ID: 952827914

View in Genome Browser
Species Human (GRCh38)
Location 3:37539342-37539364
Sequence CAGGAAAGGAAGGCAGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 492}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952827906_952827914 13 Left 952827906 3:37539306-37539328 CCCAAGAGGTACCAGTAAGGAAA 0: 1
1: 0
2: 0
3: 17
4: 225
Right 952827914 3:37539342-37539364 CAGGAAAGGAAGGCAGTTGCAGG 0: 1
1: 0
2: 4
3: 37
4: 492
952827907_952827914 12 Left 952827907 3:37539307-37539329 CCAAGAGGTACCAGTAAGGAAAT 0: 1
1: 0
2: 2
3: 10
4: 231
Right 952827914 3:37539342-37539364 CAGGAAAGGAAGGCAGTTGCAGG 0: 1
1: 0
2: 4
3: 37
4: 492
952827910_952827914 2 Left 952827910 3:37539317-37539339 CCAGTAAGGAAATGGGACAGTGA 0: 1
1: 0
2: 1
3: 22
4: 191
Right 952827914 3:37539342-37539364 CAGGAAAGGAAGGCAGTTGCAGG 0: 1
1: 0
2: 4
3: 37
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952827914 Original CRISPR CAGGAAAGGAAGGCAGTTGC AGG Intronic
900605346 1:3521289-3521311 CAGGAAGGTAAGGCAGTGGAGGG + Intronic
900739806 1:4323763-4323785 CAGGAAAGGGATGGAGTGGCTGG + Intergenic
901876291 1:12168678-12168700 CAGGAAGGGAAGGAAGTGGGAGG - Intronic
902517945 1:16999969-16999991 CAGGGGAGGAAGGAAGCTGCAGG + Intronic
903008381 1:20313330-20313352 CAGGAAAGGAAGTCAAATCCTGG - Intronic
903562495 1:24238360-24238382 CAGGAAAGGGTGCCAGTTGTGGG + Intergenic
903828884 1:26163192-26163214 CAGGAAAGGGAGGCAGTGGCAGG - Intergenic
904135882 1:28312241-28312263 CAGGAAGGGGAGGCAGAGGCAGG - Intergenic
904445413 1:30569924-30569946 AAGGTTAGAAAGGCAGTTGCTGG - Intergenic
904604308 1:31690535-31690557 CAGGAAAGGAAGGCCCTGGTGGG - Exonic
904877565 1:33668192-33668214 CAGGAGAGGTAGGCAGGGGCAGG + Intronic
904972970 1:34433574-34433596 CAGGGAAGGAAGCCAGTTGCAGG + Intergenic
905658128 1:39699403-39699425 CAGGAAAGGAAGTCTTTTTCAGG + Intronic
906058654 1:42934533-42934555 CAGGAAAGGCAGGGGGATGCTGG + Intronic
906314575 1:44777949-44777971 CAGGGAAGGAAGGCAGGCCCTGG - Intronic
906544596 1:46612247-46612269 CAGGAAAAGGAGGGAGTTGGTGG - Intronic
907863035 1:58372148-58372170 CAGGCAATGAAAGCAGCTGCAGG + Intronic
908066700 1:60413839-60413861 ATGGAAACGGAGGCAGTTGCTGG - Intergenic
910112664 1:83699464-83699486 AAGGAAAGAAAGGCAGAAGCAGG - Intergenic
910584761 1:88866842-88866864 CACGCAAGGAAGGCAGAAGCAGG + Intronic
912194023 1:107376979-107377001 TAGGAAAAGCAGGGAGTTGCAGG + Intronic
912411155 1:109481568-109481590 CAGCTAGGGAAAGCAGTTGCGGG + Exonic
912491345 1:110064444-110064466 CAGGAGGGGAAGGCTGGTGCAGG + Intronic
913656110 1:120961675-120961697 CAGGAAAGTCAGGCAGCTGAAGG + Intergenic
913974761 1:143446393-143446415 AAGGAAATGAAGGCATTGGCAGG - Intergenic
914069152 1:144272009-144272031 AAGGAAATGAAGGCATTGGCAGG - Intergenic
