ID: 952820519

View in Genome Browser
Species Human (GRCh38)
Location 3:37482070-37482092
Sequence CAGTGCAGCCAGAAGCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 328}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952820519_952820527 8 Left 952820519 3:37482070-37482092 CCACACAGCTTCTGGCTGCACTG 0: 1
1: 0
2: 2
3: 29
4: 328
Right 952820527 3:37482101-37482123 TGTCCTGAGGCTGGGGGGAGAGG 0: 1
1: 0
2: 5
3: 124
4: 1218
952820519_952820526 3 Left 952820519 3:37482070-37482092 CCACACAGCTTCTGGCTGCACTG 0: 1
1: 0
2: 2
3: 29
4: 328
Right 952820526 3:37482096-37482118 ACAGATGTCCTGAGGCTGGGGGG 0: 1
1: 1
2: 3
3: 47
4: 388
952820519_952820522 -1 Left 952820519 3:37482070-37482092 CCACACAGCTTCTGGCTGCACTG 0: 1
1: 0
2: 2
3: 29
4: 328
Right 952820522 3:37482092-37482114 GTGGACAGATGTCCTGAGGCTGG 0: 1
1: 0
2: 6
3: 173
4: 2541
952820519_952820529 17 Left 952820519 3:37482070-37482092 CCACACAGCTTCTGGCTGCACTG 0: 1
1: 0
2: 2
3: 29
4: 328
Right 952820529 3:37482110-37482132 GCTGGGGGGAGAGGAGACCCAGG 0: 1
1: 0
2: 2
3: 72
4: 765
952820519_952820524 1 Left 952820519 3:37482070-37482092 CCACACAGCTTCTGGCTGCACTG 0: 1
1: 0
2: 2
3: 29
4: 328
Right 952820524 3:37482094-37482116 GGACAGATGTCCTGAGGCTGGGG 0: 1
1: 0
2: 4
3: 39
4: 314
952820519_952820525 2 Left 952820519 3:37482070-37482092 CCACACAGCTTCTGGCTGCACTG 0: 1
1: 0
2: 2
3: 29
4: 328
Right 952820525 3:37482095-37482117 GACAGATGTCCTGAGGCTGGGGG 0: 1
1: 0
2: 6
3: 39
4: 337
952820519_952820523 0 Left 952820519 3:37482070-37482092 CCACACAGCTTCTGGCTGCACTG 0: 1
1: 0
2: 2
3: 29
4: 328
Right 952820523 3:37482093-37482115 TGGACAGATGTCCTGAGGCTGGG 0: 1
1: 0
2: 7
3: 200
4: 2721
952820519_952820521 -5 Left 952820519 3:37482070-37482092 CCACACAGCTTCTGGCTGCACTG 0: 1
1: 0
2: 2
3: 29
4: 328
Right 952820521 3:37482088-37482110 CACTGTGGACAGATGTCCTGAGG 0: 1
1: 0
2: 1
3: 36
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952820519 Original CRISPR CAGTGCAGCCAGAAGCTGTG TGG (reversed) Intronic
900332714 1:2144225-2144247 CAGTGCAGCGAGAGGATATGGGG + Exonic
901440294 1:9273550-9273572 CAGAGCAGCCCTAAGCTGTTGGG - Intergenic
902451289 1:16498643-16498665 CAGGGCCGCCGGATGCTGTGCGG - Intergenic
902501584 1:16914639-16914661 CAGGGCCGCCGGATGCTGTGCGG + Intronic
903133530 1:21294218-21294240 CAGGGCACCCAGACTCTGTGAGG - Intronic
904123082 1:28215933-28215955 CACTGCAGCCTCAAGCTCTGGGG + Intronic
905324244 1:37139261-37139283 CAGGGAAACCAGAAGATGTGGGG + Intergenic
906088375 1:43156089-43156111 CAATGCAGCCACAGGCTGGGAGG + Intronic
906519257 1:46457673-46457695 CAGTGCTGTCACCAGCTGTGTGG + Intergenic
907225483 1:52942477-52942499 CAGTGCAGCCAGATGCAGCCTGG - Intronic
907277716 1:53326458-53326480 CAGTGCGGCCCGGAGCTGCGTGG + Intronic
907513476 1:54979310-54979332 GAGTGGAGCCAAAAGCTCTGTGG + Intergenic
910245627 1:85135308-85135330 CACTGCAGCCTCAAGCTGTTGGG + Intergenic
910456029 1:87398140-87398162 CAGTGCATTCAAAAGCTATGTGG - Intergenic
912375186 1:109203997-109204019 CAGTGCAGCCTCAAGCTCTTGGG + Intronic
912443711 1:109717431-109717453 CAGTGATGCCAGAAGATGGGAGG + Exonic
914974621 1:152349868-152349890 CAGTGCAACCATATGCAGTGGGG - Exonic
915016887 1:152742753-152742775 CAGTGCTATGAGAAGCTGTGGGG - Intronic
916069392 1:161161035-161161057 CAGTGCAGCCCCAAGCTCTCCGG - Exonic
917128243 1:171711966-171711988 CAGTGCAGTCACATGCTGTACGG + Intronic
