ID: 952827670

View in Genome Browser
Species Human (GRCh38)
Location 3:37537657-37537679
Sequence CATTCTAGTGGGAGGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952827660_952827670 -3 Left 952827660 3:37537637-37537659 CCTTGCCCTCATGGAGCTGGCAT 0: 2
1: 16
2: 137
3: 594
4: 1737
Right 952827670 3:37537657-37537679 CATTCTAGTGGGAGGGGGGCAGG 0: 1
1: 0
2: 2
3: 34
4: 240
952827662_952827670 -9 Left 952827662 3:37537643-37537665 CCTCATGGAGCTGGCATTCTAGT 0: 3
1: 19
2: 113
3: 516
4: 1622
Right 952827670 3:37537657-37537679 CATTCTAGTGGGAGGGGGGCAGG 0: 1
1: 0
2: 2
3: 34
4: 240
952827661_952827670 -8 Left 952827661 3:37537642-37537664 CCCTCATGGAGCTGGCATTCTAG 0: 3
1: 21
2: 154
3: 634
4: 1809
Right 952827670 3:37537657-37537679 CATTCTAGTGGGAGGGGGGCAGG 0: 1
1: 0
2: 2
3: 34
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952827670 Original CRISPR CATTCTAGTGGGAGGGGGGC AGG Intronic
900851306 1:5145108-5145130 CAGTCTACTTGGAGGGGGGCTGG - Intergenic
900999909 1:6143757-6143779 CATTCAAGTCTGAGGTGGGCAGG + Intronic
901365846 1:8747367-8747389 CATGGAAGTGGGAGGTGGGCAGG + Intronic
901661244 1:10799232-10799254 CATTATAGTGGGAAAGGGGTAGG - Intergenic
902310720 1:15579519-15579541 CATTCTGGTTGGAGGTGGGAGGG - Intronic
903689707 1:25164134-25164156 CAATGTTGTGGGAGTGGGGCAGG - Intergenic
904006177 1:27364391-27364413 AATCCTGGTGGGAGGGAGGCAGG + Exonic
904468091 1:30719604-30719626 GAGCCTAGTGGGAGGGGAGCAGG - Intronic
904821732 1:33249552-33249574 CTTTCTTGGGGGAGTGGGGCAGG - Intergenic
905807721 1:40888897-40888919 CATTCTAGTGGGGTGAGGGGAGG - Intergenic
906307336 1:44727789-44727811 CATTCAAGTTGGAGTGAGGCAGG + Intergenic
911052769 1:93685277-93685299 ATTTCTAGTGGGAGGGGGTCTGG - Intronic
915051987 1:153084662-153084684 CATACTATTGGGCTGGGGGCAGG - Intergenic
915053599 1:153103652-153103674 CATACTATTGGGCTGGGGGCAGG - Intronic
917106209 1:171494774-171494796 CTTTCTTGAGGGAGGGGGGCAGG - Intronic
918077490 1:181181644-181181666 CATTCCTGTGGGCGGGGGGGGGG - Intergenic
918448735 1:184639367-184639389 CAATCTAGGTGGTGGGGGGCTGG - Intergenic
920668900 1:207987925-207987947 TATTCTAGTGGGTGGGAGGCTGG - Intergenic
921198756 1:212783368-212783390 CTTTCAAGTGGGAGGGGTGGGGG + Intronic
922891685 1:229066616-229066638 CATTTGAGTGGGAGGAAGGCAGG + Intergenic
924162487 1:241247029-241247051 CATTCAAGCAGGAGGGAGGCTGG + Intronic
924743147 1:246809427-246809449 CATTGAAGTGGGAGGGAGGCAGG + Intergenic
924936983 1:248780331-248780353 CATGCTGGGGGGAGGGGGGAGGG - Intergenic
