ID: 952825860

View in Genome Browser
Species Human (GRCh38)
Location 3:37524241-37524263
Sequence AGGTGTTTCAAGATGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952825851_952825860 17 Left 952825851 3:37524201-37524223 CCTAGGTCAAATTGCCTGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 118
Right 952825860 3:37524241-37524263 AGGTGTTTCAAGATGGAGTGGGG 0: 1
1: 0
2: 3
3: 21
4: 217
952825855_952825860 3 Left 952825855 3:37524215-37524237 CCTGGGTGGTGGAGTAGTGGTTC 0: 1
1: 0
2: 0
3: 9
4: 106
Right 952825860 3:37524241-37524263 AGGTGTTTCAAGATGGAGTGGGG 0: 1
1: 0
2: 3
3: 21
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952825860 Original CRISPR AGGTGTTTCAAGATGGAGTG GGG Intronic
901086875 1:6615760-6615782 GGGTGTTTCTAGATGGAATGGGG + Intronic
901295113 1:8155498-8155520 GGCTCTTTAAAGATGGAGTGAGG - Intergenic
902539485 1:17143693-17143715 AGATGCTTCAAGAAGGAGGGAGG + Intergenic
903981609 1:27192720-27192742 AGGAGTTTGAAGTTGCAGTGAGG - Intergenic
905149985 1:35919826-35919848 AGATGTGACAAGATGGGGTGAGG - Exonic
907577972 1:55545735-55545757 AGGTTCTTTAAGATGGGGTGAGG + Intergenic
907894959 1:58679529-58679551 AGGAGTTTGAAGCTGCAGTGAGG - Intronic
910178329 1:84454837-84454859 AGGTGTTTCATAATGCAGTCAGG + Intergenic
910432468 1:87172777-87172799 AGGTGGTTGAAGATGGACTCCGG + Intergenic
911050629 1:93668013-93668035 AGGTGTTTCAACATATATTGAGG + Intronic
911134072 1:94420044-94420066 AGGTGTTTTAATATGGAGGAGGG + Intronic
912264479 1:108142649-108142671 AGGTGTTTCTGTTTGGAGTGAGG + Intronic
912772632 1:112478848-112478870 AGGTGTTTGAAGTTGCAGTGAGG + Intronic
912799984 1:112714606-112714628 AGGGGTTTCACGAAGGAGCGGGG - Intronic
912804056 1:112742128-112742150 AGGAGTTTGGAGATGGACTGTGG + Intergenic
913472018 1:119197542-119197564 AGGTTCTTCATGCTGGAGTGTGG + Intergenic
914384806 1:147158210-147158232 AGGTGTTTGATGATTAAGTGGGG - Exonic
914812131 1:151036690-151036712 AGGTGTTTAAAGAAGGAGGCAGG + Exonic
915681381 1:157584969-157584991 AAATGTTTCAAGAAGGAGGGAGG + Intronic
916546546 1:165810840-165810862 AGGAGTTTGAAGTTGCAGTGAGG + Intronic
917268048 1:173242717-173242739 TGGTTTTTGAAGATGGAGGGAGG + Intergenic
918146127 1:181757732-181757754 AGGTGTTGCCACATGGAGTAGGG - Intronic
920082056 1:203382028-203382050 TGATGTTTCAAGAGGGAGAGGGG - Intergenic
920273742 1:204788042-204788064 AGTGGGTTCAAGATGGAATGAGG - Intergenic
921217398 1:212949864-212949886 AGGTGTTTCAGTAGTGAGTGTGG + Intergenic
1067383577 10:45797598-45797620 AGATGTTGCAAGATGAGGTGAGG + Intergenic
1067880601 10:50041202-50041224 AGATGTTGCAAGATGAGGTGAGG - Intergenic
1067891280 10:50138167-50138189 AGATGTTGCAAGATGAGGTGAGG + Intergenic
1069555017 10:69392196-69392218 ATGTGCATCAACATGGAGTGGGG + Exonic
1071387476 10:85136466-85136488 AGGTCTTTCATCATGGACTGGGG + Intergenic
1072478589 10:95787424-95787446 AGGTGTTTTAGGAAGGAGAGGGG + Intronic