917615818 1:176743129-176743151 CCTGGCAGCCAGAATCTGTGAGG + Intronic
917638097 1:176956474-176956496 CAGAGCAGAGACAAGCTGTGAGG - Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
918247421 1:182672094-182672116 CTCTGCACCCAGAGGCTGTGCGG + Intronic
918341305 1:183569995-183570017 CAGTTCAGCCAGAGGCCATGAGG - Intronic
920297335 1:204967091-204967113 CAGAGCTGCCAGGAGCTGGGAGG - Intronic
923139804 1:231151643-231151665 CAGTGCAGACAGGAAATGTGAGG - Intergenic
923394476 1:233547408-233547430 CAGTGCAGGGAGAAGGTGTCTGG - Intergenic
1062868335 10:876608-876630 CAGTCCACCCAGCAGCTGTCAGG + Intronic
1063288443 10:4715070-4715092 CAGGGCTGCATGAAGCTGTGTGG - Intergenic
1064339231 10:14471830-14471852 CAGTACAGTCACATGCTGTGCGG + Intergenic
1065021515 10:21505888-21505910 CAGTGCTGAGAGAAGCAGTGTGG - Intergenic
1065225002 10:23534508-23534530 CCGTGCAGGCAGAAGCAGTGGGG - Intergenic
1065538342 10:26736256-26736278 CAGTACAGCCACAAGCCATGTGG - Intronic
1065824311 10:29556040-29556062 CAGTGCTGCCAGAAACATTGGGG - Intronic
1067562615 10:47314508-47314530 CAGGGCAGCCAGAAGCCAAGAGG - Intergenic
1068194462 10:53698002-53698024 TAGTGCAGCCAGCAGTTCTGAGG - Intergenic
1070503438 10:77092635-77092657 CAGTGCAGGAGGAAGCTGAGAGG + Intronic
1070570301 10:77636254-77636276 CACTCCAGCCAGTGGCTGTGGGG + Intronic
1072250742 10:93580639-93580661 CAGTGCAGAGAGATGCTCTGTGG - Intronic
1073897942 10:108184646-108184668 CAGTGCAGAAAGAAAATGTGGGG + Intergenic
1073965270 10:108981699-108981721 CACTGCAGCCACTAGCAGTGTGG - Intergenic
1074472666 10:113741677-113741699 CACTGCAGCCTGAACCTCTGGGG - Intergenic
1075807708 10:125202069-125202091 CAGAGAAGCCAGCAGATGTGGGG - Intergenic
1076595365 10:131621920-131621942 CAGTGAAGCCGGGAGCTGCGTGG + Intergenic
1076858390 10:133128321-133128343 CAGGCCATCCAGCAGCTGTGGGG - Exonic
1077096018 11:799487-799509 CTGGGCAGCCAGGGGCTGTGGGG - Exonic
1077227344 11:1444225-1444247 GAGTGCCCCCAGCAGCTGTGGGG + Intronic
1077244694 11:1530820-1530842 CAGTGCAGGAATAACCTGTGGGG + Intergenic
1077387700 11:2278906-2278928 CCATGCAACCAGAAGCTGTCCGG + Intergenic
1077613987 11:3661992-3662014 CAGTGCAGCCTGAATCTCTCAGG - Intronic
1077975053 11:7239267-7239289 CAGTGGAGCCAGAATCTTGGCGG - Intronic
1079323642 11:19473150-19473172 AACTGAAGCCAGAAGCTATGTGG + Intronic
1080574485 11:33585744-33585766 CCTTCCAGCCAGAAGCTATGTGG - Intronic
1082752200 11:57031349-57031371 CAGTGCCTCCCCAAGCTGTGGGG - Intergenic
1082888078 11:58109407-58109429 CAGTGTGGCCAGAATCTGAGGGG + Intronic
1083323600 11:61862407-61862429 CAGTCCAGCCAGAGGCAGGGAGG + Intronic
1083484630 11:62975580-62975602 CTCTGCTGCCAGGAGCTGTGAGG - Intronic
1083797053 11:65022999-65023021 GAGTGCAGCCAGAGGGTGGGAGG + Intronic
1084212783 11:67631588-67631610 CAGTGATGCCAGAAGCCCTGGGG - Exonic
1084605966 11:70171890-70171912 CACTGCAGCCACAACCTATGTGG - Intronic
1084927467 11:72525013-72525035 CAGGGGAGAGAGAAGCTGTGAGG - Intergenic
1085766507 11:79287852-79287874 CACTGCATCAGGAAGCTGTGGGG + Intronic
1087735478 11:101827846-101827868 CAGGGCTGCCTGAAGCTGTAGGG - Intronic
1088827655 11:113509191-113509213 CAGTGCAGCCCTACACTGTGAGG - Intergenic
1090674013 11:128972498-128972520 CAGAGCAGCCACCAGTTGTGGGG - Exonic
1090844639 11:130520435-130520457 CAGTGGTGTCACAAGCTGTGTGG + Intergenic
1091227034 11:133963730-133963752 CAGTGGCTCAAGAAGCTGTGAGG + Intergenic
1093973186 12:25393106-25393128 CTGTGGAGCAAGAGGCTGTGAGG - Intergenic
