ID: 952820553

View in Genome Browser
Species Human (GRCh38)
Location 3:37482283-37482305
Sequence CTCGCCAAGGGGCACTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952820542_952820553 30 Left 952820542 3:37482230-37482252 CCCAGGCAGATGCTGGAGAATTG 0: 1
1: 0
2: 1
3: 45
4: 379
Right 952820553 3:37482283-37482305 CTCGCCAAGGGGCACTTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 96
952820543_952820553 29 Left 952820543 3:37482231-37482253 CCAGGCAGATGCTGGAGAATTGG 0: 1
1: 0
2: 3
3: 23
4: 240
Right 952820553 3:37482283-37482305 CTCGCCAAGGGGCACTTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 96
952820547_952820553 0 Left 952820547 3:37482260-37482282 CCTGAATGTGGTTTTAAGAGCTC 0: 1
1: 0
2: 1
3: 11
4: 143
Right 952820553 3:37482283-37482305 CTCGCCAAGGGGCACTTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952820553 Original CRISPR CTCGCCAAGGGGCACTTGGA AGG Intronic
900358121 1:2274535-2274557 CTCCCCAGGGGCCACCTGGATGG + Intronic
901057287 1:6454498-6454520 CTCGCCAAAGGGCCCGAGGATGG - Intronic
901937287 1:12635635-12635657 CCCGGCAAGGGGCACTTAGGGGG - Intergenic
904328682 1:29744204-29744226 CTCACCCAGGGGCACATGGAAGG - Intergenic
906036355 1:42752466-42752488 CCACCCAAGGGGCACTTGGTGGG + Intronic
912797583 1:112702229-112702251 CTCCCCCAGGGGCACTCTGATGG + Intronic
913093262 1:115494222-115494244 CTTGCCATGGCTCACTTGGATGG + Intergenic
914803963 1:150979260-150979282 CTCTCCAAGGGGCTCCTGGCCGG - Intergenic
915895905 1:159810358-159810380 CACACAAAGGGGCACATGGAAGG + Intronic
1066465549 10:35646949-35646971 CAGGCCAAGGTGCACATGGATGG + Intergenic
1068598127 10:58925861-58925883 TTCGGTAAGGGGCAGTTGGAAGG + Intergenic
1073640381 10:105246613-105246635 CTCTTCGAGGGGCACATGGAAGG + Intronic
1075856962 10:125637946-125637968 ATCACCAAGGGGAAGTTGGAGGG - Intronic
1078645127 11:13135063-13135085 ATCCCCAAGGGACACTTTGAAGG + Intergenic
1082844368 11:57715623-57715645 CTCGCAGAGGGGGACTTGGCAGG + Intronic
1083617659 11:64034664-64034686 CTCCCCAAGGGGATCTGGGAGGG + Intronic
1084667948 11:70586572-70586594 CTGGCCAAGGGGCACATGCTGGG + Intronic
1089495021 11:118903376-118903398 CTCGCTGAGGGGCAGTTGGGTGG + Exonic
1098068859 12:66650114-66650136 CCCGCCGTTGGGCACTTGGAAGG - Intronic
1100398261 12:94203763-94203785 CTGGCCTATGGGCACTAGGAAGG + Intronic
1103907603 12:124335506-124335528 CTCGACAAGAGCCACCTGGAGGG - Exonic
1104584041 12:130033326-130033348 CTGTCTAAGGGGCTCTTGGATGG + Intergenic
1107817849 13:44260152-44260174 CTCTCCAGGGGTGACTTGGACGG + Intergenic
1107978601 13:45713729-45713751 CTTGCCACGGGGCACCTGCAGGG - Exonic
1113280918 13:108786475-108786497 CTGGCCAAGGGTCATTTTGAAGG - Intronic
1114508149 14:23233360-23233382 CTCGCAGAGGGGCATTTGGCAGG - Intronic
1118035752 14:61864550-61864572 CTCGCCATGCAGCACTTGGTAGG - Intergenic
1122412755 14:101534377-101534399 GGCGCCAAGGGGCACCTGGCTGG + Intergenic
