ID: 952822416

View in Genome Browser
Species Human (GRCh38)
Location 3:37496593-37496615
Sequence AGGTGGTTCTGGCTGCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952822416_952822423 27 Left 952822416 3:37496593-37496615 CCATGTAGCAGCCAGAACCACCT 0: 1
1: 0
2: 0
3: 11
4: 168
Right 952822423 3:37496643-37496665 CTCCCTTGCTCAGGACTTTCTGG 0: 1
1: 0
2: 2
3: 27
4: 235
952822416_952822422 18 Left 952822416 3:37496593-37496615 CCATGTAGCAGCCAGAACCACCT 0: 1
1: 0
2: 0
3: 11
4: 168
Right 952822422 3:37496634-37496656 ATCATGGTGCTCCCTTGCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 131
952822416_952822421 2 Left 952822416 3:37496593-37496615 CCATGTAGCAGCCAGAACCACCT 0: 1
1: 0
2: 0
3: 11
4: 168
Right 952822421 3:37496618-37496640 TACAAACAGGAAAAATATCATGG 0: 1
1: 1
2: 3
3: 46
4: 639

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952822416 Original CRISPR AGGTGGTTCTGGCTGCTACA TGG (reversed) Intronic
903475804 1:23618546-23618568 AGGGGGATCAGGCTGGTACAGGG - Intronic
904505398 1:30948676-30948698 AGGAGGTTGAGGCTGCAACAAGG + Intronic
907085759 1:51672261-51672283 AGGTGGTAGTGGCTCCCACATGG + Intronic
908419470 1:63945861-63945883 AGGTTGCTCTAGCTGCAACATGG + Intronic
908460005 1:64339970-64339992 AGGTCCCTCTGGCTGCAACATGG - Intergenic
914860431 1:151381539-151381561 AGTGGGTTCTGGTTGCTGCAGGG + Intergenic
916076067 1:161200630-161200652 AGGTGGGTCTGGCAGTCACAAGG - Intronic
921441291 1:215189754-215189776 AGGTGTTTCTCACTGCTTCAAGG - Intronic
922471259 1:225878708-225878730 TGGTGCTTCTAGCTGTTACAGGG + Intronic
1062975404 10:1678938-1678960 AGGTGGTGCTGGCTCCCTCACGG + Intronic
1063358356 10:5424299-5424321 AGGTGCTACTGTATGCTACATGG - Intronic
1064595425 10:16940056-16940078 AGATGGTTCTGGCAGCGGCACGG - Exonic
1064910168 10:20392556-20392578 AGGTGGTTCTGGCTGTCAGATGG + Intergenic
1067434921 10:46270089-46270111 AGGTGGTGCAGGCTGCTAGTGGG - Intergenic
1071524494 10:86350330-86350352 AGATAACTCTGGCTGCTACATGG + Intronic
1072169920 10:92848873-92848895 CGGTGGGTGTGGCTGCTGCAGGG + Intronic
1073745554 10:106464597-106464619 AGGTCCTTCTGGCTGCTGTATGG + Intergenic
1075536987 10:123279459-123279481 ATGTGGTTCTGGCTGCTGTAGGG + Intergenic
1075658692 10:124178391-124178413 AGGTGGTGCAGGGTGTTACATGG + Intergenic
1076331824 10:129675853-129675875 AGGGGGTGGTGGCTGCCACAGGG - Intronic
1081950829 11:47041017-47041039 TGGTGCTGCTGGGTGCTACAGGG + Intronic
1084489830 11:69472180-69472202 AGGTGGTTCTGCCTGCCCCTTGG + Intergenic
1085535629 11:77215565-77215587 AGGTGTTTCTGGCAGGTGCAAGG - Intergenic
1085678088 11:78544183-78544205 AGATCATTCTGGCTGCTATATGG - Intronic
1086622138 11:88899622-88899644 AATTGGTTCTGGCTCCTAAATGG - Intronic