1094439845 12:30462930-30462952 GTGTTCAGCCAGAAGCTGAGAGG - Intergenic
1096055015 12:48643278-48643300 CAGTGCAGTCACATGCTGTACGG - Intergenic
1096106844 12:49001005-49001027 CAGTGCAGCTGGCAGGTGTGTGG - Intergenic
1100024579 12:90112305-90112327 CACTGCAGGCACAACCTGTGTGG + Intergenic
1101282111 12:103269020-103269042 CAGGGCTGCCAGGAACTGTGAGG + Intronic
1101729480 12:107415051-107415073 AAGTTCAGACGGAAGCTGTGAGG - Intronic
1103075248 12:117976886-117976908 CTGTGCAGGCACAAGTTGTGTGG + Intergenic
1104225600 12:126829897-126829919 CACTGCAGCCACAAGCTCTGGGG + Intergenic
1104746874 12:131216129-131216151 CAGAGCAGACAGAAACTCTGGGG - Intergenic
1104785743 12:131447054-131447076 CAGAGCAGACAGAAACTCTGGGG + Intergenic
1104856549 12:131904959-131904981 CAGGGCTCCCAGCAGCTGTGGGG - Intronic
1105213718 13:18272633-18272655 GAGTGCAGGCAGGGGCTGTGAGG - Intergenic
1105429951 13:20327229-20327251 CAGAGCTGCCAGAAGTTGTTAGG + Intergenic
1105585080 13:21736275-21736297 CAGTGCAGCCAGGCGCTGCTGGG - Intergenic
1106322229 13:28652149-28652171 CAGGGCTGCCAGAACTTGTGTGG - Intergenic
1106553040 13:30787952-30787974 CACTCCAGCTAGAAGCTGTTGGG + Intergenic
1107956476 13:45517957-45517979 CTGTGCAGACAGAATCTTTGAGG + Intronic
1108634864 13:52323287-52323309 CAGTGGCGCCAGAAGCAGTCTGG - Intergenic
1108652941 13:52499901-52499923 CAGTGGCGCCAGAAGCAGTCTGG + Intergenic
1110340503 13:74384798-74384820 CAGTGCAGAAAGAAAATGTGGGG - Intergenic
1110492407 13:76124738-76124760 CAGTGCAGAAGGAAACTGTGGGG + Intergenic
1110936926 13:81303062-81303084 CAGTGCAGCCACATGGTGGGAGG + Intergenic
1112041177 13:95550095-95550117 CAGTGAAGCCAGAATCTCTGGGG - Intronic
1112882374 13:104123448-104123470 CAGTGCAGAAAGAAAATGTGGGG + Intergenic
1113125244 13:106971072-106971094 CTGTGCAGACAGAAGCATTGAGG + Intergenic
1113609887 13:111636946-111636968 CAGTGTTGGCAGATGCTGTGTGG - Intronic
1113680202 13:112238605-112238627 CAGTGCAGCCACAGGCTGAAGGG - Intergenic
1113871165 13:113560734-113560756 CAATGTAGGCAGAAGCTGGGAGG + Intergenic
1114613758 14:24057795-24057817 CAGGGCACCGAGAAGCTGTGGGG - Exonic
1115933442 14:38524852-38524874 CAATGCAGGCAGATGCTGTGGGG - Intergenic
1116692372 14:48125817-48125839 CAGGCCAGACACAAGCTGTGTGG + Intergenic
1117650431 14:57899442-57899464 CAGTTCACAGAGAAGCTGTGAGG + Intronic
1118365004 14:65087224-65087246 CAGTGCAGACAGGAAATGTGGGG + Intronic
1118630670 14:67699512-67699534 CACTGCAGCCTCAACCTGTGAGG - Intergenic
1119736467 14:76985833-76985855 CTGAGCAGGCAGAAGCTGGGAGG + Intergenic
1120779073 14:88469616-88469638 CATAGCAGCCAGAGTCTGTGCGG + Exonic
1122624768 14:103078909-103078931 CAGTGCAGCCAGAGGATGTGAGG + Intergenic
1122896665 14:104760985-104761007 GGGTGAAGCCAGAGGCTGTGGGG - Intronic
1124060485 15:26289472-26289494 AAGTGCAGCCAGAAGAACTGGGG - Intergenic
1125806136 15:42495459-42495481 CAGTCCTGCCCGAAGCTGGGAGG - Exonic
1126292165 15:47094065-47094087 CATTGCAGTCAGAAAATGTGAGG - Intergenic
1127482665 15:59391673-59391695 CAGGGCAGCCAGAAGGTAGGGGG + Intronic
1129718148 15:77863671-77863693 CAGGGCAGCCAGGAGCCATGGGG - Intergenic
1130960150 15:88653666-88653688 CAGTGCAGGCAGGAGCTGCCTGG - Intronic
1131830602 15:96352449-96352471 CAGTGTTGCCACGAGCTGTGCGG - Intergenic
1131854872 15:96582870-96582892 CAGTGCAGGCAGGAGCTGGTGGG - Intergenic
1132877771 16:2148046-2148068 CACAGCAGGCAGAAGCTGTGGGG + Intronic
1132926028 16:2429531-2429553 CAGGGCAGGCAGAAGGGGTGTGG - Intronic