1072995040 10:100236175-100236197 AGGAGTTTGAGGATGCAGTGAGG - Intronic
1077879433 11:6337168-6337190 AGGTGGTTCAGGCTGCAGTGAGG - Intergenic
1078855643 11:15204649-15204671 AGGTGAGTGAAGGTGGAGTGGGG + Intronic
1080565026 11:33500238-33500260 AACTGTTTCAAGATCGAGTCAGG + Intergenic
1081715555 11:45247414-45247436 TGCTGTGCCAAGATGGAGTGGGG + Intronic
1081771923 11:45655543-45655565 TGATGTTGCAAGATGCAGTGAGG + Intronic
1086435317 11:86774294-86774316 AGGTCTGTCAAGGTGCAGTGTGG - Intergenic
1087630259 11:100641993-100642015 ATGTTGCTCAAGATGGAGTGCGG + Intergenic
1087668879 11:101082538-101082560 AGGTGGTCTCAGATGGAGTGAGG + Intronic
1092043806 12:5410226-5410248 AGGTCATCCAAGAGGGAGTGTGG + Intergenic
1092555406 12:9555065-9555087 AGGTTATTCAAGCTGGAGGGAGG + Intergenic
1092655576 12:10680908-10680930 ATATGTGCCAAGATGGAGTGGGG - Intergenic
1093108325 12:15116964-15116986 ATGAGTTTCAAAATGGAATGAGG + Intronic
1094516692 12:31135617-31135639 AGGTTATTCAAGCTGGAGGGAGG - Intergenic
1095909747 12:47414236-47414258 AGGTGTGAGAAGATGAAGTGAGG + Intergenic
1096057327 12:48664953-48664975 AGGAGTTTGAAGCTGAAGTGAGG - Intronic
1099124207 12:78732107-78732129 AGAAGTTTCGAGATTGAGTGAGG + Intergenic
1099839037 12:87943028-87943050 AGGTGTTTCCTGTTGGAATGGGG + Intergenic
1102016675 12:109652671-109652693 AGGAGTTTCAATTTGGTGTGGGG - Intergenic
1106413920 13:29530128-29530150 AGGTATTTAAAGGTGAAGTGAGG + Intronic
1108004632 13:45934451-45934473 TGGTGTGTATAGATGGAGTGGGG + Intergenic
1110468363 13:75828817-75828839 GGGTGATTCAAGATGGATTATGG + Intronic
1110983943 13:81939536-81939558 AGAGGTTTCATGATGGATTGTGG + Intergenic
1111960771 13:94807682-94807704 TGCTGTTTGAAGATGGAGGGAGG - Intergenic
1112998504 13:105603371-105603393 AGGTGTGTCAAGATGGATTTTGG + Intergenic
1114574042 14:23696231-23696253 ACCTTTTTCATGATGGAGTGAGG + Intergenic
1117104069 14:52381056-52381078 AAGTGTTTCCAGAGGTAGTGGGG + Intergenic
1118491785 14:66268245-66268267 TGGTGATGCAAGAGGGAGTGTGG - Intergenic
1118655128 14:67939213-67939235 ATGTGTTTCCACATGGAGGGGGG - Intronic
1119256285 14:73200748-73200770 AGCAGTTTCAAGAAGGAGAGAGG + Intronic
1120858212 14:89231454-89231476 AGGTGATCCAAGAGGGAGGGTGG + Intronic
1121910787 14:97790544-97790566 AAGTGTTGCAAGATGAAGTGGGG - Intergenic
1123685506 15:22794391-22794413 CAGTGTGTGAAGATGGAGTGTGG + Intronic
1128613157 15:69089777-69089799 AGGGGTTTGAAGATGAAGGGAGG + Intergenic
1128958253 15:71972460-71972482 TGGTGTTTGAAGGTGGGGTGGGG + Intronic
1129625273 15:77191404-77191426 TGGTATGTCAAGATGGGGTGTGG - Intronic
1130020019 15:80221508-80221530 AGGTGTTCCAGGCTGCAGTGAGG + Intergenic
1130155693 15:81348278-81348300 AGGTGTTACAAGAGGAAATGGGG + Intronic
1134480508 16:14614897-14614919 AGGTGTCTGAAGGTGGTGTGGGG + Intronic
1135290687 16:21235356-21235378 ATGTGGTTCAAGTAGGAGTGGGG + Intronic
1136111432 16:28065889-28065911 AGGTGTTTCTTGAGAGAGTGTGG - Intergenic