914110003 1:144694345-144694367 AAGGAAATGAAGGCATTGGCAGG + Intergenic
914520668 1:148412907-148412929 CAGGAAAGTCAGGCAGCTGAAGG + Intergenic
914768583 1:150662404-150662426 CAGAAAAGGAAGTCAGTTTTGGG + Intronic
914918303 1:151831486-151831508 CAGGAAAGAAAGGGAGAAGCGGG - Intronic
915937859 1:160099209-160099231 CAGGAAAGGCTGGCAGGTGCGGG - Intergenic
916780035 1:168015884-168015906 CAGAAGTGGAAGGCTGTTGCTGG - Exonic
917257960 1:173136610-173136632 AAGGAAAGGAAGGAATTTGCAGG + Intergenic
918736581 1:188071620-188071642 CAGTATAGGAAGGTAGTTGTGGG + Intergenic
918917562 1:190664386-190664408 AAGGATATGAAGGCAGATGCAGG + Intergenic
920215411 1:204358979-204359001 GAGGAAAGGAGGACAGTTGGGGG - Intronic
920787976 1:209061016-209061038 TAGTAAAGGGAGGCATTTGCTGG - Intergenic
921738316 1:218654112-218654134 CAGGAAAACAAACCAGTTGCAGG + Intergenic
923036420 1:230287942-230287964 AAGGAAAGGAAGGAAGGTGCGGG + Intergenic
923492997 1:234500922-234500944 TAGGAAAAGAAGGCACGTGCTGG + Intergenic
923843901 1:237706810-237706832 CAGGAGAAGGAGCCAGTTGCAGG + Intronic
923912143 1:238460759-238460781 CAGGAGAGTTAGGCAGTTTCTGG + Intergenic
1063608605 10:7544161-7544183 CTGGGAAGGAAGGCCGTGGCAGG + Intergenic
1063679292 10:8171905-8171927 CAGGGCAGGAAGGCAGAGGCAGG - Intergenic
1063948600 10:11201663-11201685 CAGCAAAGGACAGCTGTTGCAGG - Intronic
1064963542 10:20992662-20992684 CAGGGAAGGAAGGCAGCTCAAGG - Intronic
1065022310 10:21510344-21510366 CTGGGAAGGAAGGCAGGGGCCGG - Intergenic
1065102271 10:22341911-22341933 CTGGAAAGGAAGACAGGTACAGG + Intergenic
1065141543 10:22723334-22723356 CGGGAAAGCAAGGCAGTCCCTGG - Intergenic
1065706592 10:28476481-28476503 CGGGAAAGGAAGAAAGTTCCAGG + Intergenic
1065794232 10:29291671-29291693 CAGGGAAGGAAGGCAACTGAAGG - Intronic
1065944417 10:30593881-30593903 AAAAAAAGGAAGGCAGTTGTTGG - Intergenic
1066045105 10:31587952-31587974 CTGGAAAGAAAGGCAGTGTCTGG + Intergenic
1066283791 10:33944141-33944163 AATGAAAGGAAGGCTGTTACAGG + Intergenic
1066311451 10:34200953-34200975 GAGGAAAGGCAGGCAGTGGGGGG - Intronic
1066373624 10:34837965-34837987 CAGCCAGGGAAGGCAGTTCCAGG - Intergenic
1066446280 10:35486696-35486718 CTGGGAAGGAAGGCAGAGGCTGG - Intronic
1067439212 10:46299116-46299138 CAGGAAGGCCAGGCAGGTGCAGG + Intronic
1067581458 10:47449204-47449226 CAGGAAGGCCAGGCAGGTGCAGG + Intergenic
1067992811 10:51234645-51234667 CAAGAAAGTAAAGCAGTAGCAGG + Intronic
1068683606 10:59846419-59846441 GAGGACAGGAAGGAAGTTGTGGG - Intronic
1068850850 10:61738259-61738281 CAGGAATGGAGGCCAGTTACAGG + Intronic
1068913719 10:62406174-62406196 TCTGAAAGGAAGGCAGTGGCTGG - Intronic
1069400156 10:68035815-68035837 CAGGGAAGGAAGGCTCCTGCTGG - Intronic