1132937355 16:2487924-2487946 AACAGCAGCCAGCAGCTGTGGGG + Intronic
1132987368 16:2774653-2774675 CTGTGGACCCAGCAGCTGTGTGG - Intronic
1133256641 16:4521185-4521207 CAGTGCGGAAACAAGCTGTGGGG - Intronic
1136064421 16:27749310-27749332 CAGGACAGTCAGAAGCTGTGTGG + Intronic
1137287789 16:47030712-47030734 CAGGCCAGCCAGGAGCTGTCTGG - Intergenic
1138703126 16:58886082-58886104 CAGTGCAGTAAGAAACTGGGAGG + Intergenic
1140040352 16:71403323-71403345 CAGTGCTGAGAGAAGATGTGGGG + Intergenic
1140468826 16:75203676-75203698 CAGTGGATGCAGAAGGTGTGAGG + Intergenic
1140880136 16:79190506-79190528 CAGTGGAGCCAGAGGGTGTGAGG - Intronic
1142814776 17:2416556-2416578 CAGTGCGGCCAGCATGTGTGGGG + Exonic
1147139689 17:38454072-38454094 CAGGGCAGCCAGAGGCAGCGCGG - Intronic
1147776294 17:42904055-42904077 CCCTGCAGACAGAAGCTGAGTGG + Intronic
1148347824 17:46915364-46915386 AAGTGCTGCAAGAAGCTGAGTGG + Intergenic
1151338890 17:73457149-73457171 CAGTGAAATCAGAAGCTTTGGGG - Intronic
1151756888 17:76080247-76080269 CAGTCCACCCAGAGCCTGTGGGG - Exonic
1152538989 17:80965425-80965447 TGGTGCAGACAGGAGCTGTGTGG + Exonic
1153820607 18:8828362-8828384 CAGTGCAGAGAGAAGCCGTGAGG + Intronic
1154024569 18:10695440-10695462 CAGGGTGGCCAGAAGCTGTCAGG - Intronic
1155509938 18:26566427-26566449 CAGGACAGCCAGAAGGTGTTCGG - Intronic
1155532889 18:26785498-26785520 TAGTGTAGACAGAAGATGTGTGG + Intergenic
1156979571 18:43268644-43268666 GAGTGGAGCAAGATGCTGTGAGG + Exonic
1158059784 18:53325846-53325868 CAGTGCAGCCATTATCTGTCTGG - Intronic
1158946148 18:62448589-62448611 AATTCCAGCCAGAGGCTGTGAGG - Intergenic
1160888540 19:1364280-1364302 CAGTGAAACCAGCAGCTGAGTGG - Intronic
1160941756 19:1623325-1623347 CGGGGCAGCCTGAAGCTGTGAGG + Intronic
1161428521 19:4217511-4217533 CAGGGCCGCCCGCAGCTGTGTGG - Exonic
1163910158 19:20182421-20182443 CAGAACAAACAGAAGCTGTGGGG - Intronic
1164677264 19:30109832-30109854 CAGTTCAGCCAGAGGCCGAGGGG - Intergenic
1164944737 19:32283896-32283918 CAGTGATGCCTGAAGCTGAGGGG - Intergenic
1165601451 19:37058417-37058439 CAGTCCATCCAGAAGCAGAGGGG - Intronic
1165775087 19:38399481-38399503 CAGTGCAGGCTGAAGTGGTGGGG + Intergenic
1165775641 19:38403058-38403080 CAGTGCCGCCGGACGCTGCGGGG + Intergenic
1166254034 19:41589773-41589795 CAGTGAAGCCTCAAGGTGTGTGG - Intronic
1166343787 19:42153024-42153046 CGGGGCAGCCAGCAGCTCTGGGG - Intronic
1167200563 19:48062252-48062274 CAGTGTAGACAGCAGTTGTGAGG + Intronic
1167970016 19:53183518-53183540 AAGTACAGCCAGAAGGTGGGGGG - Intronic
1168044972 19:53788060-53788082 CATTACAGCCAGACGCTGTAAGG - Intergenic
1168304759 19:55429430-55429452 CAGAGCAGCTAGAAGCCGTGGGG + Exonic
1168324947 19:55533743-55533765 CTCTGCAGCCAGATGCAGTGGGG + Intronic
1168327486 19:55545624-55545646 CTGCGCAGCGAGAACCTGTGGGG - Intergenic
925200047 2:1959800-1959822 CAGTGCAGCCACATACGGTGTGG + Intronic
925628027 2:5861711-5861733 CAATGCAGCCAAAATGTGTGTGG - Intergenic
925665756 2:6253897-6253919 CATTGCACCCAGATGCCGTGGGG + Intergenic
925687913 2:6492245-6492267 CATTGCAGCCAGATGGTGAGAGG + Intergenic
928263385 2:29788084-29788106 AAGAGCAGACAGAGGCTGTGAGG - Intronic
929822682 2:45286029-45286051 CAGTACAGCCCCAAGCTCTGGGG + Intergenic
930381419 2:50635001-50635023 TAGAGCAGCCAGATGCTATGGGG - Intronic
931411082 2:62032458-62032480 CACTGCAGCCAGGAACTCTGGGG - Intronic
932411954 2:71552887-71552909 CAGTCCAGCCAGGAGCTATTGGG + Intronic
