ID: 952826704

View in Genome Browser
Species Human (GRCh38)
Location 3:37530501-37530523
Sequence CCCTGGGGCCACCTATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 255}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952826704_952826710 0 Left 952826704 3:37530501-37530523 CCTGGAGATAGGTGGCCCCAGGG 0: 1
1: 0
2: 1
3: 28
4: 255
Right 952826710 3:37530524-37530546 CTGGCTTAGTAACCTAACAATGG 0: 1
1: 0
2: 0
3: 6
4: 76
952826704_952826716 24 Left 952826704 3:37530501-37530523 CCTGGAGATAGGTGGCCCCAGGG 0: 1
1: 0
2: 1
3: 28
4: 255
Right 952826716 3:37530548-37530570 ACCAGTGGCACCAGGGGTGAAGG 0: 1
1: 0
2: 1
3: 18
4: 227
952826704_952826713 16 Left 952826704 3:37530501-37530523 CCTGGAGATAGGTGGCCCCAGGG 0: 1
1: 0
2: 1
3: 28
4: 255
Right 952826713 3:37530540-37530562 ACAATGGCACCAGTGGCACCAGG 0: 1
1: 0
2: 1
3: 10
4: 174
952826704_952826711 9 Left 952826704 3:37530501-37530523 CCTGGAGATAGGTGGCCCCAGGG 0: 1
1: 0
2: 1
3: 28
4: 255
Right 952826711 3:37530533-37530555 TAACCTAACAATGGCACCAGTGG 0: 1
1: 0
2: 1
3: 3
4: 93
952826704_952826714 17 Left 952826704 3:37530501-37530523 CCTGGAGATAGGTGGCCCCAGGG 0: 1
1: 0
2: 1
3: 28
4: 255
Right 952826714 3:37530541-37530563 CAATGGCACCAGTGGCACCAGGG 0: 1
1: 0
2: 2
3: 15
4: 166
952826704_952826715 18 Left 952826704 3:37530501-37530523 CCTGGAGATAGGTGGCCCCAGGG 0: 1
1: 0
2: 1
3: 28
4: 255
Right 952826715 3:37530542-37530564 AATGGCACCAGTGGCACCAGGGG 0: 1
1: 0
2: 2
3: 23
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952826704 Original CRISPR CCCTGGGGCCACCTATCTCC AGG (reversed) Intronic
900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG + Intronic
900523336 1:3116591-3116613 CCCTGGGGCAGCCTCTGTCCCGG - Intronic
900547121 1:3235417-3235439 CCCTGGGGACATCAATCTTCCGG + Intronic
900586004 1:3432616-3432638 CCCTGGGGCCACCTACCCTGAGG - Intronic
901462633 1:9400739-9400761 AGCTGCGGCCACCTACCTCCTGG - Intergenic
901738524 1:11327520-11327542 CTCTGTGCCCACCTGTCTCCAGG + Intergenic
902580867 1:17406639-17406661 CCCTGGGGCCACATGTCTCCTGG + Intergenic
903032492 1:20473772-20473794 CAGTGGGACCACCAATCTCCTGG - Intergenic
903188656 1:21643938-21643960 CCCTGTGTGCCCCTATCTCCTGG - Intronic
903787057 1:25868313-25868335 CCCTGTGGACACCTAGCTCCTGG + Intronic
905626847 1:39495076-39495098 CTCTGGGGCCACCAACCTTCAGG - Intronic
905947570 1:41916882-41916904 TCCTGGGTCCAACTGTCTCCAGG + Intronic
907243364 1:53092723-53092745 CCCTGGGGTCGTCCATCTCCAGG + Exonic
908474159 1:64471487-64471509 CCCCGGGGACACCTAGGTCCCGG + Intronic
910262794 1:85308024-85308046 CCCTGCTGCCACCTATCTCTGGG - Intergenic
910394511 1:86778406-86778428 CCCTACGGCCACCTAACCCCAGG - Intergenic