1067170466 10:43902189-43902211 CATTCACGTGGGAGGGGGTGTGG - Intergenic
1072288966 10:93944782-93944804 TATTCTAGTGGGAGCACGGCAGG - Intronic
1072964057 10:99956082-99956104 CATTCTTTTGGGAGGTAGGCTGG + Exonic
1073002952 10:100298854-100298876 CATTCTAAAGGTAGGGGGTCAGG - Intronic
1074858376 10:117490473-117490495 CATTCTAATGGGTCAGGGGCTGG - Intergenic
1075626785 10:123969607-123969629 CTGTCTAGGGGTAGGGGGGCGGG + Intergenic
1076560474 10:131360097-131360119 CAGTCCAGTGGGTTGGGGGCAGG - Intergenic
1077106324 11:844056-844078 CATCCTGGGGGGAGGGGGTCAGG - Intronic
1077275574 11:1705777-1705799 CAGTGTGGTGGGTGGGGGGCTGG + Intergenic
1077750289 11:4960034-4960056 CATTCTCCTGGGTGGGGGGGCGG - Intronic
1078853076 11:15181551-15181573 CATTCCAGTGTGTGGGGAGCTGG - Intronic
1079347623 11:19667010-19667032 GATTATGGTGGGAGGGAGGCTGG - Intronic
1079513663 11:21240758-21240780 CTTTCTAGTGGGGGGGGGGAGGG + Intronic
1081644212 11:44778497-44778519 CCTTCTAGTAGGTGGGTGGCTGG + Intronic
1081804403 11:45882612-45882634 CATCATCGTGGGAGGGGAGCAGG + Exonic
1081955921 11:47092873-47092895 CATTCTAGTGTGGGAGGGTCAGG - Intronic
1084645678 11:70456175-70456197 CCATCTTGTGGGAGGGGGGAGGG + Intergenic
1084904796 11:72337292-72337314 CATTACAGGGGCAGGGGGGCGGG - Intronic
1085703887 11:78768873-78768895 CATTCTAGTGCTAGGAGGGCTGG + Intronic
1086427495 11:86700465-86700487 GTTTCTAGTGGGAGGTGGGAGGG + Intergenic
1087291537 11:96326091-96326113 CATTTTAATGGGGGGGGGGCGGG - Intronic
1087460479 11:98439401-98439423 AAGGCTAGTGGGAAGGGGGCAGG - Intergenic
1091367677 11:135036180-135036202 CATCTGAGTGGGAGGTGGGCTGG - Intergenic
1091952996 12:4610717-4610739 AATCCTAGGGGGAGGGGGACAGG - Intronic
1092660519 12:10733459-10733481 AATTCCAGTGGCAGGGGGGCCGG - Intergenic
1095958971 12:47821701-47821723 CTATCTAGTGGGAGGGAGGGAGG + Intronic
1096578409 12:52569264-52569286 CATGTTAGTGGGCGGGGGGGTGG - Intronic
1097208207 12:57342310-57342332 CATTCAAGGGTGAAGGGGGCGGG - Intronic
1098332724 12:69371723-69371745 CATTCTAGTGGGAGGAAAACAGG + Intronic
1099415891 12:82386197-82386219 CAGACTTGTGGCAGGGGGGCGGG - Intronic
1100626112 12:96333997-96334019 CATTCTAGTGGAAGGGGTAAGGG + Intronic
1101987865 12:109461507-109461529 CATTCTTGGGGGTGGGGGCCAGG + Intronic
1102493611 12:113304362-113304384 CATCCTCGTGGGTGTGGGGCTGG - Exonic
1103506047 12:121442899-121442921 CAGTCCCGTGGCAGGGGGGCGGG - Intronic
1104619572 12:130301232-130301254 CATTCTAGATGGGGGGGGGGCGG + Intergenic
1104705788 12:130946531-130946553 CCTTCAAATGGGAGAGGGGCAGG - Intergenic