1125889121 15:43252643-43252665 CCCACCAAGGGACATTTGGAAGG - Intronic
1127260490 15:57323420-57323442 CTCCCCAAGGGCTACTAGGATGG - Intergenic
1130383456 15:83391737-83391759 CTGGCCAGGGGCCACATGGATGG + Intergenic
1132409320 15:101564797-101564819 CTTGCCCAGGGCCACTTGGCTGG + Intergenic
1132568518 16:634155-634177 CTGGGCATGGGGCACCTGGAAGG - Intergenic
1132774886 16:1587899-1587921 CTCATCAAGGGGCACTGGAAAGG + Intronic
1133074618 16:3270842-3270864 CTCGCAGAGGGGGACTTGGCAGG + Intronic
1133592348 16:7257594-7257616 CTCGGGAAGGGGCTCTTGGTAGG - Intronic
1134752102 16:16633653-16633675 GCCACAAAGGGGCACTTGGATGG - Intergenic
1138642017 16:58395370-58395392 CTCGCAAAGGGGGATTTGGCAGG + Intronic
1144821283 17:18076494-18076516 CTGGGCAAGGGGCCCTTGCATGG - Intergenic
1145896315 17:28459718-28459740 CTCGCAAAGGGGGATTTGGCAGG - Intronic
1148925824 17:51084164-51084186 CTAGCCAATGAACACTTGGAAGG - Intronic
1149971027 17:61218535-61218557 CTCACCAAGAGGCACAGGGATGG + Intronic
1152862791 17:82705519-82705541 CTGGTCCAGGGGCCCTTGGATGG + Intergenic
1153052195 18:909486-909508 CTCTCCAAGCGCCACTCGGACGG + Exonic
1155308138 18:24498878-24498900 CTCGCCAAGGGGCTCTGGGTGGG + Intergenic
1159659771 18:71079577-71079599 CACGCCAAGGTGCCCTGGGAGGG - Intergenic
1163906322 19:20152074-20152096 CTCGCAAAGGGGGATTTGGCAGG + Intergenic
1164105471 19:22105990-22106012 CTCGCAGAGGGGGACTTGGCAGG - Intergenic
1166060180 19:40321122-40321144 GTGGGCAAGGGGCACTGGGAAGG - Exonic
1166714993 19:44961291-44961313 CTGGACCAGGGGCCCTTGGAGGG + Intronic
1166810101 19:45509282-45509304 CTCTCCAGGGCGGACTTGGAAGG - Intronic
928531874 2:32200787-32200809 CTCGCAGAGGGGGACTTGGCAGG - Intronic
930747456 2:54899632-54899654 CTCCCACAGGGGCACATGGAAGG + Exonic
934619642 2:95796424-95796446 CTCGGCCCGTGGCACTTGGAGGG - Intergenic
934641246 2:96028133-96028155 CTCGGCCCGTGGCACTTGGAGGG + Intronic
936938554 2:117860129-117860151 CACGCCAAGCGGCAGGTGGAAGG - Intergenic
937774807 2:125763446-125763468 CTGGCCAGGGGGCACCTGGAGGG + Intergenic
948146342 2:235710927-235710949 CTCCCCATGGGGCACTTGTCAGG - Intronic
1170612883 20:17928873-17928895 CTCGCCAAGGGCCCCTGGGGAGG - Intergenic
1172639448 20:36432079-36432101 CTCGCCACGGGGAAATTGGAGGG - Exonic
1173538362 20:43832723-43832745 TTCGACACAGGGCACTTGGAAGG - Intergenic
1174497569 20:50959210-50959232 CTCGCCATGCAGCACTTGGCGGG - Exonic
1175362097 20:58420456-58420478 GTCATCAAGGGTCACTTGGATGG + Intronic
1175949843 20:62577596-62577618 CTCGCCCAAGGGCAGCTGGAGGG + Intergenic
1176096392 20:63346349-63346371 CGCCCCAAGGGGCCCTTGAAGGG - Exonic
1177586477 21:23102403-23102425 CTTGCCAAGGGGCACCTGGGAGG - Intergenic
1182299654 22:29330469-29330491 GTCGCCAAGAGGAACGTGGAGGG - Exonic
952820553 3:37482283-37482305 CTCGCCAAGGGGCACTTGGAAGG + Intronic
953414504 3:42707991-42708013 CTCGCCATGGTGAACTTGGAGGG - Intronic
955346123 3:58163241-58163263 CTCCCCAACGCGCACTTTGAAGG - Exonic