1089020930 11:115214106-115214128 AGGTGGTTCATGTAGCTACAAGG + Intronic
1090810656 11:130238952-130238974 AGATGATTTTGGCTGCTACATGG + Intronic
1090817171 11:130308655-130308677 AACAGGTTCTAGCTGCTACATGG + Intronic
1091057191 11:132430208-132430230 AGGTGGCTCTAGCTGGGACATGG - Intronic
1091310897 11:134574525-134574547 AGGTGGGCCTGGTTGCTAGAGGG + Intergenic
1091624130 12:2109666-2109688 AGGTGACTTTGGCTGCTGCATGG + Intronic
1092008499 12:5088948-5088970 ACGTGGTACTGGCTGCTAGCAGG + Intergenic
1092801828 12:12176059-12176081 AGGTTGTTCTGCCTACTGCAGGG + Intronic
1092908335 12:13122739-13122761 AGGTGGTGATGGGTGCTTCAAGG + Intronic
1094046873 12:26177325-26177347 ACATGGTGCTGGTTGCTACATGG + Intronic
1094477566 12:30853383-30853405 AGGAGGCTGTGGCTGCTGCAGGG + Intergenic
1095572202 12:43696291-43696313 AGTTGCTTCTTTCTGCTACATGG + Intergenic
1101069747 12:101062121-101062143 AGAGGGGTCTGGCTGCTAGAAGG - Intronic
1102992555 12:117325411-117325433 AGGTAGTTTTGGTTGTTACAAGG + Intronic
1103565164 12:121811757-121811779 AGGCGGGTCTGGCTGCATCAGGG + Intronic
1108701099 13:52945023-52945045 AGGTTGCTCTGGCTGCTAGGTGG + Intergenic
1108817161 13:54305746-54305768 ACCTGGTTCTGGCTGGTACTGGG - Intergenic
1112941201 13:104863950-104863972 AGGTGGTTCTGCATGATATATGG - Intergenic
1113056928 13:106278262-106278284 AGGTGGTGATGGGTGCTACGTGG - Intergenic
1113952986 13:114082089-114082111 AGGTGGTTCTGGGTGCAGCCAGG + Intronic
1115807515 14:37068205-37068227 AGGTCATTCTGGCAGCCACATGG + Intronic
1122764298 14:104054872-104054894 AGATTATTCTGGCTGCTGCATGG + Intergenic
1123007959 14:105333487-105333509 AGAAGGTTCTGGCTGCTCCCTGG + Intronic
1125337245 15:38639031-38639053 AGGTGGTTGTGGTTTCTACATGG - Intergenic
1125485263 15:40107172-40107194 TGCTGCTTCTGGCTGCTGCAGGG - Intronic
1126332475 15:47548355-47548377 AGGTGTTTCTGGCAGGTGCAAGG - Intronic
1126792438 15:52233473-52233495 AGGTGCTACTGGCTTCTAGAGGG - Intronic
1131152888 15:90058017-90058039 AGGTGGGTCTGACTGCCACAGGG - Intronic
1131457114 15:92590179-92590201 TGTTGGGTCTCGCTGCTACATGG + Intergenic
1132088232 15:98925132-98925154 ATCTGGTTCAGCCTGCTACAGGG + Intronic
1132336714 15:101052662-101052684 AGGTGGTGATGGCTGGCACAGGG - Intronic
1132561241 16:595250-595272 AGGTGGTGGTGGGGGCTACACGG - Intronic
1134667651 16:16030788-16030810 AGCTGGTTCTGGGTGCGACTGGG - Intronic
1135125948 16:19809421-19809443 AGGTGGTGCTGGCTGCTGGCTGG + Intronic
1138264512 16:55650945-55650967 AGGTGTTTCTAGCTGCTATGTGG + Intergenic
1139953171 16:70681589-70681611 AGGAGGCTGTGGCTGCTGCAGGG + Intronic
1141881569 16:86863643-86863665 CGCTGGTCCTGGCTGGTACAAGG + Intergenic
1145239603 17:21232748-21232770 AGCTCTTTCTGGCTGCTGCATGG + Intergenic
1146467310 17:33096455-33096477 GGCTGCTTCTGGCTGCTAAATGG + Intronic