1105446440 13:20461717-20461739 GATTCTGGTGGGAGTGGGGCAGG + Intronic
1106257799 13:28037711-28037733 CAGTCTAGAGGCTGGGGGGCTGG - Intronic
1106606407 13:31233469-31233491 CAGTCTAGTTGGTGGGGGCCTGG + Intronic
1106801300 13:33259119-33259141 CATTCTAGTGGGGGCAGGGGAGG - Intronic
1106836394 13:33639868-33639890 TATTCTAGTTGGTGGGTGGCGGG + Intergenic
1110261178 13:73486902-73486924 CATTCTAGTGGGGAGGACGCAGG + Intergenic
1114533558 14:23409746-23409768 TAAACTGGTGGGAGGGGGGCTGG - Intergenic
1114620720 14:24094537-24094559 CATCCTAGGCGGAGGCGGGCAGG + Intronic
1115565478 14:34621580-34621602 CATTCTAGTTTGGTGGGGGCAGG + Intronic
1117751154 14:58924658-58924680 CATTCCTGTGGAAGAGGGGCTGG + Intergenic
1119264799 14:73258217-73258239 CATCCTAGTGGGTGGGAAGCAGG + Intronic
1119352451 14:73977256-73977278 CGTTCCAGGGGGAGAGGGGCAGG - Intronic
1121341062 14:93105434-93105456 GATTCTCCTGGGAAGGGGGCTGG - Intronic
1121583007 14:95044846-95044868 CATGCCACTGGGAGGAGGGCGGG + Intergenic
1122101070 14:99409965-99409987 CATTCTAATGGGAGGCGGGGGGG + Intronic
1122462354 14:101905965-101905987 CATTCTAGTGGGGAGGAGACAGG - Intronic
1125475556 15:40045900-40045922 CATGGGAGTGGGAGGGGGACAGG - Intergenic
1127320545 15:57840923-57840945 CATTATAGTGGGAGGGGGTCTGG + Intergenic
1127958864 15:63876175-63876197 CATTCTAGTGGGGAGTGGGGTGG - Intergenic
1128234163 15:66056151-66056173 CATTCCAGTGGGAGAAGTGCTGG + Intronic
1128836098 15:70810255-70810277 TATTTTTGTGGGAGGGAGGCTGG + Intergenic
1131459076 15:92605792-92605814 CATTCCAGTGGCAAGGGGGCAGG + Intergenic
1131683199 15:94745355-94745377 CATTTTGGTAGGAGGGAGGCAGG - Intergenic
1132557497 16:579002-579024 CGTTCGAGTGGGGCGGGGGCGGG + Intronic
1132943497 16:2519962-2519984 CACTCTAGGGGGTGGGGCGCCGG - Exonic
1133222817 16:4326437-4326459 CATGCTGCTGGGAGCGGGGCAGG + Intronic
1133596652 16:7300216-7300238 CATTCTAGTGGGTGGGGGAGGGG - Intronic
1134257294 16:12622749-12622771 CTTTTTAGGGGGAGGGGGGAAGG + Intergenic
1135319544 16:21483083-21483105 CACTCTAGGGGGCGGGGGGAAGG + Intergenic
1135372381 16:21914571-21914593 CACTCTAGGGGGCGGGGGGAAGG + Intergenic
1135439405 16:22456137-22456159 CACTCTAGGGGGCGGGGGGAAGG - Intergenic
1136275190 16:29175631-29175653 CATCCTTGTAGGAGGGAGGCGGG + Intergenic
1136329776 16:29564805-29564827 CACTCTAGGGGGCGGGGGGAAGG + Intergenic
1136417945 16:30114673-30114695 CAGTCTGGCGGGAGAGGGGCAGG + Exonic
1136444403 16:30304509-30304531 CACTCTAGGGGGCGGGGGGAAGG + Intergenic
1137048079 16:35686763-35686785 CATTCTAATGGGAGAGATGCTGG - Intergenic