910523977 1:88156306-88156328 TCCTAGGGCCACCCAACTCCAGG + Intergenic
913332594 1:117679823-117679845 CCCTGAGGCTTCCTTTCTCCTGG - Intergenic
913485786 1:119331810-119331832 CACTGGGCCCACCTACCTGCAGG - Intergenic
915603840 1:156938737-156938759 CCCAAGGGCCACCTGTCTCCTGG - Intronic
918114054 1:181482307-181482329 CACTGGGGACACCTCTCTGCAGG + Intronic
922620224 1:226984247-226984269 CCCTGGCCCCACCTGTCTGCTGG - Intronic
923033122 1:230265443-230265465 CCCAGCTGCCACCTTTCTCCTGG + Intronic
923390907 1:233514121-233514143 CCATGGGGCCAGCTATTTTCTGG + Intergenic
924208759 1:241743282-241743304 CTCAGGGGTCACCCATCTCCTGG - Intronic
924457660 1:244231323-244231345 CCCAGTGGCCTCCTATCCCCGGG + Intergenic
1064655491 10:17551585-17551607 CCCTGGGCCCACCATTCTCCAGG - Intergenic
1065772858 10:29093807-29093829 CCCTGGGGTCACCTGGCTTCAGG - Intergenic
1067878634 10:50025174-50025196 CCCTGGGGCCATCTGCCTGCAGG + Intergenic
1067893092 10:50152762-50152784 CCCTGGGGCCATCTGCCTGCAGG - Intergenic
1069793576 10:71038947-71038969 CCCTGGGGCCAGTGATATCCAGG - Intergenic
1069908257 10:71744776-71744798 CCCTGAGGCCATCCATCTCCAGG + Intronic
1070472945 10:76801846-76801868 CCCTGGGGCCACCTGTTGGCAGG + Intergenic
1071861192 10:89674458-89674480 CACTGCAGCCTCCTATCTCCCGG + Intergenic
1072240865 10:93494767-93494789 GCCAGGTGCCACCTCTCTCCAGG + Intergenic
1074429923 10:113385768-113385790 CCCTGGGGACACCTCTCCACAGG - Intergenic
1076991531 11:278595-278617 CCCTGGGGCCAGCACTCACCTGG - Exonic
1077037806 11:503710-503732 CCCTGGGGCCACCTTTCATCTGG - Intronic
1077282567 11:1752336-1752358 ACCTGGGGCCATTTATTTCCCGG + Intronic
1079122615 11:17696238-17696260 CCCTGGGGCAGCCTCACTCCTGG - Intergenic
1083254509 11:61487883-61487905 CTCTGGGGCCACCTCCTTCCTGG - Intronic
1087065914 11:94027801-94027823 CCCTGGCACCACCTATGTCTTGG - Intronic
1087281786 11:96219066-96219088 CCCTGGGGCCATCCGGCTCCGGG + Intronic
1089147035 11:116336616-116336638 CCATGGAGCCATTTATCTCCTGG + Intergenic
1089638397 11:119831406-119831428 CCCCTGGGCCACCTATCTCTGGG - Intergenic
1091767255 12:3129834-3129856 CCCTGGGGCCAGCTGTCCCTCGG + Intronic
1092246707 12:6867932-6867954 CCCCGGGGCCACCTTCCTCCAGG - Intronic
1094168509 12:27466602-27466624 CCCTCTGTCCACCCATCTCCTGG - Intergenic
1095916168 12:47481110-47481132 CCCTAGGGTCATTTATCTCCAGG - Intergenic
1096140501 12:49238863-49238885 CCCTGGGCACACCACTCTCCAGG + Intronic
1098071341 12:66678997-66679019 CACTGGGACTACCTTTCTCCTGG - Intronic
1101591579 12:106129883-106129905 GCCTGGGACCATCTAGCTCCTGG + Intronic
1102003883 12:109576230-109576252 GCCAGGGGCCAGCTATTTCCCGG + Intronic
1102226120 12:111229473-111229495 ACCTGGGCCCATCTTTCTCCTGG - Intronic