1069632889 10:69908146-69908168 CAGGAAGGAAAGGCAGCAGCAGG + Intronic
1070409644 10:76128169-76128191 CAGGAAAAGCAGGCATTTCCAGG + Intronic
1070661168 10:78306386-78306408 CAGGTAGAGAAGGCAGTGGCGGG + Intergenic
1070711333 10:78685337-78685359 CAGAATGGGAAGGCAGCTGCAGG - Intergenic
1070745292 10:78930068-78930090 CAGGAAAGGATGGCAGTGGCTGG + Intergenic
1072202727 10:93175744-93175766 CAGGACAGGAGGGGAGTTGGTGG + Intergenic
1072426444 10:95334582-95334604 CAGGATAGGAGGGGAGTAGCTGG - Intronic
1072607630 10:96997881-96997903 CAGGAAAAGCAGGGAGTTCCAGG + Intergenic
1072800139 10:98387072-98387094 CAGGAAGGGAGGACAGTGGCAGG - Intronic
1073608168 10:104916407-104916429 AAGGAAAGAAAGGCAGCTCCTGG + Intronic
1074502130 10:114035454-114035476 AAGGAAAGGTAGGCAGTGGGTGG + Intergenic
1074861718 10:117515107-117515129 CAGGAAATGTAGACATTTGCCGG + Intergenic
1075538884 10:123295674-123295696 CAGGAAAGGAGGGCTGCTACTGG - Intergenic
1075582619 10:123633793-123633815 CAGGAGAGGAAGGCAGAGGAGGG + Intergenic
1076137965 10:128057881-128057903 AAGGAAAGGAAGGCCATGGCAGG + Intronic
1076234521 10:128853220-128853242 CAGGAAAGGACGCCAGGTGTGGG + Intergenic
1076415523 10:130284841-130284863 AAGCAGAGGAAGGTAGTTGCAGG - Intergenic
1076637304 10:131890997-131891019 CAGGAAGGGGACGCAGCTGCAGG - Intergenic
1076649484 10:131977901-131977923 TAGGAAAGGAAGGCACTTCCTGG + Intronic
1076993480 11:287740-287762 CAGGGAACCAAGGCAGGTGCAGG + Intergenic
1076993508 11:287862-287884 CAGGGAACCCAGGCAGTTGCAGG + Intergenic
1077585313 11:3447130-3447152 CAGGAATGGGAGGCAGCAGCTGG + Intergenic
1077898355 11:6471012-6471034 GAGGACAGGAAGCCAGATGCAGG + Intronic
1079036388 11:17024077-17024099 AAGGCAAGGAAGGCATTTGTGGG - Intergenic
1079339046 11:19597006-19597028 CAGCAAAGGGAGGCAGTTGGTGG - Intronic
1079781487 11:24611560-24611582 GTGGAAAGGGAGGCAGTTACTGG + Intronic
1080087620 11:28304113-28304135 CAGTAAAGGAATGCAGTAGTTGG + Intronic
1081596606 11:44463757-44463779 CAGGAGAGGCATGCAGTTGAGGG + Intergenic
1083932185 11:65852152-65852174 CAGGGGAGGGAGGCAGTGGCTGG - Intronic
1083956087 11:65983605-65983627 CCAGAAAGGATGGCAGCTGCTGG + Intergenic
1084204566 11:67584188-67584210 CAGGGAAGGGAGGCAGGGGCTGG + Intronic
1084242216 11:67829693-67829715 CAGGAATGGGAGGCAGCAGCTGG + Intergenic
1085071951 11:73554971-73554993 CATGGAAGGAAGGCAGCAGCAGG + Intronic
1085351829 11:75802646-75802668 CAGGAAAGGAAGGCAGTGAAGGG + Intergenic
1086853897 11:91843652-91843674 CATGAAAGCAAGGCAGTCCCAGG - Intergenic
1089121110 11:116136009-116136031 CAAGGAAGAAAGGCAGTGGCAGG - Intergenic
1089362968 11:117903399-117903421 CAGGCCAGGCAGGCAGTTGCTGG - Intronic
1089797959 11:120998554-120998576 CAGGAGAAGAATGCTGTTGCAGG + Intergenic