961090892 3:124111950-124111972 CTCTACCAGGAGCACTTGGAAGG - Intronic
962411955 3:135148827-135148849 CTGGTCAAGGGGCTCTGGGATGG - Intronic
968289111 3:197525254-197525276 CACGCCAAGGGGCATTTGAAGGG - Intronic
970929872 4:21496987-21497009 CTCTCTAAGGGGCATGTGGAGGG + Intronic
971924287 4:32986796-32986818 CTGGCTCAAGGGCACTTGGAAGG - Intergenic
972329404 4:38050543-38050565 ATCACTAAGGGACACTTGGAAGG - Intronic
974156693 4:58082681-58082703 CTTGCCAAGGAGCACTTGCCTGG + Intergenic
984702842 4:182829117-182829139 CTCTCCATGGGGCTCTGGGATGG + Intergenic
984813583 4:183818137-183818159 CTCGCAGAGGGGGACTTGGCAGG + Intergenic
995887603 5:116913754-116913776 TTAGCCAAGGGGATCTTGGATGG - Intergenic
1000130286 5:158290621-158290643 CTCCCCAAGGGGCAGTTGGCAGG - Intergenic
1005522426 6:26612823-26612845 CTGGTCAAGGGGCTCTTGGAGGG + Intergenic
1011426602 6:87238722-87238744 CTCGCAGAGGGGCATTTGGCAGG + Intronic
1020276421 7:6627383-6627405 CTCCCCACGGGGCACCTGGTGGG + Intergenic
1022129157 7:27387992-27388014 CTCTCTGAAGGGCACTTGGAAGG + Intergenic
1023839104 7:44085926-44085948 GTGTCCAAGAGGCACTTGGAAGG + Intergenic
1028932466 7:96428516-96428538 CTGGCCAAGGGGCAATAGGTAGG - Intergenic
1029491057 7:100870362-100870384 CTGGCTCAGGGGCACCTGGAAGG - Exonic
1033475214 7:141685810-141685832 CTTGCCAAGGGTCACTTGGCTGG + Intronic
1038437851 8:27549086-27549108 TTCAGCAATGGGCACTTGGATGG + Intergenic
1039282911 8:36006328-36006350 CTAGCCAAGGGAAACTGGGAGGG + Intergenic
1039390239 8:37174527-37174549 CTCTCCAGGGAGGACTTGGAGGG - Intergenic
1039911985 8:41833309-41833331 ATCACCACGGGGCACTTGGAAGG - Intronic
1043872792 8:85453455-85453477 CATCACAAGGGGCACTTGGATGG + Intergenic
1045797202 8:106060080-106060102 CTCCCCAAGGAGCACTTGGCTGG - Intergenic
1046885623 8:119363931-119363953 GTTGCCAAGAGGGACTTGGAGGG - Intergenic
1049042841 8:140125231-140125253 CTGGCCCAGGGGCACTCGGAGGG + Intronic
1053319068 9:37079553-37079575 CCCGCCACGTGGCACTGGGAAGG + Intergenic
1054159474 9:61663883-61663905 CTGGCCGAGTGGCACCTGGAAGG - Intergenic
1054174276 9:61864260-61864282 CTCGCCGAGTGGCGCCTGGAAGG + Intergenic
1054479248 9:65594888-65594910 CTGGCCGAGTGGCACCTGGAAGG - Intergenic
1054663262 9:67716531-67716553 CTCGCCGAGTGGCGCCTGGAAGG - Intergenic
1056693797 9:88829622-88829644 GCCCTCAAGGGGCACTTGGAAGG + Intergenic
1056954603 9:91072191-91072213 CTCGGCCAGGGGCATGTGGAAGG - Intergenic
1061163600 9:128910060-128910082 TCCACCAAGGGGCCCTTGGATGG - Intronic
1062519552 9:136952003-136952025 CCCAGCATGGGGCACTTGGAAGG + Intronic
1186578923 X:10796031-10796053 CTCACCAAGAGGCACTTGGTGGG + Intronic
1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG + Intronic
1196778735 X:119362975-119362997 CTCGCAGAGGGGGACTTGGCAGG - Intergenic
1196795965 X:119502122-119502144 CTGTCCAGGAGGCACTTGGATGG + Intergenic
1201335924 Y:12879505-12879527 CTCGCAAAGGGGGATTTGGCAGG - Intergenic