1149302441 17:55317782-55317804 AGGAAGTTCAGGCAGCTACAGGG - Intronic
1149796638 17:59527037-59527059 AGGTGGGTCTGTCAGATACATGG - Intergenic
1151830191 17:76544921-76544943 AGGAGGTGGTGGCTGCTCCAGGG + Intronic
1154465965 18:14642947-14642969 GGGTGGTTGTGTGTGCTACAGGG + Intergenic
1155688547 18:28586473-28586495 AGGTGTTTCTGGCAGCTTCCTGG + Intergenic
1157967771 18:52227646-52227668 AGGTGGCTCTGGCTTCTTCTGGG + Intergenic
1158581781 18:58690462-58690484 AGGAGGCTCTGGCTTCCACATGG - Intronic
1159101993 18:63968253-63968275 AGGTCCCTCTGGCTGCAACATGG - Intronic
1161654947 19:5508437-5508459 AGGTTGTCCTGGCTGCTATGAGG - Intergenic
1165438509 19:35810426-35810448 AGTTGATTCTAGCTGCTGCATGG - Intronic
1165484814 19:36089217-36089239 AGGTGGTTTTCTCTGCTACGTGG - Exonic
1166967027 19:46535235-46535257 AGGGGGTTCTGGCTGCGCCAAGG - Intronic
925719584 2:6813997-6814019 TGGTGGTTCTGGATGTTCCATGG + Intergenic
928612601 2:33005336-33005358 AGGTGGCACTGGCTGCTAGTTGG + Intronic
929091640 2:38223130-38223152 ACATGGTTCTGTCTGCTTCAAGG + Intergenic
929355742 2:41022204-41022226 AGGAGGTTCTGCCTACTAAAAGG + Intergenic
932000109 2:67877379-67877401 AGGTGGATCTGGCTGCCTCAAGG + Intergenic
935479663 2:103570451-103570473 AGGTATTTCTGGCTGGTAGATGG + Intergenic
939978867 2:148754626-148754648 TGCTGCCTCTGGCTGCTACAAGG + Intronic
941005477 2:160242991-160243013 AGGTCATTCTGACTGCTTCAAGG - Intronic
941452437 2:165675892-165675914 AGGTGGTGATGGCTTCCACAAGG + Intronic
943064916 2:183075595-183075617 GGGTCTTCCTGGCTGCTACAAGG - Intergenic
944332245 2:198484165-198484187 AGGTGGTTCTGTCACCTAGATGG - Intronic
945399238 2:209359199-209359221 AGTTGGTTGTGGCTGCTATTTGG + Intergenic
947462547 2:230315825-230315847 TGGTGGTTCATGCTGCTAAATGG + Intergenic
947471656 2:230406338-230406360 TGGTGGTTCATGCTGCTAAATGG + Intergenic
948062894 2:235054649-235054671 AGGTGGTCCCTGCTGCTACGAGG + Exonic
948274669 2:236699224-236699246 AGGTGGATCTGGGTTCTGCATGG + Intergenic
948422050 2:237865673-237865695 AGGTGTTTCTGGCGGCAGCAGGG + Intronic
1168939035 20:1693587-1693609 AGATGATGCTGGCTGCGACAGGG + Intergenic
1170447066 20:16439312-16439334 AGGTGGCTCTGGCTGCCATATGG - Intronic
1173585951 20:44183396-44183418 AGGTGCCTATGGCTGCTACCCGG - Intronic
1175416823 20:58806951-58806973 AGATGGTTTTGGTTGATACATGG - Intergenic
1175731573 20:61357797-61357819 ATGTGGTCCTGGCTGGCACACGG - Intronic
1175739614 20:61411556-61411578 ACGTGGTGCTGTCTGCTTCAGGG + Intronic
1176808620 21:13515648-13515670 GGGTGGTTGTGTGTGCTACAGGG - Intergenic
1177382022 21:20356660-20356682 AGGTGGATCTGGCTGCCACCTGG + Intergenic
1178500042 21:33118209-33118231 AGGTGGCTCTGGCCGCAAAATGG - Intergenic