933758257 2:85657537-85657559 GTGTGGAGCCAGAGGCTGTGGGG + Intronic
934300608 2:91774116-91774138 GAGTGCAGGCAGGGGCTGTGAGG + Intergenic
936071406 2:109374120-109374142 GAGTGGAGGCAGAACCTGTGAGG - Intronic
936386317 2:112032756-112032778 CAGTGCAGCCTTGAGCTTTGAGG - Intergenic
937093323 2:119221015-119221037 CAGAGTAGGCAGGAGCTGTGGGG + Intergenic
937116227 2:119406905-119406927 CACTGCAGCCAGAGGCTGTGTGG + Intergenic
937182753 2:120011359-120011381 CAGTGAAAACAGAAGCTCTGAGG - Intergenic
937937366 2:127256992-127257014 CAGAACAGCAGGAAGCTGTGCGG + Intergenic
938279446 2:130053700-130053722 CAGTGCAGACCTAGGCTGTGGGG - Intergenic
939270928 2:139938457-139938479 CTGTGTAGACAGAAGCTATGTGG - Intergenic
940758869 2:157715459-157715481 CAAGGCAGCCAGAATTTGTGAGG - Intergenic
943597094 2:189871453-189871475 CAGTGCAGCCAAAATCCTTGCGG + Intronic
944381796 2:199119022-199119044 CAATGCTGCCACATGCTGTGTGG + Intergenic
946879123 2:224159978-224160000 CATTCCAGCCAGAAGCAGAGAGG - Intergenic
947462686 2:230317232-230317254 CAGGCCAGCCAGACGCTGTGTGG - Intergenic
947471876 2:230408575-230408597 CAGGCCAGCCAGATGCTGTTTGG - Intergenic
947615694 2:231555416-231555438 AAGGGCAGCCCCAAGCTGTGGGG + Intergenic
948568291 2:238900344-238900366 CGGTGTGGCCAGAAGCTGTAGGG + Intronic
948789767 2:240371239-240371261 CAGCTCAGCCAAATGCTGTGGGG + Intergenic
1169116977 20:3072212-3072234 CAGTCCGGCCAGAAGGCGTGCGG + Exonic
1169118694 20:3083021-3083043 CAGTCCGGCCAGAAGGCGTGCGG - Exonic
1169123464 20:3110996-3111018 CAGGGCTGCCAGTAGCAGTGAGG - Intronic
1170634304 20:18091681-18091703 CATTGCAGCCAAAATCTGTGGGG + Intergenic
1170654695 20:18275704-18275726 CAGTTCAGCCAGAGGGTGAGTGG + Intergenic
1171058600 20:21933337-21933359 CAGTCCAGTCTGAAGCTGGGAGG - Intergenic
1173604991 20:44325493-44325515 CACTGCAGCCTCAAGCTCTGGGG - Intergenic
1173908881 20:46649461-46649483 CAGAGCAGAGAGAAGCTGTCGGG + Intronic
1174579811 20:51563358-51563380 CTGGGCAGCCAGAGGCCGTGAGG - Intergenic
1175666445 20:60864105-60864127 CAGTGCTTCCTTAAGCTGTGGGG + Intergenic
1177686513 21:24444036-24444058 CAGTGAAGGCAGAAGATGAGGGG + Intergenic
1178312511 21:31541379-31541401 CAGTGCAGCCTCAACCTCTGGGG - Intronic
1179108463 21:38424599-38424621 CAGAGTAGACAGATGCTGTGGGG + Intronic
1179574183 21:42296772-42296794 CTGTGCAGCCATCAGCTGAGAGG - Exonic
1181202741 22:21227356-21227378 GAGTGCAGGCAGGGGCTGTGAGG - Intronic
1181597261 22:23924216-23924238 CAGTGTGGCCAGAAGTTTTGTGG - Intergenic
1181698963 22:24609249-24609271 GAGTGCAGGCAGGGGCTGTGAGG + Intronic
1182468430 22:30532343-30532365 CAGTTCAGCCACATACTGTGTGG + Intronic
1183056939 22:35312737-35312759 CATTGCAGACAGAAGCTCAGAGG + Intronic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184670572 22:46010432-46010454 CTGTGGACCCAGAAGCTCTGGGG + Intergenic
1203224175 22_KI270731v1_random:68057-68079 GAGTGCAGGCAGGGGCTGTGAGG + Intergenic
949655288 3:6210916-6210938 CAGAGCATCCAAAAGCTGTGGGG + Intergenic
949930666 3:9075878-9075900 TAGTGCCGCCAGCAGCTGGGTGG + Intronic
950120796 3:10481351-10481373 CAGGGCAGGCAGAAGCCCTGAGG - Intronic
950157721 3:10736256-10736278 CAGTGCAGCACTAAGATGTGAGG + Intergenic
950179012 3:10897825-10897847 CAGTGCAGACAGGAAATGTGGGG - Intronic
951460004 3:22941194-22941216 CAGTCCAGCCATAAGCAGTTGGG + Intergenic
951748965 3:26012618-26012640 CAGATCAGCCAGAAGGTGTGCGG - Intergenic