1103476374 12:121221978-121222000 CCCGGGGGCCTCCTACCTCGGGG - Exonic
1104604914 12:130180763-130180785 CCATGGGGCCCCCACTCTCCTGG + Intergenic
1104956183 12:132466909-132466931 GCCTGGGGTCACCTATTACCAGG + Intergenic
1106335424 13:28778632-28778654 CTCTGGGACCATCTCTCTCCGGG + Intergenic
1107012692 13:35683917-35683939 CCCTGGAGCCTCCTTTCTCCTGG - Intergenic
1107885724 13:44872877-44872899 CCCAGGGGCCACCTCCCTCCGGG + Intergenic
1109080343 13:57891721-57891743 GCCTGGGGCCATCAAACTCCAGG + Intergenic
1109370752 13:61416438-61416460 ACCTGGAGTCACCTAACTCCTGG + Intronic
1111996351 13:95169450-95169472 CTCTGAGCCCACCTTTCTCCAGG + Intronic
1112629065 13:101140520-101140542 CCTTGTGACCACTTATCTCCAGG - Intronic
1113421432 13:110174375-110174397 CCTTGGGGCCTCCCATCCCCTGG + Intronic
1113453278 13:110428472-110428494 CCCTGGGCCCACCTTGCCCCGGG - Exonic
1113464467 13:110503954-110503976 CCCTGGGGCCCCATCTCCCCCGG - Exonic
1113724546 13:112588274-112588296 GCCTCGGGCCACCTGTCGCCCGG - Intergenic
1116295386 14:43100548-43100570 CACTGGTGCCACCTGTCACCTGG - Intergenic
1119877998 14:78076797-78076819 GCCCGGGGCCCCCTCTCTCCAGG + Intergenic
1122822425 14:104354289-104354311 CCCAGGGCCCCTCTATCTCCAGG - Intergenic
1123108338 14:105853285-105853307 CCCTGGGGCCTCCGCTCCCCAGG + Intergenic
1123935053 15:25190054-25190076 CCCTATGCCCACCTTTCTCCAGG - Intergenic
1124374675 15:29122589-29122611 CTCTTGGGCCCCCTTTCTCCAGG - Exonic
1124982681 15:34580512-34580534 CCTTGAGGTCACCTAACTCCCGG + Intronic
1128345035 15:66848185-66848207 CCCTTGGGCCACCCGTCTCATGG - Intergenic
1129029122 15:72605640-72605662 CCCTTGGGCCCCCTGTCCCCAGG - Intergenic
1129037044 15:72656654-72656676 CCCTTGGGCCCCCTGTCCCCAGG - Intronic
1129212843 15:74080571-74080593 CCCTTGGGCCCCCTGTCCCCAGG + Intronic
1129397559 15:75260515-75260537 CCCTTGGGCCCCCTGTCCCCAGG - Intronic
1129401169 15:75284792-75284814 CCCTTGGGCCCCCTGTCCCCAGG - Intronic
1129474761 15:75777493-75777515 CCCTTGGGCCCCCTGTCCCCAGG - Intergenic
1129729980 15:77924891-77924913 CCCTTGGGCCCCCTGTCCCCAGG + Intergenic
1129743330 15:78000874-78000896 CTGTGGGACCACCTACCTCCAGG + Intronic
1129838530 15:78729094-78729116 CCCTTGGGCCCCCCGTCTCCAGG - Intergenic
1130260039 15:82347465-82347487 CCCTTGGGCCCCCTGTCCCCAGG + Intronic
1130281192 15:82521546-82521568 CCCTTGGGCCCCCTGTCGCCAGG - Intergenic
1130472565 15:84237728-84237750 CCCTTGGGCCCCCTGTCCCCAGG - Intronic
1130480056 15:84352299-84352321 CCCTTGGGCCCCCTGTCCCCAGG - Intergenic
1130484283 15:84389874-84389896 CCCTTGGGCCCCCTGTCCCCAGG - Intergenic
1130491713 15:84435830-84435852 CCCTTGGGCCCCCTGTCCCCAGG + Intergenic
1130503328 15:84514870-84514892 CCCTTGGGCCCCCTGTCCCCAGG + Intergenic