1138967752 16:62106411-62106433 AGTTGTTTCAAAATTGAGTGTGG + Intergenic
1140299483 16:73742336-73742358 ATGTGTTTGAAGAGGGTGTGTGG + Intergenic
1140796018 16:78439039-78439061 AGGTATTTAAAGATGGAAAGGGG - Intronic
1141968460 16:87463307-87463329 AGGAGTTTGAAGCTGCAGTGAGG + Intronic
1142496308 17:307905-307927 AGATGTTCCAAGATGCCGTGCGG + Intronic
1142667806 17:1472443-1472465 AGGAGTTTTAGGCTGGAGTGAGG - Intronic
1143830461 17:9646334-9646356 AGGTATTTTGAGAGGGAGTGGGG + Intronic
1145000095 17:19298574-19298596 AGGAGTTTGAAGATACAGTGAGG - Intronic
1145252192 17:21302757-21302779 AAATGTTTCCAGATGCAGTGAGG - Intronic
1145723614 17:27096103-27096125 AGGGGTTTAAAGAAAGAGTGGGG + Intergenic
1145732628 17:27202974-27202996 ATATGTTTCAAAATGTAGTGTGG - Intergenic
1145946341 17:28777823-28777845 AGGTGGTCCAGGCTGGAGTGTGG + Intronic
1147153748 17:38532940-38532962 AGGAGCTTCAGGATGGACTGGGG + Exonic
1148246860 17:46037905-46037927 AACTGCTTCCAGATGGAGTGTGG + Intronic
1148567963 17:48644939-48644961 GGGTCTTTCAAGTTGCAGTGTGG + Intergenic
1152001654 17:77649723-77649745 AGATGATTCAAGATGGAGGCTGG + Intergenic
1152826885 17:82471954-82471976 AGGTGTTTTAAAATGTAGAGAGG + Intronic
1153544190 18:6189068-6189090 TGATGTTCCCAGATGGAGTGTGG - Intronic
1154406501 18:14096586-14096608 AGGTGTTTGAGGCTGCAGTGAGG - Intronic
1155231481 18:23779081-23779103 AGGTGTGTGAAAGTGGAGTGAGG + Intronic
1157806610 18:50663037-50663059 AGGTGTTGGAAGCCGGAGTGTGG + Intronic
1157932329 18:51836677-51836699 AGATGTGTAAAGATGGAGTTAGG - Intergenic
1158559970 18:58505469-58505491 AGGTGGTTCAGGATGGAGCAGGG - Intronic
1158646355 18:59251351-59251373 AAGTGTTCCAAAATGGACTGCGG - Intergenic
1158773584 18:60551602-60551624 AGGAGTCTCACGATAGAGTGAGG + Intergenic
1159124127 18:64203180-64203202 AGGTGTTTCAGGAAGTACTGGGG + Intergenic
1162011262 19:7816756-7816778 AGGAGTTTCAAGGAGGAGGGAGG - Intergenic
1162090574 19:8277023-8277045 AGGTGTTTCTGGTTGCAGTGGGG - Intronic
1162092807 19:8291851-8291873 AGGTGTTTCTGGTTGCAGTGGGG - Intronic
1163340224 19:16701313-16701335 AGGAGTTTGAAGCTGTAGTGTGG - Intergenic
1164564846 19:29318474-29318496 ATGGGATTCAAGATGCAGTGAGG - Intergenic
1165247859 19:34507937-34507959 AGGTGCTCCAAGGTGGAGTCAGG - Exonic
1167101248 19:47405534-47405556 AGGCATGTCAGGATGGAGTGAGG + Intronic
1167387206 19:49170989-49171011 AGGAGGATCAAGATGTAGTGAGG + Intronic
1167776297 19:51559837-51559859 AAGTGATTCAAGATGCAGAGAGG + Intergenic
1167793857 19:51696518-51696540 AGGAGTTTGAAGCTGTAGTGAGG - Intergenic
1168255035 19:55160573-55160595 AGGTGTTTCACACTGGAGTGTGG - Intronic
1202638104 1_KI270706v1_random:59225-59247 GGGTGTTGCAAGATGGAGATTGG - Intergenic
925694357 2:6560104-6560126 AGGTTTTTAAATATGGAATGTGG + Intergenic
926586411 2:14690785-14690807 AGATGTTTGATGTTGGAGTGGGG - Intergenic
927291734 2:21411240-21411262 AGGTGTGTCCAGATGTGGTGAGG + Intergenic