952804027 3:37329382-37329404 CAGTTCAGTCAGAATCTGTGAGG - Intronic
952820519 3:37482070-37482092 CAGTGCAGCCAGAAGCTGTGTGG - Intronic
954925078 3:54226837-54226859 CAAGGCAGCCAGAAGTTGAGAGG - Intronic
955404266 3:58615998-58616020 CAGTGGAGACAAAAGCTCTGAGG + Intronic
955442570 3:58973421-58973443 CTGTGAAGCCAGGAACTGTGTGG - Intronic
956593045 3:70935939-70935961 CACTGCAGCCTGAATCTCTGGGG + Intergenic
957870838 3:86089242-86089264 CAGTGCCTCCAGACTCTGTGTGG + Intergenic
960079805 3:113529414-113529436 CAGTGCAGACAGTATCTCTGTGG + Intergenic
961042211 3:123685516-123685538 CATTGCAGCCTCAAGCTCTGTGG - Intronic
961048633 3:123727277-123727299 CAGACCACCCAGAAGGTGTGGGG + Intronic
961214234 3:125147324-125147346 GAGTGCAGCCTGAAGCTGCAAGG - Intronic
962392425 3:134984267-134984289 CAGTGGAGCCCACAGCTGTGGGG - Intronic
962535582 3:136326442-136326464 CAGTGGAGCCAGAATCTGATTGG + Intronic
963062311 3:141234721-141234743 CAGTACAGCCAAATGCTGAGGGG + Intronic
964874126 3:161346927-161346949 CAGTGAGGCCAGAAGCTGTAGGG + Intronic
965773092 3:172201291-172201313 GAGAGCAGCCAGAAGCAGGGTGG - Intronic
966868813 3:184276962-184276984 CAGTGCAGCCAGCAGTAGAGAGG - Exonic
967254789 3:187578962-187578984 CAGTGAAGTAAAAAGCTGTGGGG + Intergenic
968316914 3:197732692-197732714 CACTCCAGCCAGATGCTCTGGGG - Intronic
968726641 4:2250958-2250980 CAGTGCAGCAGGGAGCTGGGAGG + Intronic
968944244 4:3655248-3655270 CAGGGCAGCCAGACTCTGAGGGG - Intergenic
969442516 4:7225872-7225894 CAGAGAAGGCAGAGGCTGTGTGG + Intronic
969612076 4:8232942-8232964 CCGTGGAGCCAGAAGCTCTGGGG + Intronic
971041286 4:22754988-22755010 CAGTGCAGCCAGGAGCAGCCTGG - Intergenic
974318766 4:60316311-60316333 AAGAGCATCCAGAACCTGTGAGG + Intergenic
979202278 4:117992929-117992951 TAGTGCAGCCAGTACCTGAGCGG - Intergenic
979911479 4:126372426-126372448 CAGCACAGGCAGAAGCTATGTGG + Intergenic
980351826 4:131693570-131693592 CAGTGCAGAAGGAAGATGTGGGG - Intergenic
982265685 4:153536467-153536489 CAGTGCAGCCTCTAGCTGTCAGG + Intronic
983802784 4:171956076-171956098 CACTGCAGCCTGAAACTCTGGGG + Intronic
985714528 5:1447933-1447955 CTGTGCAGGTAGAAGCAGTGTGG + Intergenic
985762799 5:1759819-1759841 CAGTGGAGACAGAGACTGTGTGG + Intergenic
986013666 5:3739335-3739357 CTGTGCAGCCTGAAGCTGGAGGG - Intergenic
986382889 5:7204522-7204544 TAGTGCAGCCAGAGACTGTTGGG + Intergenic
987142945 5:14963728-14963750 CACTGCAGCCTGAATCTCTGGGG + Intergenic
990633541 5:57697134-57697156 CAGTTCAGCCCGAAGCTGGCTGG + Intergenic
991971697 5:72147684-72147706 CAGTACAGACAGAAGGTGAGTGG + Intronic
995111750 5:108436873-108436895 CACTGCAGCCTCAAGCTCTGGGG - Intergenic
995527048 5:113058590-113058612 CAGGGCAGCCAGGAGCATTGTGG - Intronic
996570624 5:124929363-124929385 CAGTGCTGGCTGAGGCTGTGTGG + Intergenic
996985362 5:129555748-129555770 CAGTACAGTCAGAAGATCTGAGG - Intronic
998037755 5:138931204-138931226 GAGAGCAGCCAGAAGCCATGTGG + Intronic
999718248 5:154379442-154379464 CAGGGCAGCCAGCAGCTGCCTGG - Intronic
999806009 5:155081945-155081967 CAGAGCAGCCAGAGGCTGCATGG + Intergenic
1000948206 5:167448175-167448197 CAATGCAGCCAGTAGGGGTGGGG - Intronic
1001690733 5:173630833-173630855 CAGTGCAGGCAGTCACTGTGAGG - Intergenic
1001896237 5:175383890-175383912 CAATGCAGACAGAGGCTGAGTGG + Intergenic
1004039992 6:11966035-11966057 CAAGGCAGCCAGGAGCTCTGGGG - Intergenic
1004227326 6:13798057-13798079 AAGTGCAGTGAGAAGTTGTGAGG - Intronic