1178706464 21:34877610-34877632 AGAAGGTTCAGGCTTCTACAGGG + Intronic
1179078249 21:38144084-38144106 AGTTGGTGCTCGCTGCCACATGG + Intronic
1179504290 21:41830738-41830760 AGGTGTTTCTGGAAGCTTCATGG - Intronic
1180741705 22:18057597-18057619 AGGTGGTTATGGGTGCTTAACGG + Intergenic
1182269129 22:29142422-29142444 AGGTGGTCATGGCTGGCACAGGG + Intronic
1182401530 22:30081174-30081196 GGGTGGTTCTGGCCCCTAAAGGG + Intronic
950275590 3:11657664-11657686 AGGTGAGTCTGGCTACTAGAGGG + Intronic
951521808 3:23617218-23617240 AGCTGGTTCTGGCCTCTTCAAGG + Intergenic
951643226 3:24859254-24859276 AGGTGGTTCTGGGAGCTTGAGGG + Intergenic
952822416 3:37496593-37496615 AGGTGGTTCTGGCTGCTACATGG - Intronic
952871341 3:37903870-37903892 AGTTGCTTCTGGCTGGTACCAGG + Intronic
952964163 3:38610764-38610786 ATGTGGTGCTGGCTTCTGCAGGG - Intronic
954455114 3:50593570-50593592 AACTGGTTCTTGCTGCTGCATGG + Intergenic
954612552 3:51953748-51953770 CTGTGGTTCTGGCTCCTGCAGGG - Intergenic
955555941 3:60137222-60137244 AGGTGGTTCTGGCATCAATAGGG - Intronic
956314515 3:67919662-67919684 ATGTGGTTCTTGCAGCAACATGG - Intergenic
956435170 3:69228117-69228139 AGGTGTTACTGGCTTCTACTGGG + Intronic
956786726 3:72648858-72648880 AGCTTATTCTGGCTGCTGCATGG + Intergenic
961018512 3:123485199-123485221 AGTTGATTCTGGCTGCTGTATGG + Intergenic
961091699 3:124118276-124118298 AGATGGCTCTGGCTGCCACTTGG + Intronic
961337238 3:126187995-126188017 AAGAGCTCCTGGCTGCTACACGG + Intronic
962154337 3:132929651-132929673 ATGTGGTTCTGTCTGCTTGAAGG + Intergenic
962568251 3:136686069-136686091 AGGTGGTTTTAGCAGCTACTAGG + Intronic
962569340 3:136696216-136696238 AGGTGGTTTTAGCAGCTACTAGG + Intronic
965672278 3:171159082-171159104 AGATGGGTTTGGCTGCTAAATGG + Intronic
966391348 3:179455851-179455873 AGTTGGTGCTGGCTGCTAGCTGG + Intergenic
967560565 3:190913370-190913392 AGGTGGTTCTGGGAGATAGAAGG - Intergenic
969616939 4:8258823-8258845 AGGTGGGTCTGGCCACCACAGGG - Intergenic
972029301 4:34432792-34432814 CGGGGGATTTGGCTGCTACACGG + Intergenic
977265469 4:94848674-94848696 TGATGATTCTGGCTGCTGCATGG + Intronic
985441836 4:189987386-189987408 AGGTGGTCCTGGAAGCTAAAGGG - Intergenic
986042589 5:4008117-4008139 AGGTGGCTGTGGCTGCTTCGGGG + Intergenic
987233965 5:15924596-15924618 AGGAAGTTCTGTCTGCTTCACGG + Intronic
990314066 5:54567630-54567652 AGGTGGTTCTGGATTGTATAAGG - Intergenic
992080668 5:73232757-73232779 AGGTGGTTCTGCCTGCCGCTGGG + Intergenic
994022517 5:95044084-95044106 AGATGGTTCTGGGCCCTACAGGG + Intronic
995739753 5:115343221-115343243 TGCTGCTTCTGGCTGCTCCATGG - Intergenic
997862777 5:137433541-137433563 AGGTGGTTTTGGCAGCCAAATGG - Intronic
997893956 5:137699308-137699330 AGGTTGGTGTGGCTGGTACATGG + Intronic