927657252 2:24959665-24959687 ATCTGTTTCCAGATGGAGTTAGG - Intronic
928052413 2:28013007-28013029 TGGAAATTCAAGATGGAGTGGGG + Intronic
928448192 2:31351574-31351596 AGGGGATTCAATATGGAGAGAGG - Intronic
930228318 2:48817214-48817236 AGGGGTCTCAAGATGGAGGGAGG + Intergenic
931807245 2:65819132-65819154 AATTGTTTCAAGAAGGAGGGTGG - Intergenic
932817605 2:74874337-74874359 ATGTGTATCAATATGGAGTGGGG + Exonic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936763145 2:115810755-115810777 GGGTGTTTCAAGGTTGAGAGTGG - Intronic
937695184 2:124801023-124801045 GGGTGTTCCAAGCTGGAGTGGGG - Intronic
938647396 2:133345749-133345771 AGGTGGTTCAAGATGTAATATGG + Intronic
939390764 2:141566784-141566806 AGGTGTTTGAGGCTGCAGTGAGG + Intronic
939530818 2:143359287-143359309 AGATGTTGCAAGATGGAGTAAGG - Intronic
939758860 2:146149644-146149666 AAGGGTATCAAGATGGATTGAGG + Intergenic
940038559 2:149334654-149334676 AGGGGTTTCCAGAAGGACTGGGG + Intronic
940523358 2:154780229-154780251 AAGTGTTTCAACATGGATTAAGG + Intronic
943579370 2:189666830-189666852 AGGTTTTTCAAGATACAGTTTGG - Exonic
1170735831 20:19013450-19013472 AGATATTTTAAGATGGAGGGTGG + Intergenic
1171954503 20:31450227-31450249 AGGTGTTTATTGATAGAGTGTGG - Exonic
1173357052 20:42303337-42303359 AGGTGTTTCAAGATTGACTGAGG + Intronic
1177274366 21:18888927-18888949 TGGTGTTTCAAGAGAGACTGGGG + Intergenic
1179022604 21:37653963-37653985 CGGTGGCTCAAGAAGGAGTGTGG + Intronic
1181715786 22:24726935-24726957 ACGTATTTCAAGGTGCAGTGTGG + Intronic
950063042 3:10088206-10088228 GTGTGTTTCAAGATGGGGTTGGG + Intronic
952610765 3:35206228-35206250 GGTTGTTTCAAGATGGGGAGAGG - Intergenic
952729194 3:36621075-36621097 AGGTGATTCAAGATGAAGCTAGG + Intergenic
952825860 3:37524241-37524263 AGGTGTTTCAAGATGGAGTGGGG + Intronic
953039892 3:39246524-39246546 AGTTGTTCCAAGTTGGGGTGAGG + Intergenic
954257945 3:49419239-49419261 AGGTGTGTCAAGAAGTGGTGTGG - Exonic
956020026 3:64924298-64924320 AGGTGTTTACAGGAGGAGTGAGG + Intergenic
959214552 3:103434623-103434645 AGGTGCTTTAAGATGGATTTTGG + Intergenic
960194305 3:114746580-114746602 AGCTGTTTCAAGCTGTAGTGTGG - Intronic
962306179 3:134288374-134288396 TGGAGAATCAAGATGGAGTGAGG - Intergenic
962640378 3:137379363-137379385 AGGTGTGTCATGATGGTTTGCGG - Intergenic
963850353 3:150204789-150204811 AGGTCTTTCAATGTGAAGTGGGG - Intergenic
964225776 3:154399817-154399839 GTGTTTTTCAAGCTGGAGTGTGG - Intronic
964425345 3:156547193-156547215 AGGTATTTCAAAGTGGGGTGAGG - Intronic
964517954 3:157533260-157533282 AGAAGTGTCAAGATGGAGTTAGG - Intronic
965676755 3:171205713-171205735 AGGGTTTTGAACATGGAGTGAGG - Intronic
966930043 3:184670559-184670581 AGGTACTTCATGATGAAGTGGGG + Intronic
966930181 3:184671115-184671137 AGGTGCTCCATGATGAAGTGGGG + Intronic
966930353 3:184671832-184671854 AGGTGCTCCATGATGAAGTGGGG + Intronic
966930405 3:184672059-184672081 AGGTGCTCCATGATGAAGTGGGG + Intronic