1138114100 16:54346659-54346681 CATCCTAGTGGGAGTGAAGCGGG + Intergenic
1138582229 16:57949119-57949141 CATTCTAGTGTGTGTGGGGGGGG + Intronic
1138594488 16:58022565-58022587 GCTCCTATTGGGAGGGGGGCAGG + Intergenic
1138671922 16:58622325-58622347 CACTCTAGTGGGGGGGGGGGGGG + Intronic
1139581845 16:67878457-67878479 CAGCCTAGTGGGTGGTGGGCTGG + Intronic
1139725428 16:68893869-68893891 CTTTCTAGTTGGGGCGGGGCGGG - Intronic
1141044768 16:80706286-80706308 CATTCTTGTGTGAGGGTGGAGGG - Intronic
1142079549 16:88141699-88141721 CATCCTTGTAGGAGGGAGGCGGG + Intergenic
1142147859 16:88499959-88499981 CATCCTGGTGGTTGGGGGGCGGG + Intronic
1142682516 17:1558777-1558799 CATTCTCTGGGGGGGGGGGCGGG - Intronic
1143891832 17:10107943-10107965 CAGTCCAGTGGGAGCTGGGCAGG + Intronic
1144092732 17:11872364-11872386 CATTGCAGGGGGTGGGGGGCGGG - Intronic
1144417781 17:15068290-15068312 CTTTTTGGGGGGAGGGGGGCAGG + Intergenic
1144571642 17:16403762-16403784 CATTCTAGAGGGATTTGGGCAGG - Intergenic
1144836648 17:18159803-18159825 CATGCTGGTGGGGAGGGGGCTGG + Intronic
1145036070 17:19541395-19541417 GGGTCTAGTGGGTGGGGGGCAGG + Intronic
1146783434 17:35696812-35696834 CATTCTAGTAGGAGAGGAGCAGG - Intronic
1149529337 17:57382242-57382264 CTTTCTGGTAGGAGGGGGACAGG + Intronic
1152897085 17:82918345-82918367 CAGACTGGTGGCAGGGGGGCAGG - Intronic
1154383887 18:13876172-13876194 CATTCTGCTGGGAGAAGGGCTGG - Intergenic
1155618165 18:27745488-27745510 CATCCTAGTGGGATGTGGGATGG - Intergenic
1157103140 18:44748117-44748139 TCCTCTAGTGGGAGGGGAGCAGG - Intronic
1158622472 18:59045035-59045057 CATTCTGCTGGGAGGGAGGCAGG + Intergenic
1158734169 18:60060995-60061017 CTTTCTAGGTGGAGGGGGGCGGG + Intergenic
1159226361 18:65542643-65542665 AATTCTAGGGGGAGAGGGCCAGG - Intergenic
1160583000 18:79898408-79898430 CACTCTCGTGGGTGGGAGGCTGG - Intronic
1162312216 19:9914086-9914108 CCGCCTAGGGGGAGGGGGGCCGG - Intronic
1162785483 19:13032123-13032145 CAGTGGAGGGGGAGGGGGGCAGG + Intronic
1163631071 19:18418180-18418202 CATCCTTGTGCGTGGGGGGCGGG - Intergenic
1164379032 19:27716663-27716685 CATTCTAATGGGAGGGGCTCTGG - Intergenic
1164384089 19:27758803-27758825 CATTCTAATGGGAGAGAGTCTGG - Intergenic
1165635470 19:37336199-37336221 CATTCCAGTGGGAGGCGGCAAGG + Intronic
1165777494 19:38413279-38413301 CATTGAAGGGGGAGGGTGGCTGG + Exonic
1166051764 19:40264808-40264830 CATTCCAGTGGGGGTGGGGCAGG - Intronic
1166656276 19:44614273-44614295 CATTCTGGTGGAAGGGGGCTGGG - Intronic
1167135474 19:47612946-47612968 AATTCTCGGGGGAGGTGGGCAGG + Intronic
1167292934 19:48634637-48634659 CCTTCAAGCGCGAGGGGGGCGGG - Intronic