1004984941 6:21070859-21070881 CAGTGTTGGCAGCAGCTGTGAGG + Intronic
1005715968 6:28548872-28548894 CAGTGCAGCCATAAGGTCTTGGG + Intergenic
1006768791 6:36533482-36533504 CAGTGGTTCCAGAAGCAGTGAGG - Intronic
1006922778 6:37637405-37637427 CAGTCCAGCCCACAGCTGTGGGG - Exonic
1007125455 6:39422367-39422389 CAGAGCTGGCAGAAACTGTGTGG + Intronic
1007762452 6:44140963-44140985 CAGTGGAGCCAGGGGATGTGAGG - Intronic
1008522571 6:52376286-52376308 CTATGCAGGCAGAAGCTGTGTGG + Intronic
1009302497 6:62043303-62043325 CAGTGAAACCAGCAGCTTTGTGG + Intronic
1010752467 6:79631101-79631123 CAGCCCGGGCAGAAGCTGTGAGG - Intergenic
1011178858 6:84596049-84596071 CACTGCAGCCTCAACCTGTGAGG + Intergenic
1011380823 6:86740504-86740526 CAAAGCAGGCAGAAGATGTGGGG - Intergenic
1013688105 6:112609419-112609441 CAGTGCAGAAAGAAAATGTGTGG + Intergenic
1013827943 6:114237548-114237570 CAGTGGAACCAGAATCTGTGAGG - Intronic
1014116564 6:117674126-117674148 CAGTGCAGCCTGAAGAACTGAGG - Intergenic
1014206180 6:118657694-118657716 CAGTCCAGTCAGAAGCATTGAGG - Intronic
1015560971 6:134515385-134515407 CCATGCTGCCAGATGCTGTGAGG - Intergenic
1015775232 6:136807169-136807191 CAGGGGAGCCAGAAACTCTGGGG + Intergenic
1016870815 6:148814608-148814630 TAGTACAGCCAGAAGCTGACTGG - Intronic
1017658107 6:156649140-156649162 CTGAGCAGACAGAAGCTGGGAGG + Intergenic
1017744208 6:157432370-157432392 CAGTGCAGTCGGAGGCTGTGGGG + Intronic
1018048296 6:159984581-159984603 CAGTGCAGCGTCATGCTGTGTGG + Intronic
1018159183 6:161021271-161021293 GAGTGTAGACAGAAGCTGTTGGG + Intronic
1018853591 6:167659155-167659177 CACTGCAGCCAGAAGAAGGGAGG - Intergenic
1023967677 7:44971409-44971431 TAGTGCAGTCATGAGCTGTGTGG - Intronic
1024292999 7:47819203-47819225 CAGAGCACCCAGAGGCAGTGAGG + Intronic
1025227562 7:57178176-57178198 CAGTGCAGCCAGGAGCAGGCAGG - Intergenic
1025730313 7:64102136-64102158 CAGTGCAGCCAGGAGCAGGCAGG + Intronic
1026047470 7:66916814-66916836 CAGTGCAGCCTCAACCTGTCGGG - Intergenic
1026470791 7:70693248-70693270 CAGTGCCCCCAGAGGGTGTGGGG - Intronic
1026685408 7:72505285-72505307 CACTGCAGCCTGCAGCTGTCAGG - Intergenic
1026906079 7:74063469-74063491 CAGTGGAGCCAGGAGGTGTCTGG - Intronic
1030748307 7:113196698-113196720 CAGTGCAGACATAATCTGGGAGG + Intergenic
1031208473 7:118792545-118792567 CAGTGCAGAGAGAAAATGTGAGG - Intergenic
1032410953 7:131692946-131692968 CAATGCTGCCAGATGCTGAGTGG - Intergenic
1032517994 7:132521138-132521160 CACTGCAGCCGGAAGCTGAACGG + Intronic
1034104844 7:148481610-148481632 CAGCCCATCCAGAAGTTGTGGGG - Intergenic
1035126401 7:156611033-156611055 CAGTGCAGTCCGATGCTTTGGGG - Intergenic
1035472472 7:159119239-159119261 AGGGGCAGCCAGGAGCTGTGGGG - Intronic
1037665580 8:20966857-20966879 CAGTGATGCCAGAAGCCGAGGGG + Intergenic
1037842106 8:22252081-22252103 CTGCCCAGCCAGCAGCTGTGAGG + Exonic
1039435543 8:37556979-37557001 CCCTGCAGGGAGAAGCTGTGGGG - Intergenic
1040874090 8:52132100-52132122 GAGGACAGCCAGAAGCTGTGCGG + Exonic
1041765139 8:61411407-61411429 CAGTGGAGACAGAGGCTGGGTGG + Intronic
1042351126 8:67778828-67778850 CAATGGAGGCAGAAGCTGGGTGG - Intergenic
1042784357 8:72531283-72531305 CAGTGGAGCAAAAAGCTCTGGGG - Intergenic
1043078819 8:75738255-75738277 AAGTACATCCATAAGCTGTGAGG - Intergenic
1043784496 8:84380934-84380956 CAGCTCAGACAGAAGCTGGGTGG + Intronic
1044560966 8:93611836-93611858 CAGTGCAGCTGGAAAATGTGGGG - Intergenic
1045216904 8:100158059-100158081 CAGTGCAGCCAGAGCCGGTGCGG + Intronic