1130594860 15:85242362-85242384 CCCTTGGGCCCCCTGTCGCCAGG - Intergenic
1132511756 16:346188-346210 CCCTCGGGGCAGCTGTCTCCAGG + Exonic
1138009418 16:53363502-53363524 CCCTTGGGCCCTCTGTCTCCAGG + Intergenic
1138590267 16:57995868-57995890 CCCTGGGCCCACTGGTCTCCAGG + Exonic
1139269803 16:65671426-65671448 CTCTGTGGCCCCCTGTCTCCTGG - Intergenic
1141714161 16:85717239-85717261 CTCTGGGCCCTCCTAGCTCCAGG + Intronic
1141781885 16:86168056-86168078 TCCCGGGGCCACCTCTCACCTGG + Intergenic
1141978054 16:87531384-87531406 TCCTGGGGCCACTTGTCCCCAGG + Intergenic
1203098887 16_KI270728v1_random:1288587-1288609 CACTGGGTCCGCCAATCTCCAGG - Intergenic
1142631261 17:1228389-1228411 CCCAGGGGCTTCCCATCTCCCGG - Intronic
1142769189 17:2084422-2084444 CCCTGGAACCACCTCTGTCCTGG + Intronic
1143095639 17:4477007-4477029 CCCTGGCGCCACCTCTGTCCAGG + Intronic
1143581778 17:7831827-7831849 TCCTGGGCCCCCCAATCTCCTGG + Intronic
1143611777 17:8022104-8022126 CCCTGGGGTCACCTCTCCCAGGG + Intergenic
1144064599 17:11613247-11613269 TTCTGGGGACACCTGTCTCCTGG - Intronic
1144721109 17:17470492-17470514 CCCTGTGGCCACCTAATACCTGG - Intergenic
1144793158 17:17873042-17873064 GCCTGAGGCCACCTATATTCTGG - Intronic
1144888039 17:18477269-18477291 CCCTGGGTCCAGCTATTTACTGG + Intronic
1145144168 17:20467034-20467056 CCCTGGGTCCAGCTATTTACTGG - Intronic
1145175623 17:20698447-20698469 CCCTGGGTCCAGCTATTTACTGG - Intergenic
1145791695 17:27631686-27631708 CCCTGGGTCCAGCTATTTACTGG + Intronic
1146341224 17:32021268-32021290 CCCTGGGGCCACCTGAGCCCTGG + Exonic
1148174243 17:45550156-45550178 CCCTGGGGCCGCCTGAGTCCTGG - Intergenic
1148275019 17:46295291-46295313 CCCTGGGGCCGCCTGAGTCCTGG + Exonic
1148297126 17:46512870-46512892 CCCTGGGGCCGCCTGACTCCTGG + Exonic
1148912383 17:50949770-50949792 GCTTGGGGCCACCTCTCTCTAGG + Intergenic
1149865311 17:60148314-60148336 CCCAGGGCCCCCCTCTCTCCTGG + Intergenic
1150299604 17:64037189-64037211 TCATGAGCCCACCTATCTCCAGG - Intergenic
1152463306 17:80452379-80452401 CCGTGGGGCCACAGATGTCCTGG + Intergenic
1153222066 18:2870752-2870774 CCCTGTGGACACCCACCTCCAGG - Intronic
1153681464 18:7504865-7504887 CCATGGGGCAACCAAACTCCAGG - Intergenic
1154450671 18:14473461-14473483 CCATGGGGTCCCCTATCTGCGGG - Intergenic
1156545071 18:37956237-37956259 GCTGGGGGCCACCTCTCTCCAGG + Intergenic
1158057910 18:53303979-53304001 CCATGGGACCACCAAACTCCAGG - Intronic
1160804493 19:986114-986136 CCCTGCTGCCTCCTTTCTCCAGG + Intronic
1160924878 19:1539207-1539229 TCCTGGGGCCACCCATCTGCAGG + Intergenic
1160928725 19:1559781-1559803 CCCTGGGACCACCAGCCTCCAGG - Intronic
1162104961 19:8364633-8364655 CCCTGGGGACACGTACCTGCAGG - Exonic
1162879429 19:13647237-13647259 CTCTGGGGGCACCTATAGCCAGG - Intergenic