925851775 2:8088712-8088734 CATTCCAGAGGGAAGGAGGCAGG + Intergenic
926119052 2:10231571-10231593 GATTCTCATGGGAGGTGGGCAGG + Intergenic
927399146 2:22690532-22690554 CATTCTAGGGGAAGGTGGTCAGG + Intergenic
927596596 2:24403047-24403069 AATTCAAGTGGGATGCGGGCAGG - Intergenic
927711609 2:25329580-25329602 CATTCTAGTGGCACGGGGCCTGG - Intronic
928353203 2:30582208-30582230 CATTGCCATGGGAGGGGGGCAGG - Intronic
929651271 2:43682058-43682080 TAGTCCAGTGTGAGGGGGGCAGG - Intronic
930445313 2:51463550-51463572 GGTACTAGTGGGAGGGGGGAAGG + Intergenic
931627261 2:64267889-64267911 AATTCTAGGGGGTGGAGGGCTGG - Intergenic
931653747 2:64491287-64491309 CATTCTAGTGGTGGGGGGAGGGG + Intergenic
932576221 2:72963740-72963762 CATTCCAGTGCCAGGGAGGCTGG + Intronic
935089859 2:99884820-99884842 CATTCTGGTGAGGGGGTGGCTGG + Intronic
935706556 2:105862226-105862248 CAGACTAGTGGGAAGGGGGTCGG + Intronic
936911725 2:117600742-117600764 CCTGCCAGTGGGTGGGGGGCTGG + Intergenic
937012384 2:118573984-118574006 CATTCTTGTAGGAGTGTGGCAGG + Intergenic
939283677 2:140100246-140100268 GATTATCGTGGGAGTGGGGCAGG + Intergenic
939814750 2:146880140-146880162 CATTCTTTTGGGCGGGGGGGGGG + Intergenic
940238051 2:151531672-151531694 CCATTTAGTGGGAGGGAGGCAGG - Intronic
940720209 2:157273972-157273994 CCTTTTAGGGGGTGGGGGGCTGG - Intronic
946022573 2:216651228-216651250 CATGCTGGTGGGAGGGAGGGAGG - Intronic
946478210 2:220029315-220029337 GATACTAGTGGAAGGGGGGCTGG + Intergenic
948910727 2:241001165-241001187 CACTGCAGTGGGATGGGGGCTGG - Intronic
948940259 2:241191744-241191766 CATCCTAGTGGGAGGAGGTTAGG - Intronic
1168733127 20:104376-104398 TCTTCTGGTGGGAGGGGGGCTGG - Intergenic
1168750289 20:277192-277214 CAGTCTGGTGGGAGAGGGGCAGG + Intronic
1168828892 20:833685-833707 CATTCTGGTGTGAAGGGGGGCGG + Intergenic
1168954950 20:1828236-1828258 CTTTCTCGTGGCAGAGGGGCTGG - Intergenic
1169633199 20:7656994-7657016 CATTCTAGGGAGAGGGGGGAGGG + Intergenic
1172109901 20:32538572-32538594 CATTCCAGTGAGAGGAGGGGTGG + Intronic
1173494090 20:43506663-43506685 CATTGGTGTGGGAGAGGGGCTGG + Intergenic
1174568839 20:51486590-51486612 CATTCTAGTGGGGCGGGGGGTGG - Intronic
1175952836 20:62592536-62592558 CATTCTAGTGGGAGGTGCCTGGG + Intergenic
1177720002 21:24893494-24893516 CTTGTTAGTGGGTGGGGGGCTGG - Intergenic
1178379601 21:32096708-32096730 CATCCTAGGGGGAGGAGGGAAGG - Intergenic
1180699234 22:17772824-17772846 GATTCTAGGGGGAGGGTGCCTGG - Intronic
1181036358 22:20171621-20171643 AATTCTAGTGGAGGGAGGGCTGG + Intergenic