1090902562 11:131045880-131045902 CAGGGAAGGAAGGAGGTGGCGGG + Intergenic
1091489275 12:919066-919088 AAGGAAAGCAAGGCAGTGACTGG + Intronic
1091566156 12:1649647-1649669 GAGGATAGGAAGGCAGTCACAGG + Intergenic
1092069849 12:5623644-5623666 CAGGAGAGGACGCCAGCTGCAGG + Intronic
1093854182 12:24078970-24078992 CAGAGAAGGAGGGCAGTTGATGG - Intergenic
1095875599 12:47077615-47077637 GATGAACGGAAGGCAGGTGCAGG - Exonic
1096351234 12:50902828-50902850 GAGGAATGGAAGTCAGTGGCGGG + Intergenic
1096713095 12:53472217-53472239 TAGGACAGCAAGGCAGTTTCTGG + Intronic
1097373746 12:58816005-58816027 AAGGAAAGGAAGAAAGTTGAAGG - Intergenic
1097964650 12:65565682-65565704 CAACAAAGGAATGCGGTTGCTGG - Intergenic
1098290512 12:68953055-68953077 CAGGCCAGGAAGGCAGGTACTGG + Intronic
1102162247 12:110778963-110778985 GAGGAAAAGAGGGAAGTTGCAGG + Intergenic
1102491623 12:113292908-113292930 CAGGGATGGAAGGCAGGTGTGGG - Intronic
1102594467 12:113981934-113981956 CAGGAAAGGAACCCAGATGCAGG + Intergenic
1103412800 12:120724867-120724889 TGGGAAAGAAAGGCAGTTGGAGG + Intergenic
1103926818 12:124427801-124427823 AAGGACAGGAAGGCAGCTGTGGG - Intronic
1104451009 12:128868160-128868182 CAGGAGAGGGAAGCAGATGCAGG - Intronic
1104845778 12:131846064-131846086 CAGGAAAGGGAGACAGTAGCAGG + Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1105268999 13:18853169-18853191 GAGGAAAGAAAGACATTTGCTGG - Intergenic
1106366911 13:29090511-29090533 CAGTGAAGGAAGGCTGTAGCTGG + Intronic
1106658110 13:31768928-31768950 CAGGAAGGGATGTCAGTTGGAGG + Intronic
1106845173 13:33730681-33730703 GAGGAAAGGGAGGCAGCTGGAGG - Intergenic
1107186455 13:37527555-37527577 CATGAAAGGAAGTCAGTTACGGG + Intergenic
1107425901 13:40292662-40292684 CAGGTAAGGAAGGAACTTGGGGG + Intergenic
1107614105 13:42146803-42146825 CAGTAAAGGAAGTCAGTAGCTGG + Intronic
1108093213 13:46873032-46873054 CAGGAAACAATGGCAGTGGCCGG - Intronic
1108328480 13:49359481-49359503 GAGGAAAGGAAGGCAGTAAATGG + Intronic
1108419958 13:50238526-50238548 AAGGAATGGAAAGTAGTTGCTGG + Intronic
1109869877 13:68320952-68320974 CAGGAAAAGAAGCCAGCTCCTGG - Intergenic
1110608516 13:77461978-77462000 GAGGGAAGGAAGGCAGCTGTGGG - Intergenic
1110749866 13:79100734-79100756 TAGGAAAGCAAGCCAATTGCTGG - Intergenic
1111579209 13:90200874-90200896 AAGGAAAGAAAGGGAGTTGGGGG - Intergenic
1112673203 13:101665907-101665929 AAGGTTAGGCAGGCAGTTGCTGG - Intronic
1114216252 14:20659835-20659857 CAGGAAAGGCAGGATTTTGCTGG + Intergenic
1114540576 14:23454538-23454560 CAGGAAAGGAAGGCAGGGCAAGG + Intergenic
1115375556 14:32671582-32671604 CAGGAAAGAAAGGCAATTTTGGG + Intronic
1115489132 14:33941928-33941950 GAGGAAAGGAAGGCAGTGGTGGG + Intronic
1115619031 14:35122660-35122682 CAGGAAAGGAAGAGAGGTACAGG - Intronic