1163637984 19:18446211-18446233 CTCTGGGGCCACCAAGCTCGTGG + Intronic
1164148027 19:22524576-22524598 CCCTTGGGCCCCCTGTCCCCAGG + Intronic
1164155976 19:22597423-22597445 CCCTTGGGCCCCCTGTCCCCAGG - Intergenic
1165114724 19:33521953-33521975 CTCTTGGGCCCCCAATCTCCGGG - Intergenic
1165306705 19:35007114-35007136 CCCTGGGTGCACCTCACTCCAGG - Intronic
1166986194 19:46661096-46661118 CCCCGCGGCCACCCCTCTCCCGG + Exonic
1167958915 19:53090493-53090515 CCCTGTGGCCACATATTTACAGG + Intronic
925919809 2:8631078-8631100 CCCTGGGGTCTCCTAGCTCCAGG - Intergenic
926697420 2:15780454-15780476 CCCTGGGCCCACTGAGCTCCTGG + Intergenic
926758073 2:16251923-16251945 CCCTGGGTGCTCCTTTCTCCAGG + Intergenic
927875673 2:26653715-26653737 CTCGCGGGCCACCTGTCTCCAGG + Intergenic
928595694 2:32856976-32856998 CCCAGTGCCCACCTATCCCCAGG + Intergenic
929768256 2:44868966-44868988 GCCTGTGGCCATCTATATCCCGG + Intergenic
930746007 2:54884298-54884320 CCCTGGGTGCACCTCCCTCCAGG + Intronic
931405252 2:61970981-61971003 CACTGTGGCCCCCTGTCTCCTGG + Intronic
932934092 2:76081031-76081053 GCCTGGGGCTACCTCTATCCCGG - Intergenic
933987902 2:87608026-87608048 CCCTGGGTGCACCACTCTCCAGG - Intergenic
934661077 2:96144083-96144105 GACTGGGGGCACCTGTCTCCTGG - Intronic
935042616 2:99447793-99447815 CACTGGAGCCTCCCATCTCCTGG + Intronic
935226028 2:101054061-101054083 CCCTGGGGCCAACTTTATCTTGG + Intronic
938405747 2:131032234-131032256 CCCTGGGGACATCTGTCCCCAGG - Intronic
938480768 2:131659422-131659444 CCACGGGGTCACCTATCTGCGGG + Intergenic
939097289 2:137848367-137848389 CCCTGGAGCCACCTTTTTCCTGG - Intergenic
939587372 2:144021482-144021504 CCCTTGGGTCAACTATGTCCTGG - Intronic
942543335 2:177037348-177037370 CCCTGCTTCAACCTATCTCCCGG + Intergenic
944530797 2:200665801-200665823 AGCTGAGGCCACTTATCTCCTGG + Intronic
947636355 2:231682510-231682532 CCCTGGCCCCACCTCTCTTCTGG + Intergenic
948368506 2:237473603-237473625 CTCTGGGGGCACCTCTCTCAAGG + Intergenic
948456228 2:238105860-238105882 GCCTGGGGCCTCCTGTCTCCTGG + Intronic
948730216 2:239958485-239958507 CCCTGGGTCCACCTGTGGCCTGG + Exonic
1171443648 20:25187386-25187408 CCCTCCTCCCACCTATCTCCTGG - Intergenic
1172776132 20:37408086-37408108 CCCTGGGGTCTCATATCCCCGGG - Intergenic
1174137964 20:48393464-48393486 GCCTGGGGCCATCCATCACCCGG - Intergenic
1174362970 20:50040091-50040113 CCCTCGGGCCAGATACCTCCTGG - Intergenic
1176413544 21:6461734-6461756 CCCTGGAGCCCCTTATCTCAAGG + Intergenic
1179655501 21:42842041-42842063 CCCTGTGGCCACCTGACCCCGGG + Intergenic
1179689041 21:43070057-43070079 CCCTGGAGCCCCTTATCTCAAGG + Intronic
1179985639 21:44919152-44919174 CCCTGTGGCCACCTGACCCCGGG - Intronic