969840805 4:9880320-9880342 AGGGGGTTGAAGATGGATTGAGG + Intronic
971653039 4:29304212-29304234 AGTTCTTCCAAGCTGGAGTGAGG + Intergenic
975385327 4:73751567-73751589 AGGTGTTTCCAGATGGAAGTGGG + Intergenic
977150857 4:93509746-93509768 AAGTGTTACAAAATGGACTGGGG - Intronic
982606999 4:157527839-157527861 AGGTGTCTCCAGAGGGTGTGTGG + Intergenic
987020030 5:13860665-13860687 AGGTGGTTCAGGTTGGAATGGGG - Intronic
988157119 5:27469043-27469065 AGGTGATCCAAGATTTAGTGTGG - Intergenic
989280957 5:39642952-39642974 AGGGGGTTCATGATGGAGAGAGG - Intergenic
991731786 5:69596747-69596769 AAGTGTTACAAGATGGACTGGGG + Intergenic
991808218 5:70451885-70451907 AAGTGTTACAAGATGGACTGGGG + Intergenic
991863166 5:71031120-71031142 AAGTGTTACAAGATGGACTGGGG - Intergenic
992151819 5:73911907-73911929 AGGTGTTTCAGGATGTAGTGGGG - Intronic
995196705 5:109378442-109378464 AAGTGTTCAAAGATGGAGAGAGG - Exonic
1000494445 5:161962931-161962953 AAGTGTTCCAAGATAAAGTGAGG + Intergenic
1001216789 5:169863940-169863962 AGGTGTTGGAAGGTGTAGTGTGG + Intronic
1002106546 5:176882034-176882056 ATGTGCATCAACATGGAGTGGGG - Exonic
1005295805 6:24426013-24426035 AATTATTTGAAGATGGAGTGGGG - Exonic
1005649552 6:27874129-27874151 AAGTGTTTCTAGGTGGAATGAGG - Intergenic
1005902753 6:30232255-30232277 AGGTTTATCAAGATGGTGAGTGG - Intergenic
1006212045 6:32404059-32404081 AGGTGATTCAAAATGGATGGAGG - Intronic
1006305531 6:33216070-33216092 TGGTGTTGCAGGTTGGAGTGGGG - Intergenic
1007295939 6:40820562-40820584 TGTTGCTTCAAGATGGAGTCTGG + Intergenic
1008701525 6:54106198-54106220 AGTTGTTTCAAGCTGGAGTGAGG + Intronic
1010320033 6:74496304-74496326 AAGTAATTCAAGATGGAGTAAGG - Intergenic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1012473913 6:99601126-99601148 AGGTGTTTCTAGAGTGAGTTTGG + Intergenic
1012868754 6:104648287-104648309 AAGTGTGTCCAGATGGAATGTGG + Intergenic
1013208853 6:107969002-107969024 AGGTGCTTCAACATGAAGAGAGG - Intergenic
1013354279 6:109333540-109333562 AGGAGTTTGAAGCTGCAGTGAGG - Intergenic
1013617337 6:111857388-111857410 TGATGTTTCAAGATAGTGTGGGG - Intronic
1017196612 6:151707597-151707619 AGGTGTTTTAACAAGGATTGTGG + Intronic
1017729861 6:157305734-157305756 CAGTGTTTCAGGATGGAGGGGGG + Intronic
1018990874 6:168672772-168672794 ATGTGTTTTCAGATGGAGTGAGG + Intronic
1020777564 7:12473698-12473720 AGGAGTTGGAAGATGGAGGGAGG - Intergenic
1022318545 7:29266486-29266508 ATGTGTCGCAAGATGGTGTGAGG + Intronic
1023251734 7:38270601-38270623 AGGTGTTTCAAGCTGGACTTTGG - Intergenic
1023313134 7:38908526-38908548 GGGTGGTTTAAGATGGAGAGAGG - Intronic
1023841391 7:44100509-44100531 AGGTCGTTCAAAATGGAGTCTGG - Intergenic
1024107142 7:46102407-46102429 AGGAGTTTCAAGCTGCAGTGAGG + Intergenic
1024979031 7:55141496-55141518 GGGTGGATCAACATGGAGTGTGG + Intronic
1028303721 7:89234686-89234708 AGGTGTTTCCTTATGGAATGGGG - Intronic
1029580418 7:101433474-101433496 AGGTGTTTCCAGAGGGAGGGTGG + Intronic