1182366262 22:29781404-29781426 CATTCTATTGGCAGAGGGGCAGG - Intergenic
1183033936 22:35126595-35126617 CATGCTGTTGGGAGGGAGGCAGG + Intergenic
1183830810 22:40417550-40417572 CCTTGTAGGGGGCGGGGGGCGGG + Intronic
1185318608 22:50190019-50190041 CAGACTAGAGGGAGGAGGGCTGG + Intronic
1185372732 22:50468495-50468517 CCTCCTGGTGGGTGGGGGGCGGG - Intronic
950644610 3:14369578-14369600 CCTTCTCATGGGAGGGGGTCTGG + Intergenic
951204184 3:19909031-19909053 CCTTGTAGGGGGTGGGGGGCGGG - Intronic
952082757 3:29781106-29781128 TATTCTCGGGGGAGGGGGGAGGG - Intronic
952827670 3:37537657-37537679 CATTCTAGTGGGAGGGGGGCAGG + Intronic
954447032 3:50552394-50552416 GATGCTAGTGGGATGGAGGCTGG - Intergenic
954698983 3:52441906-52441928 CATGCTAGTGGGAGGGAGAGAGG + Exonic
955145522 3:56314493-56314515 AATTCCAGTGGGTGGGGGGGTGG + Intronic
956606600 3:71079125-71079147 CACTCTATTTGGAGGGGCGCAGG - Intronic
958027804 3:88069454-88069476 CATTCAAGTGGGTTGGGGGGTGG - Intronic
958638590 3:96777066-96777088 CATTCTAGAGGGCGGCGGGGCGG + Intergenic
959631939 3:108516924-108516946 CATCCCAGTGGGAGGGGAGCGGG - Intronic
959778423 3:110199407-110199429 CAGTCTAATGGGAGGAGGGTGGG - Intergenic
960056457 3:113279552-113279574 CATGCTGGTGGGTGGGGGCCTGG - Intronic
961646185 3:128393994-128394016 CATTCCAGTGGGGCGGTGGCGGG + Intronic
961693622 3:128688637-128688659 CATTAGAGTGGAAGGAGGGCAGG - Intergenic
962814039 3:138982732-138982754 CAGTCTTGTGGCAGGGGGCCTGG - Intergenic
962852915 3:139321158-139321180 CATTCTAGTGGGAGAGGAGGTGG - Intronic
965265965 3:166543761-166543783 GATTTTGGTGGGAGGTGGGCTGG + Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966374116 3:179278038-179278060 CATCCCTGTGGGAGGGTGGCCGG - Intergenic
968536087 4:1130601-1130623 CATTTTAATGGGAGGAGGGGGGG - Intergenic
968751202 4:2389949-2389971 CATTCTGGTGGGCGGGAGGAAGG - Intronic
968973653 4:3810061-3810083 CTTTCTACTTGGTGGGGGGCAGG + Intergenic
970566163 4:17334399-17334421 TACTCTAGTGGCAGGGAGGCAGG - Intergenic
971502702 4:27333716-27333738 CATTCCAGTGGGATGGGAGTGGG + Intergenic
973011736 4:45083659-45083681 CATTCTAGTGGGAGTGTAGTAGG - Intergenic
974412132 4:61555577-61555599 CATTTTAGTGGGAGTGTTGCAGG + Intronic
974801751 4:66827753-66827775 CATACTGGTGGGGTGGGGGCGGG + Intergenic
977859072 4:101933757-101933779 CAGTCTAGTGGAAGGTGGTCAGG + Intronic
978713057 4:111808913-111808935 CATTGTGGGGGGAGGGGGGAAGG + Intergenic
981969183 4:150645886-150645908 CTTTTTCTTGGGAGGGGGGCGGG - Intronic
986111244 5:4720765-4720787 CATCCAAATGGGAGCGGGGCAGG - Intergenic