1117363418 14:55000414-55000436 CAAGAAAGTAAGGCAGTTTGTGG + Intronic
1117455358 14:55891558-55891580 TGGGAAAGGAATTCAGTTGCTGG + Intergenic
1117516435 14:56506749-56506771 CAGGAAATGTAGGCAGAGGCGGG + Intronic
1118686440 14:68296021-68296043 CAGGAAGGGGAGACTGTTGCAGG + Intronic
1119620609 14:76129208-76129230 GAGCAAAGAAAGTCAGTTGCAGG + Intergenic
1120022931 14:79550659-79550681 CAGCCAAGGAAGGAAGATGCTGG + Intronic
1120815325 14:88850885-88850907 CAGGAAAGTATGGGAATTGCAGG + Intronic
1120832969 14:89014406-89014428 AAGGAAAGGAAGTAAATTGCTGG - Intergenic
1121087070 14:91154883-91154905 CTGGAAAGGAAAGCAGCGGCTGG - Intronic
1121334885 14:93071152-93071174 CAGGCAGGAAAGGAAGTTGCAGG - Intronic
1121682569 14:95805968-95805990 CAGGAGAGGAAGGGAGGGGCTGG - Intergenic
1121690575 14:95875338-95875360 CAGGGAAGTAAGGCAAGTGCCGG - Intergenic
1122187257 14:100009433-100009455 CAAGAAAGGAAGGCAATTTCTGG - Intronic
1122410799 14:101525324-101525346 CGGGAAAGAGAGGCAGATGCGGG + Intergenic
1122823210 14:104357358-104357380 CAGGGGAGCAAGGCAGATGCTGG + Intergenic
1122904697 14:104796225-104796247 CAGGACAGGAGGTCAGTTGGAGG + Intergenic
1122971104 14:105152576-105152598 CAGGAAAGGAAGGCCCTGCCGGG + Intronic
1123034831 14:105467656-105467678 CAGGAAAGGAGGGCTGGGGCTGG - Intronic
1202830303 14_GL000009v2_random:20808-20830 GAGGAAAGAAAGACATTTGCTGG + Intergenic
1124143208 15:27095912-27095934 CAGGAAGGGAAGGCGGGTCCTGG - Intronic
1124227015 15:27903322-27903344 CAGGAGAGGAGGGCAGCTGTGGG - Intronic
1125409951 15:39395692-39395714 AAGGAAAGGAAAGCTGTTCCAGG + Intergenic
1126560728 15:50040853-50040875 CAGGAAAGAAAGGAAGTAGAGGG + Intronic
1128024648 15:64425177-64425199 AAGCAAAGTAAGGCAGTTACAGG - Intronic
1128129143 15:65214286-65214308 CAGGAAAGGAAGGTAGTGGGAGG + Intergenic
1128606177 15:69038174-69038196 GAGAAAAGGAAGGCAGTTCTAGG + Intronic
1129931152 15:79412165-79412187 CAGTAGAGGAAGGAAGTGGCTGG - Intronic
1131160212 15:90100845-90100867 CAGAAAAAGCAGTCAGTTGCAGG - Intronic
1131765310 15:95669253-95669275 CAAGACAGAAAGGCAGCTGCTGG - Intergenic
1132712472 16:1275592-1275614 CAGGAAAGGAAGAAAGCTTCAGG + Intergenic
1132902261 16:2263578-2263600 CAGGCTGGGAAGGCAGCTGCTGG + Intronic
1133119457 16:3597258-3597280 CAGGAAGGAAAGGCAGAGGCGGG - Intronic
1133201865 16:4208733-4208755 CAGTAAGGGCAGGCATTTGCTGG + Intronic
1134344759 16:13379466-13379488 CAGGAAAGGCAGGCTGGAGCAGG - Intergenic
1134860282 16:17554626-17554648 CATGAAGGAAAGGGAGTTGCGGG - Intergenic
1135082227 16:19446044-19446066 CAGGAAAGGAAGGGAGTGGAGGG + Intronic
1135196988 16:20402907-20402929 CAGGCTAGAAAGGCAGGTGCCGG - Intronic
1135424444 16:22325386-22325408 CAGGAAAGGAAGGAGGGTGAAGG - Intronic
1135620798 16:23953652-23953674 CAGGAAAGGAAGGCTGCAACAGG + Intronic