1179996815 21:44977946-44977968 CTCTGGGGCCTCCTGGCTCCAGG + Intergenic
1180137454 21:45870959-45870981 CCCTGGGGGCCCCCATTTCCTGG - Intronic
1184389146 22:44192866-44192888 CCCTGGGCCCATCCCTCTCCAGG - Intronic
1184687560 22:46103525-46103547 CCCTGGGGCCGCCCATCTGTTGG + Intronic
949836738 3:8278220-8278242 CCCTGGGGTTGCCTCTCTCCTGG - Intergenic
950507440 3:13403969-13403991 CCCTGGGGCCTGCTCTCTCTGGG + Intronic
951476927 3:23117072-23117094 CCCTGGGACCCCTTACCTCCTGG - Intergenic
952315892 3:32231910-32231932 CCCTGGGCCCACCTGTGGCCTGG + Intergenic
952826704 3:37530501-37530523 CCCTGGGGCCACCTATCTCCAGG - Intronic
952874881 3:37936253-37936275 CCCTGGGGACATTTATCTCATGG + Intronic
952901490 3:38114609-38114631 CCCTGAGGCCACCTTCCCCCAGG - Intronic
953405249 3:42656686-42656708 ACCAGGGGCCACCTGTCTCCAGG - Intronic
954369235 3:50161558-50161580 ACCTGGGGCCACCCATCCCAGGG + Intronic
954462188 3:50633659-50633681 CCCTGTGGCCACCTGGCTGCAGG - Intronic
955065328 3:55529087-55529109 GCCTGGGGACTCCCATCTCCTGG - Intronic
956043866 3:65174628-65174650 TCCTGGGGCCAGCTTACTCCTGG - Intergenic
956845462 3:73178286-73178308 CCCTTGGGCCACCTTTGTCCTGG - Intergenic
957536060 3:81505241-81505263 TCCTGGGGTCACTTAGCTCCTGG - Intronic
958524690 3:95240852-95240874 CCATGGGGCAACCGAACTCCAGG - Intergenic
960958517 3:123052438-123052460 CCCTGGGCTCAACCATCTCCTGG + Intergenic
961177259 3:124845967-124845989 CCCTGTGGCCACCTGTCGCCAGG + Intronic
961572916 3:127813296-127813318 CCCTCCTCCCACCTATCTCCTGG + Intronic
961653023 3:128426697-128426719 TCCTGGGCCCACCCGTCTCCGGG + Intergenic
962653314 3:137517687-137517709 CCCTGGGGCAACCTTCCTCCAGG + Intergenic
966974402 3:185071676-185071698 CCCAGGGGCCTCCTCTCTCAGGG + Intergenic
968454164 4:688806-688828 CCCTGGGCCCAGCCACCTCCAGG + Intronic
968481193 4:833789-833811 CCTTGGGGACACCAATCTCAGGG - Intergenic
968615534 4:1575932-1575954 CCCTGGGGCCACTTCACCCCGGG - Intergenic
968945112 4:3659632-3659654 TGCAGGGGCCACCTCTCTCCTGG + Intergenic
969427203 4:7132136-7132158 CCCTGGGGCCACCTGTGACCTGG - Intergenic
969832341 4:9807926-9807948 GCCTGGGGCCAACTATTTCAGGG - Intronic
970587850 4:17531409-17531431 CCCTGGGTGCACCTCCCTCCAGG - Intergenic
980096578 4:128497472-128497494 CTCTGGGACCACCACTCTCCAGG + Intergenic
980101415 4:128544915-128544937 TCCTGGGGCCACGCTTCTCCAGG - Intergenic
981570826 4:146148789-146148811 CCCTGGGAAAACCCATCTCCTGG - Intergenic
990987980 5:61658854-61658876 CTCTGGGGCCCCCCTTCTCCTGG - Intronic
994104977 5:95937420-95937442 CCCAGGGGCAGCCCATCTCCTGG + Intronic
994140235 5:96333559-96333581 CCCTGGCCCCACCTGACTCCAGG - Intergenic
995180379 5:109225287-109225309 CCCTGTGGCCGCATATCACCTGG - Intergenic