986220852 5:5767330-5767352 CAGTCTAGTGGGAACGGAGCTGG - Intergenic
989634097 5:43516155-43516177 ATTTCTAGTGGGTGGGTGGCAGG - Intergenic
991105133 5:62834508-62834530 CATGCAAGTGGGAGGGGGAAAGG + Intergenic
991593256 5:68276443-68276465 CATTCCAGGGGGAGGGAGGGAGG + Intronic
992429185 5:76691124-76691146 CACTGTAGTGGGAGGGAGGTGGG + Intronic
992627787 5:78649722-78649744 CATTTGACTGGGCGGGGGGCGGG - Intronic
992915354 5:81445253-81445275 CTTTCTTGTGGGTGGGGTGCTGG + Intronic
995042960 5:107609800-107609822 TATTCTAGTCGGCGGCGGGCAGG - Intronic
996344238 5:122472159-122472181 CAGGCTAGTGGGGTGGGGGCAGG + Intergenic
997438157 5:133890031-133890053 CCTTCTAGTTGGAGGTGGGGTGG - Intergenic
997604963 5:135168208-135168230 TATCCTAGGGGTAGGGGGGCGGG + Intronic
998388249 5:141770813-141770835 CATTCCAGTAGGAGGGTGCCAGG - Intergenic
999366348 5:151026228-151026250 CAGTCTACTGGCAGGGGGTCAGG + Intronic
1000971951 5:167724509-167724531 CATTCTATTGGGTGGAGGGAAGG + Intronic
1002032512 5:176441020-176441042 TGTTCTTGTGGGAGGGAGGCAGG - Intergenic
1006084981 6:31589110-31589132 CATGGTGGTGGGAGGGGCGCTGG + Exonic
1007551424 6:42732800-42732822 CATTCGAGTGGAAGGTGGGCAGG + Intergenic
1007602712 6:43093042-43093064 CATGCTGATGGCAGGGGGGCGGG + Intronic
1008386490 6:50897346-50897368 CAGTGTGGTGGGAGGGGAGCTGG - Intergenic
1009508764 6:64520638-64520660 CATTCTAGTGGGTGAGAGACTGG + Intronic
1011633159 6:89346640-89346662 CACTGTAGGGGGTGGGGGGCAGG - Intronic
1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG + Intergenic
1014433087 6:121392035-121392057 CTTTCTAGTGGGAGGGGTAGAGG + Intergenic
1014499368 6:122165844-122165866 CCTTCTGGTGGGAAGGGGCCAGG - Intergenic
1015799585 6:137046599-137046621 CTTTATAATGGGAGGGGGGAAGG + Intergenic
1015841348 6:137480577-137480599 CATTCCAGTGGGAGAGGGACAGG + Intergenic
1018147016 6:160900769-160900791 CACTCAAGTGGGAGAGGAGCTGG + Intergenic
1019719551 7:2559757-2559779 CATTCCAGTGGGGGGGGGGGGGG + Intronic
1019827992 7:3300378-3300400 CATTTTTGTGGGAGGAGAGCTGG - Intergenic
1022181412 7:27924009-27924031 TATTCTTGTGGGATGGGGACGGG + Intronic
1022884045 7:34623164-34623186 CATTCTAGTGGGAGGAGAAGGGG + Intergenic
1024003814 7:45210770-45210792 CATACTGGTGGGAGGAGGTCAGG - Intergenic
1024220543 7:47283121-47283143 CATTCTGGAGGGAGGGAGACAGG + Intronic
1024445966 7:49479406-49479428 CATTCTTGAGGGTGGGGGGCTGG + Intergenic
1024511402 7:50207491-50207513 CATGCTCCTGGGAGGGTGGCAGG + Intergenic
1029270548 7:99374682-99374704 CTTCCTCGTGGGCGGGGGGCGGG - Intronic