1136038762 16:27561384-27561406 CAGGAAAGGAAGCTAGGAGCGGG - Intronic
1137623541 16:49892927-49892949 CTGGAAAGGGAGACAGTTTCAGG + Intergenic
1138240741 16:55425190-55425212 CAGCACAGGAAGGAAGTTCCAGG - Intronic
1138742469 16:59326669-59326691 AAAGAAAGGAAGTAAGTTGCCGG - Intergenic
1140187018 16:72783472-72783494 CAGGCATGGCAGGAAGTTGCAGG - Exonic
1141230867 16:82166305-82166327 CAGGAAAGAACTGCAGTTTCTGG + Intronic
1141380131 16:83568859-83568881 CAGGAAAGAGAGGCAGGAGCTGG - Intronic
1141582658 16:85011106-85011128 CTGGAAGGGAAGTCAGGTGCGGG + Intronic
1142004327 16:87682142-87682164 CAGGAAATGAAGCAAGCTGCTGG - Intronic
1142775833 17:2138198-2138220 CGGTAAAGGTAGGCAGTGGCTGG + Intronic
1143183729 17:4998680-4998702 CAGGACAGGAAGGGAGTAGCTGG - Intronic
1143373928 17:6456427-6456449 CTGGCAAGGAGGGCAGTCGCAGG - Intronic
1143376087 17:6468493-6468515 CAGGACAGGAATGCAGGTCCCGG - Intronic
1143706487 17:8701211-8701233 AAGGGAAGGAAGGCAGTAACTGG - Intergenic
1144154301 17:12483961-12483983 CAGGAAGGGAGGGTAGTTGTAGG + Intergenic
1144178001 17:12727062-12727084 CAGTGGAGGAAGGTAGTTGCGGG + Intronic
1146156969 17:30532702-30532724 CAGGAGAAGGAGGCAGTTTCGGG + Intergenic
1146313297 17:31787771-31787793 CAGGAAGTGAAGGCAGAGGCTGG + Intergenic
1146915304 17:36674476-36674498 CAGGAAATGAAGCCTTTTGCTGG + Intergenic
1147762118 17:42805481-42805503 GAGGAAAGGAAGGGAGATCCAGG + Intronic
1148029714 17:44611072-44611094 CAGGAAAGGAGGGAAGCAGCCGG + Intergenic
1148371991 17:47106728-47106750 GAGGAATGGAAGTCAGTGGCGGG + Intergenic
1148955682 17:51351806-51351828 CGGGAAAGGAAGGAAGGGGCAGG - Intergenic
1149296005 17:55263681-55263703 CAGGGCAGAAAGGCACTTGCCGG + Intergenic
1149574894 17:57704731-57704753 CAGGAAGGCCAGTCAGTTGCAGG - Intergenic
1149591380 17:57832145-57832167 GCTGAAAGGAAGGCAGTTGGGGG + Intergenic
1150953436 17:69827651-69827673 GAGGTTAGGGAGGCAGTTGCTGG + Intergenic
1151224975 17:72641067-72641089 GAGGACAGGAACGCAGTGGCGGG - Intergenic
1151691581 17:75689456-75689478 TAGGAAAGGAAGGCTGCTCCTGG - Intronic
1155388479 18:25307545-25307567 CAGGAAAGGAAGGCAGGGTCTGG - Intronic
1155700988 18:28743367-28743389 CAGGAAAGCAAGGAAACTGCAGG + Intergenic
1155846186 18:30709760-30709782 CATGTAATGAAAGCAGTTGCTGG - Intergenic
1156492407 18:37504001-37504023 CAGGAGAGGATGGGAGTTCCTGG + Intronic
1157117396 18:44874938-44874960 CAGAAAAGGAAGGCTGAAGCAGG + Intronic
1157485139 18:48081373-48081395 CAGGAAGGGGAGGCAGTTCCTGG + Intronic
1159110679 18:64052942-64052964 CAGGATAGTAAGGCAGAGGCTGG + Intergenic
1159425986 18:68287011-68287033 TATGAAAGGTAGGCAGTTTCTGG - Intergenic
1159806501 18:72963773-72963795 CAGGGAAGGAAGGCAATCCCAGG - Intergenic