998482721 5:142476211-142476233 AGGTGCTTCTTCCTGCCACAGGG - Intergenic
999255907 5:150209967-150209989 AGGTGGTGCCGGCTGCCCCATGG - Exonic
1000337951 5:160255426-160255448 TGGTGGTTCTTCCAGCTACAGGG - Intronic
1002153015 5:177251489-177251511 AGACTGTTCTGACTGCTACATGG - Intronic
1006714625 6:36108670-36108692 AGGAGGTTGTGGATGCTCCAGGG + Exonic
1010953896 6:82068960-82068982 AGTTGATTCTGGCTGCCATATGG - Intergenic
1011164264 6:84428504-84428526 AGGTGGCGATGGCTGCTACCAGG + Intergenic
1014944276 6:127478336-127478358 AGTTGGTTCTGCCTGCTGAAAGG + Intronic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1016028688 6:139315086-139315108 AGGTGGTGCCGGCTGATCCATGG - Intergenic
1019549134 7:1593604-1593626 AGGTGGGTCTGGCTGCCCCGAGG - Intergenic
1026970550 7:74465022-74465044 GGGTGGTCCTGGCAGCTCCAAGG + Intronic
1028243738 7:88451487-88451509 AGGGAGTCCTGGCTGCCACAAGG - Intergenic
1033661370 7:143405375-143405397 AGGCGCTGCTGGCTGCCACATGG + Intronic
1033848350 7:145463015-145463037 TGGTGGTTCTAGCTCATACACGG + Intergenic
1035250954 7:157596563-157596585 AGGTGGTTCTGTCTTCCAGAGGG + Intronic
1035252655 7:157607362-157607384 AGGGGCTTCTGGCTGCTTCCAGG + Intronic
1037553770 8:20002529-20002551 AGGTGGTTATGATTGGTACATGG - Intergenic
1039791757 8:40881923-40881945 AGGTGATTCTGCGCGCTACATGG - Intronic
1041119607 8:54572658-54572680 AGGTGGTTCTTGCCTCTGCACGG + Intergenic
1045370882 8:101521436-101521458 AGGTGCTCCTGGCTACCACATGG + Intronic
1048755025 8:137728848-137728870 AGGTGCTTCTGGTTCTTACATGG + Intergenic
1049341520 8:142115033-142115055 AGGTGGGTGTGGCAGCTTCAGGG + Intergenic
1049574235 8:143383082-143383104 GGGTGTGTCTGGCTGCTGCATGG - Exonic
1049793698 8:144485819-144485841 AGGTGGCTGTGGCTGCAAGAGGG - Intronic
1053182173 9:35982114-35982136 AGATGCTTCTGGCTGCTACCTGG - Intergenic
1053183497 9:35994333-35994355 AGATGCTTCTGGCTGCTGCTTGG - Intergenic
1055357844 9:75455688-75455710 AGGTGTTTCTGGGTGCAACAAGG + Intergenic
1059551388 9:115232501-115232523 AGGTGACTATGGCTGTTACAGGG - Intronic
1060206361 9:121684949-121684971 ACGTGGTCCTGGCTGTAACAGGG + Intronic
1060658302 9:125387944-125387966 AGGTGTGTCTGGCTGCCAGAAGG + Intergenic
1061753587 9:132797580-132797602 GGGTGGTTCTAGATGCAACAAGG + Intronic
1062188484 9:135231330-135231352 GGATGGTTCTGTCTGCTACTCGG - Intergenic
1062734172 9:138126246-138126268 AGGTGGCTGTGGCAGCAACAGGG + Intergenic
1192205362 X:69092360-69092382 AGATCACTCTGGCTGCTACAAGG + Intergenic
1195313996 X:103659985-103660007 AGGTGGGCTTGGCTGCCACATGG + Intergenic
1197529613 X:127606673-127606695 CTGTGGTTCTGGCTTCTAAAAGG - Intergenic
1198107607 X:133476290-133476312 ATTTGGTTCTGGATGCCACAGGG + Intergenic
1199686305 X:150268664-150268686 AGATGCTTCTGTCTCCTACAGGG + Intergenic