1029323463 7:99785387-99785409 TTTTCTAATGGGAGGAGGGCAGG + Intergenic
1030481776 7:110113622-110113644 CATCCTGGTGGGGGGGGGGGGGG - Intergenic
1031347782 7:120690807-120690829 CATTCTAGTGGGAGGTGGGAGGG + Intronic
1031528592 7:122850477-122850499 CTTCCTTGTGGCAGGGGGGCGGG + Intronic
1033314267 7:140284741-140284763 CATTCTAGTGGTAAGGAGACAGG + Intergenic
1033352029 7:140569607-140569629 GATTCTTGCGGGAGGAGGGCTGG + Intronic
1033647876 7:143318987-143319009 TAGTGTAGTGGGAGTGGGGCAGG + Intronic
1034435926 7:151062743-151062765 GCTTCTGGTGGGAGTGGGGCTGG + Intronic
1035291665 7:157843381-157843403 AATTGTGGTGGTAGGGGGGCCGG + Intronic
1038767297 8:30440965-30440987 CAAACTAGCTGGAGGGGGGCGGG - Intronic
1039622339 8:39009884-39009906 CATTCTAGTGATGGGGGGGGGGG + Intronic
1042036755 8:64541655-64541677 CTTTGTTGTGGGATGGGGGCAGG - Intergenic
1043637500 8:82404724-82404746 CTTCGTAGTGGGAGGGGGGTGGG - Intergenic
1045799261 8:106082803-106082825 CATTAAAGTGGGTGGGAGGCAGG + Intergenic
1048510435 8:135056994-135057016 CCTTGTAGTGGGAGAGTGGCAGG + Intergenic
1048891577 8:138953230-138953252 CATCCTAGAGGGAGAGGGTCAGG - Intergenic
1049179137 8:141212148-141212170 CATTCCAGTGGGCGGGTGGGCGG - Intronic
1049443804 8:142620952-142620974 CATTCTGGGTGGAGGGAGGCTGG - Intergenic
1049748096 8:144271449-144271471 CATTGTAATCGGAGAGGGGCTGG - Intronic
1057493323 9:95539956-95539978 CAGTCAAGTGGCAGGGGAGCTGG - Intergenic
1058120781 9:101136215-101136237 GATTCTAGAGGGAAGTGGGCTGG - Intronic
1058149590 9:101449365-101449387 CACTCTCGTGGGAAGAGGGCGGG + Intergenic
1058505717 9:105663790-105663812 CACCTTAGTGGGCGGGGGGCGGG - Intergenic
1059497434 9:114721199-114721221 CATTCTAATGGGAGGAGGAGGGG - Intergenic
1060152670 9:121298870-121298892 GACTCTAGTGGGAGGGTGGAGGG + Intronic
1060512028 9:124241202-124241224 CATTCTCTTGGGAGAGGGGCTGG + Intergenic
1060694396 9:125694599-125694621 CATTCTTTTGGGAGAGGGGGCGG - Intronic
1060721546 9:125983016-125983038 CATCCCCGTGGGAGGAGGGCAGG - Intergenic
1060772462 9:126342542-126342564 CATTTTAGTGGGAGGTTAGCAGG + Intronic
1062103645 9:134740981-134741003 CCTTCCAGTGAGAGGGGTGCTGG + Intronic
1185777938 X:2820653-2820675 CATTCTAGTGGGGATGGAGCCGG - Intergenic
1186458442 X:9729197-9729219 CATTCTTGCTGGAAGGGGGCTGG + Intronic
1189288377 X:39867919-39867941 GATTCTTGTGGGAGGTGGACGGG - Intergenic
1193168021 X:78303553-78303575 CAGTCTAGTGGGACTGGGGTAGG - Intronic
1195487508 X:105426040-105426062 CATTCTACTGGGAGGGAGACAGG - Intronic
1199259910 X:145760341-145760363 CAGGCTAGAGGGAGAGGGGCGGG - Intergenic