1047535097 8:125712386-125712408 CAGTGCAGAAAGAAAATGTGGGG + Intergenic
1048208561 8:132435371-132435393 CAGTTCAGCCAGAGGCGGGGAGG + Intronic
1048419362 8:134261768-134261790 CAGTGCAGAAAGAAAGTGTGGGG + Intergenic
1048489098 8:134875481-134875503 CACTGCAGCCACAACCTCTGAGG + Intergenic
1048804630 8:138228658-138228680 AAGAGCAACCAGAAGTTGTGGGG - Intronic
1049188001 8:141269137-141269159 CAGCGCAGCCTGGAGCTGTCGGG - Intronic
1049711948 8:144068781-144068803 CCTTGCAGCCAGGAGCTGGGAGG - Intergenic
1049829611 8:144692124-144692146 CAGGGAAGCCAAAGGCTGTGGGG - Intergenic
1050883943 9:10740092-10740114 GAATGCAGCCAGAATATGTGTGG + Intergenic
1051331554 9:16029447-16029469 CTGTGCTGACAAAAGCTGTGTGG + Intronic
1053199029 9:36140336-36140358 CTCTGCAGGGAGAAGCTGTGTGG + Intronic
1053619301 9:39799281-39799303 TAGTGCAGCCAGGACTTGTGGGG - Intergenic
1053780890 9:41606127-41606149 CAGTGCAGAAGGAAGATGTGGGG + Intergenic
1054168833 9:61816284-61816306 CAGTGCAGAAGGAAGATGTGGGG + Intergenic
1054264856 9:62908148-62908170 TAGTGCAGCCAGGACTTGTGGGG + Intergenic
1054668698 9:67764527-67764549 CAGTGCAGAAGGAAGATGTGGGG - Intergenic
1054816852 9:69483827-69483849 TATTGCAGCCAGGGGCTGTGGGG - Intronic
1054990792 9:71323852-71323874 AAGTACAGCCAGACCCTGTGTGG - Intronic
1055813390 9:80177897-80177919 CAGTGCAGAGAGAAAATGTGGGG - Intergenic
1056378317 9:86035465-86035487 CAGGGCAGCCTGCACCTGTGGGG + Exonic
1056555336 9:87683471-87683493 CACTGCAGCCTGAACCTCTGTGG + Intronic
1057442522 9:95092322-95092344 CAGAGCAGCCAGATGCTGGGTGG - Intergenic
1058933373 9:109744752-109744774 TAGTGTTGCCAGAGGCTGTGAGG - Intronic
1059878712 9:118665849-118665871 CAGTGCAGTCAGAGGATGTGGGG + Intergenic
1060542595 9:124440903-124440925 CAGTTCAGGCGGAAGGTGTGAGG + Intergenic
1060602270 9:124886263-124886285 CAGTGCAGAGAAGAGCTGTGAGG + Intronic
1061601234 9:131671515-131671537 CAGTGCCCCCAGAACCTCTGTGG - Intronic
1061825823 9:133257634-133257656 CAGAGGAGGCAGAAGCTGAGTGG - Intronic
1062085972 9:134648659-134648681 CAGTGCAGCAGGAGGCTGTGAGG + Intronic
1062447275 9:136600225-136600247 CAGAGCAGACAGAGGCTGGGAGG - Intergenic
1185747159 X:2583011-2583033 CAGGGCAGACAGAAGCTGTTTGG - Intergenic
1185776602 X:2808276-2808298 CAGTGCTGGGAGGAGCTGTGTGG + Intronic
1186562745 X:10630401-10630423 CAGTGATTGCAGAAGCTGTGAGG + Intronic
1187352832 X:18536784-18536806 CGGTGCAGCCAGAAGCTCTCAGG - Intronic
1189430827 X:40945511-40945533 CACTGCAGACAGCATCTGTGAGG + Intergenic
1191111042 X:56803317-56803339 CAGTGAACCAAGGAGCTGTGGGG - Intergenic
1193682709 X:84541583-84541605 CAGTGCAGAAAGAAAATGTGGGG + Intergenic
1193682754 X:84541828-84541850 CAGTGCAGAAAGAAAATGTGGGG + Intergenic
1194330963 X:92582593-92582615 CAGTGCAGAAAGAAAATGTGGGG + Intronic
1194657892 X:96595761-96595783 CAGTGCAACTAGAATTTGTGAGG - Intergenic
1194778179 X:97991246-97991268 CAGTGCAGAAAGAAAATGTGGGG - Intergenic
1197342432 X:125289108-125289130 CAGGGCTGCCAGAAGCCTTGGGG + Intergenic
1199747293 X:150781078-150781100 CAGAGCAGCAAAAAGCTGAGGGG + Intronic
1199810696 X:151345648-151345670 CAGAGATGCCAGGAGCTGTGTGG - Intergenic
1200639665 Y:5701659-5701681 CAGTGCAGAAAGAAAATGTGGGG + Intronic
1201321183 Y:12699939-12699961 GACTGCAGCCAGCAGCTGTGAGG + Intergenic
1201928564 Y:19316727-19316749 CAGTCCATCCAGAAGCTGCACGG + Intergenic
1201935844 Y:19410123-19410145 CAGTGCAGAAAGAAAATGTGGGG + Intergenic