1029687512 7:102158882-102158904 GGGTGTTTAGAGATGGAGTAGGG - Intronic
1029870737 7:103689951-103689973 AGATGTTTCAAGAGTGACTGAGG + Intronic
1030348733 7:108459782-108459804 CTGGGTTTGAAGATGGAGTGAGG - Intergenic
1031087730 7:117320492-117320514 GGGTCTTTGAAGATGGAGTGAGG + Intronic
1031236112 7:119179850-119179872 AGGTCTTTCTAGAGGGAATGTGG + Intergenic
1033456502 7:141508302-141508324 AGGTGGTCTCAGATGGAGTGAGG - Intergenic
1033708554 7:143914127-143914149 AGGAGTTTGAGGATGTAGTGTGG - Intergenic
1033883059 7:145911521-145911543 AGGTGTTTCAAATTCAAGTGTGG + Intergenic
1034549795 7:151813235-151813257 AGGTGTTGGAAGATGGGGAGAGG - Intronic
1035034970 7:155888876-155888898 AGGTCTTTCAGGCTGAAGTGTGG + Intergenic
1035055619 7:156034015-156034037 AGGTAATTCTAGATGGAGTAAGG + Intergenic
1036680657 8:10870526-10870548 AAGTCTTTGAAGAAGGAGTGTGG + Intergenic
1040557826 8:48496656-48496678 AGGTGTAGCCAGATGGAGAGAGG + Intergenic
1041176588 8:55203281-55203303 AGGTGTGTGAAGATGCAGTTGGG - Intronic
1041256903 8:55986796-55986818 AGGAGTTTCAGGCTGCAGTGAGG - Intronic
1045063258 8:98426115-98426137 GGGGGGTTCAAGCTGGAGTGGGG - Intronic
1045694251 8:104790017-104790039 GGGTGTTTTAACATGGGGTGGGG - Intronic
1048659961 8:136588210-136588232 AAGTGTTTAAAAATGAAGTGGGG + Intergenic
1048757195 8:137752927-137752949 AGATGTTTCAGTTTGGAGTGAGG + Intergenic
1049565580 8:143336299-143336321 AGGTTTTGTAAGAGGGAGTGTGG + Intronic
1051308351 9:15740757-15740779 TGGTGTTTCAATATGTGGTGGGG + Intronic
1052638117 9:31128953-31128975 AGGAGTTTGAAGCTGCAGTGAGG - Intergenic
1052984722 9:34478398-34478420 AGAAGTTTCAAGAAGGAGGGAGG + Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055294614 9:74821395-74821417 AGGTGTTTGCAGGGGGAGTGAGG - Intronic
1055910536 9:81345579-81345601 AGTTGTCTCAAAATGGAGTAAGG - Intergenic
1058054044 9:100431978-100432000 GGATGGTTTAAGATGGAGTGTGG + Intronic
1058727132 9:107814984-107815006 AGCTCTTTCAAGCTGAAGTGGGG - Intergenic
1059686161 9:116638504-116638526 AGGTTTTTCAATATGGGCTGTGG + Intronic
1060766257 9:126296735-126296757 AGAAATTTCAGGATGGAGTGAGG - Intergenic
1061915879 9:133753596-133753618 AAGAGTTTCAAGATGGGGGGTGG + Intergenic
1187999994 X:24971880-24971902 AGGATTTTAAAGATGGAGGGGGG + Intronic
1190641552 X:52485312-52485334 TGGTGATTCAAGATGAAGCGTGG + Intergenic
1190646120 X:52527553-52527575 TGGTGATTCAAGATGAAGCGTGG - Intergenic
1192206958 X:69102714-69102736 AGGTCATTCAAGCTGGGGTGGGG - Intergenic
1192674331 X:73179743-73179765 AGGTGTGTATAGAAGGAGTGGGG + Intergenic
1193360474 X:80573823-80573845 ATGTGTATCAATATGGAGTGGGG - Intergenic
1193545625 X:82824526-82824548 AAATGTTTCAAGATGGATAGTGG - Intergenic
1194943222 X:100037824-100037846 AGGTGTATGAAGATGGAGCCAGG - Intergenic
1196820392 X:119695932-119695954 ATGTGTGTCAATATGGAGAGAGG + Intergenic
1198152094 X:133921413-133921435 AGGTGTTTCTAGAAGGATTGGGG - Intronic