996808302 5:127483117-127483139 CCCTGGTTCCCCCTACCTCCAGG + Intergenic
997283052 5:132660508-132660530 CCCTGGGTCCACCGAGCTCAGGG - Exonic
998073721 5:139219147-139219169 ACCTGGACCCACCTATCTCTGGG + Intronic
1001090598 5:168737394-168737416 CCCTGTGCCCTCCTACCTCCTGG + Intronic
1001284001 5:170409308-170409330 CCCTGGGACCACCTGCCTTCAGG + Intronic
1001303592 5:170555524-170555546 CCGTGGGGCCAGCTAGCTCTTGG - Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1003985214 6:11428277-11428299 CCCTGGGTCTCCCAATCTCCTGG + Intergenic
1004303463 6:14478943-14478965 CTCTGGGGCCACCTTTTTCTGGG + Intergenic
1004312171 6:14555291-14555313 CCTGGGGGCCTCCTCTCTCCAGG + Intergenic
1006296128 6:33170880-33170902 CCCTGGGGTCCCCGAGCTCCGGG + Exonic
1007673918 6:43579481-43579503 CCCTGGGAACACCACTCTCCAGG - Intronic
1010038218 6:71351145-71351167 CCCTGGGGCAACCTACCTGAAGG - Intergenic
1010249228 6:73691273-73691295 TCCTGGGGCCACCTGAGTCCAGG - Intergenic
1017558973 6:155606487-155606509 CCCTGGGCCCTCATATCTCTGGG + Intergenic
1017898102 6:158698960-158698982 CCCTCTGGCCACCTCTCTGCTGG - Intronic
1018101554 6:160445349-160445371 CCCTGGCACCACCTCTCTTCAGG - Intronic
1018746838 6:166768900-166768922 CCCTGTGGCCACATGGCTCCGGG + Intronic
1019478138 7:1253961-1253983 CTCTGGGGCCCCCTGTTTCCGGG - Intergenic
1019909342 7:4089657-4089679 CCCTGGGGCTGCCTGACTCCTGG + Intronic
1022922081 7:35025800-35025822 CCCTGGGGCCAGTAACCTCCTGG + Intronic
1023978972 7:45054846-45054868 CCCTGGGGAACCCTGTCTCCTGG - Intronic
1024062646 7:45710381-45710403 TCCTGGGGTCACCTAGCACCAGG - Intronic
1026476921 7:70744333-70744355 CCCTGAGGCCACCAATGTCACGG + Intronic
1029611820 7:101630624-101630646 CCCTGGGGCCTCCTGGCTCTGGG + Intergenic
1032763483 7:134967196-134967218 CCCTGGTGCTACATAACTCCAGG - Intronic
1033472220 7:141660347-141660369 CTCTGGGGCCACCCATACCCTGG + Exonic
1035079212 7:156202333-156202355 CCTTGGGGCCATCTCTCTCCTGG - Intergenic
1035260563 7:157659209-157659231 CCCTGCGGCCCCCACTCTCCAGG + Intronic
1035305074 7:157926900-157926922 CCCTGGGGCTTCCTGTCTTCAGG - Intronic
1035305117 7:157927080-157927102 CCCTGGGGCTTCCTGTCTTCGGG - Intronic
1035305132 7:157927140-157927162 CCCTGGGGCTTCCTGTCTTCGGG - Intronic
1035305162 7:157927260-157927282 CCCTGGGGCTTCCTATCTTTGGG - Intronic
1035305190 7:157927379-157927401 CCCTGGGGCTTCCTGTCTTCAGG - Intronic
1035305218 7:157927498-157927520 CCCTGGGGCTTCCTGTCTTCGGG - Intronic
1035305247 7:157927617-157927639 CCCTGGGGCTTCCTGTCTTCGGG - Intronic
1036005150 8:4653662-4653684 GCCTGGGGCAACTTAACTCCTGG - Intronic
1036209257 8:6828735-6828757 CCCTGGTGCCATCTGTCTACAGG + Intronic
1036752316 8:11451098-11451120 CCCTGGGGTTTCCTTTCTCCTGG + Intronic
