergenic
1000366868 5:160500008-160500030 ATGAGGAAGCAGAAGCTATGAGG + Intergenic
1000917569 5:167100624-167100646 ATAATGTAGCAGGAGCAAAGGGG - Intergenic
1001097518 5:168787266-168787288 CTAGTGTAGCAGAAGCCACGGGG + Intronic
1004748597 6:18537880-18537902 ATGATGTGGCAGATGCCCTATGG - Intergenic
1005142394 6:22648019-22648041 ATGAAATTGCAGAAGCCAAGGGG + Intergenic
1005221996 6:23597553-23597575 GGGGTGTAGCAGCAGCCATGGGG - Intergenic
1005358430 6:25007713-25007735 ATGATACAGTTGAAGCCATGGGG - Intronic
1006846984 6:37069170-37069192 AGGAGGTAGCAGAAGACATCAGG + Intergenic
1010355605 6:74929015-74929037 AGGAAGTAGTAGAAGGCATGTGG + Intergenic
1011173539 6:84534422-84534444 TTTATGTAGCTGCAGCCATGTGG + Intergenic
1011534492 6:88361444-88361466 ATGGTGTAGCAGAGACAATGTGG - Intergenic
1011750053 6:90446566-90446588 AAGAAGCAGCAGAAGCCAGGTGG + Intergenic
1014306136 6:119744741-119744763 TTGATGTAACATAAGCCAAGTGG - Intergenic
1015135545 6:129865489-129865511 ATAATGGAGCAGAAGGCATCAGG - Intergenic
1017628413 6:156371431-156371453 ATGGTGTAGGAGAAGCCAAGCGG - Intergenic
1021256434 7:18397968-18397990 ATGATGTGGCTGAATCAATGAGG - Intronic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022126681 7:27364461-27364483 AAGACCAAGCAGAAGCCATGTGG - Intergenic
1022142993 7:27509361-27509383 GTGTAGCAGCAGAAGCCATGAGG + Intergenic
1024114506 7:46179524-46179546 AGGGTGGAGCAAAAGCCATGAGG + Intergenic
1027988325 7:85323873-85323895 ATGATGTAGTACAGGCCGTGTGG - Intergenic
1029670685 7:102028594-102028616 AGCATCTAGCAGAAGCCACGAGG + Intronic
1032608478 7:133385042-133385064 ATGGTGAAACAGAAGCCACGTGG - Intronic
1033313971 7:140282691-140282713 ATGATGTATCAGAAGCCCAGGGG - Intergenic
1033454376 7:141489399-141489421 ATGATGGAGAAGAAGCCAACCGG - Intergenic
1033790364 7:144785799-144785821 CTGATGAAGCAGGAGCCATAAGG + Intronic
1036627032 8:10480589-10480611 AGAATGTACCAGAAGCCAGGAGG + Intergenic
1036730172 8:11256003-11256025 CTGCTGTGGCCGAAGCCATGAGG + Intergenic
1037009152 8:13819254-13819276 AGGATGTTGCAGAAGGCCTGTGG - Intergenic
1037677601 8:21065231-21065253 ATGAAATAACAGAAGCCAGGTGG + Intergenic
1038936786 8:32260661-32260683 AGCATTTAGCAGAAGGCATGGGG - Intronic
1040939356 8:52817025-52817047 AGCAGGTAGCAGAAGCCATCAGG + Intergenic
1041394876 8:57379853-57379875 GTGATGTAACAGAATTCATGTGG + Intergenic
1043314082 8:78898332-78898354 TTGGTGTGGCAGAAGCCTTGAGG + Intergenic
1043547833 8:81335232-81335254 ATGATGATGCAGAAGCCATCTGG + Intergenic
1044003333 8:86912311-86912333 ATAATGTGGCAGAAGCTAAGGGG + Intronic
1045608740 8:103809943-103809965 ATGATGAAGCAGAAGGCATTTGG + Intronic
1046128905 8:109943413-109943435 ATGAGGTAGCAGAAGCCTAGTGG - Intergenic
1046531194 8:115447176-115447198 AAGATGTAGCAGAACCCAGAAGG - Intronic
1055064092 9:72101206-72101228 TAGTTGTAGCAGAAACCATGTGG + Intergenic
1186632627 X:11366517-11366539 ATGAAGGAGCAGAAGCCATGAGG + Intronic
1186986181 X:15016475-15016497 GTGATGGAACAGAACCCATGTGG + Intergenic
1187353379 X:18542933-18542955 AAGATGTAGCAGAGGCAATAAGG - Intronic
1189608146 X:42701982-42702004 ATGATCTGGAAGAAGCAATGAGG - Intergenic
1189854247 X:45208189-45208211 ATGATGTGGCTGCTGCCATGGGG + Intergenic
1191845496 X:65544415-65544437 ATGCTGTACTAGAAGCAATGGGG + Intergenic
1192442470 X:71184931-71184953 AGGATGCAGCAGAAGCCAGGAGG + Intergenic
1193275353 X:79580074-79580096 ATGATTTAGCATTAGCCATTTGG + Intergenic
1193886986 X:86994488-86994510 CTGCTGTGGCAGTAGCCATGGGG + Intergenic
1194457534 X:94123534-94123556 CTGAGGTAGCAGTGGCCATGAGG - Intergenic
1195282629 X:103350639-103350661 ATGAGGAAGCTGAAGCCATGAGG + Intergenic
1195809896 X:108817639-108817661 CTGAGGTAGCAGCAGCCAAGTGG - Intergenic
1195941625 X:110172358-110172380 GTAATGTAGCATTAGCCATGTGG + Intronic
1196061966 X:111418156-111418178 GTGATATGGCAGAAGCCTTGTGG - Intergenic
1196473725 X:116058670-116058692 ATGGTGTGGCAGAAGGGATGGGG + Intergenic
1197232849 X:124024676-124024698 ATGAGGTAGCAGAGGCTGTGAGG - Intronic
1200069202 X:153519491-153519513 ATGAGGAAACCGAAGCCATGTGG + Intronic
1201524569 Y:14917498-14917520 CTGATGTAGAAGAATCCAGGAGG + Intergenic
1202047204 Y:20747215-20747237 ATAATGTGGAAGAAGCCAAGGGG - Intergenic