1038268326 8:26053283-26053305 ACTTGGGGCCATCTACCTCCCGG - Intergenic
1039733453 8:40304993-40305015 GCCTGGGTCCTCCTGTCTCCTGG - Intergenic
1040852888 8:51920220-51920242 CCCTTGACCCACCTATCCCCGGG + Intergenic
1041143299 8:54845115-54845137 CCCAGGGGCCACCCAGCTTCTGG - Intergenic
1045517425 8:102872377-102872399 CCCTGGGCCCGCCACTCTCCAGG + Intronic
1045869534 8:106909027-106909049 CCCTGGGGGCACCGCTTTCCAGG + Intergenic
1045991550 8:108314493-108314515 CCCTGGGCCCACTACTCTCCAGG - Intronic
1046016804 8:108615256-108615278 CCTAGAGGCCACATATCTCCTGG + Intronic
1048589305 8:135806315-135806337 TCCTGGGGCCACCTGTATACAGG - Intergenic
1049202827 8:141350241-141350263 GGCTGGGGCCACCACTCTCCTGG - Intergenic
1053262752 9:36684491-36684513 GCCTGGGGTCACCTCTCTGCAGG + Intergenic
1056722299 9:89082474-89082496 CCATGGGGCCACCTAGGCCCTGG + Intronic
1057292065 9:93813059-93813081 TGCTGGGGCCACCTCTTTCCCGG - Intergenic
1057492380 9:95531135-95531157 TCCCAGGGCCACCTATCTCCAGG - Intergenic
1059378836 9:113907670-113907692 CCCTGGGGCCACCTGTAGACTGG + Intronic
1059465624 9:114467136-114467158 CCCAGGGGTCTCCTATCACCTGG + Intronic
1060496689 9:124124697-124124719 CCCTCTGGCCTCCTTTCTCCTGG + Intergenic
1060521980 9:124299139-124299161 CCCTGGGGCCTCCCATGTACTGG - Intronic
1060985876 9:127818673-127818695 CCCTCGGGCCTCCCAGCTCCTGG - Intronic
1061065240 9:128273805-128273827 CCCTTGGGCCCCCTGTCCCCAGG + Intronic
1061226341 9:129283103-129283125 CCCTGGGGTCACATAGCTGCAGG + Intergenic
1061395179 9:130339917-130339939 CCCAGGGGCCACCTTGCTCCAGG - Intronic
1061660235 9:132125227-132125249 CCATGGGGCCACCTCCCTACAGG - Intergenic
1061887474 9:133599058-133599080 CCCTGGGGGCACCTTCCACCTGG + Intergenic
1061926609 9:133808968-133808990 CTGCAGGGCCACCTATCTCCTGG - Intronic
1062338858 9:136084665-136084687 CCCTGGGGCCACTTGCCTCTTGG - Intronic
1188906773 X:35800029-35800051 CTGTGGGGCCACCTATGTTCTGG - Intronic
1191864283 X:65691320-65691342 CCCAGAAGCCCCCTATCTCCTGG + Intronic
1192938127 X:75882539-75882561 CCCTGCAGACACCTCTCTCCAGG - Intergenic
1194019118 X:88665767-88665789 CCCAGGAGCCACTCATCTCCAGG - Intergenic
1194552527 X:95319645-95319667 CCCTGGTGCCACCTGTCTGCTGG + Intergenic
1200060962 X:153483577-153483599 CCCTGGAGCCCCCTGCCTCCTGG - Intronic
1200162113 X:154014988-154015010 CCCTGGGGGCGCCTCTCTGCGGG - Intronic
1200256560 X:154585755-154585777 ACCTGGGTCCCCCTATCTCCTGG - Intronic
1200261209 X:154618648-154618670 ACCTGGGTCCCCCTATCTCCTGG + Intronic
1201060365 Y:10038685-10038707 CCCTGAGGCCACCTACCACCTGG + Intergenic
1202366600 Y:24170056-24170078 CCCTTGGGCCCCCTGTCCCCAGG - Intergenic
1202504182 Y:25500067-25500089 CCCTTGGGCCCCCTGTCCCCAGG + Intergenic