1160404209 18:78634105-78634127 GAGGAAAGCAAGGCAGAAGCGGG - Intergenic
1160462960 18:79053190-79053212 CAGCAAAGACAGGCAGATGCAGG + Intergenic
1160471386 18:79137606-79137628 CCAGAAAGGAAGGCAGTGACGGG - Intronic
1162472894 19:10883027-10883049 CAGGAAAGGCAGAGAGTAGCAGG - Intronic
1162794817 19:13081595-13081617 CAGGAGAGGAGGGGAGCTGCCGG - Intronic
1164604466 19:29587483-29587505 CAGGGAAGGAAGAGAGTTGATGG + Intergenic
1165264089 19:34646126-34646148 CAGGAAGGGAAGGTAAGTGCAGG - Intronic
1166143530 19:40818984-40819006 GAGGAAAGGAAGACAGCAGCTGG + Intronic
1166184024 19:41127794-41127816 GAGGAAAGGAAGACAGCAGCTGG - Intronic
1166758796 19:45212026-45212048 CAGGAGAGGAAGGAGGTTGGGGG - Intronic
1167051599 19:47082423-47082445 TAGGAAAGGAAGACAGGTGTAGG + Intronic
1167080834 19:47275181-47275203 CAGGAGAGGGAGGCAGCGGCGGG - Exonic
1167650411 19:50725537-50725559 CAGGAAGGGAAGGGAGATTCCGG - Exonic
1168043095 19:53774630-53774652 CAGGAAAGTAAAACAGTTCCAGG + Intergenic
1168407550 19:56118843-56118865 CAGGGCAGCCAGGCAGTTGCTGG + Intronic
1168714733 19:58520076-58520098 CAGAATGGGAAGGCAGTTCCCGG + Exonic
1202642387 1_KI270706v1_random:106964-106986 GAGGAAAGAAAGACATTTGCTGG - Intergenic
925385590 2:3459667-3459689 TAGGGAAGGAAGCCAGCTGCAGG + Intronic
925950699 2:8907587-8907609 CAGAAAAGGAGAGCAGATGCTGG - Intronic
927879194 2:26678755-26678777 CAGAAGAGGAGGGTAGTTGCAGG - Intergenic
928057115 2:28067793-28067815 CAGGAAGGAAGGGCAGATGCTGG + Intronic
928074439 2:28250190-28250212 CAGCCAAGGAAGGCAATTCCAGG + Intronic
928105913 2:28470514-28470536 CAGGGTCGGAAGGCAGGTGCTGG + Intronic
929560128 2:42951302-42951324 AAGGAAGGAAAGGCAGTGGCTGG + Intergenic
929769757 2:44881656-44881678 CAGGAAAGGCAGGGAGTGGGGGG + Intergenic
930416758 2:51098797-51098819 CAGGAAAAGAAGGAAATTGAGGG - Intergenic
931202570 2:60113189-60113211 AGGGAAAGTAGGGCAGTTGCAGG - Intergenic
932014106 2:68006982-68007004 AAGGAAAGGAAGGCATTAGAGGG + Intergenic
932509736 2:72273706-72273728 CTGGAAAGGCAGGCAGGGGCTGG + Intronic
932776643 2:74531805-74531827 CAGGGAAGGAAGGATGTAGCTGG + Intronic
933276950 2:80294092-80294114 AAGGAAAGGAAGGTGGTAGCGGG + Intronic
933937195 2:87216421-87216443 CAGGTAAGGAAGAGAGTTGTTGG - Intergenic
934179460 2:89607361-89607383 AAGGAAATGAAGGCATTGGCAGG - Intergenic
934289751 2:91681629-91681651 AAGGAAATGAAGGCATTGGCAGG - Intergenic
934498223 2:94830397-94830419 GAGGAAAGAAAGACATTTGCTGG - Intergenic
935064130 2:99633465-99633487 CAGGAAAGGAAAACAGCTCCAGG + Intronic
935105225 2:100036528-100036550 CAAGAAAGAAAGGCAGGGGCTGG + Intronic
935116139 2:100138131-100138153 CAGGAAGGGAAGATAGTTGGTGG - Intronic
935134908 2:100291513-100291535 AAGGAGATGAAGGCAGTGGCCGG - Intronic
935191875 2:100784304-100784326 CAGGAAAGGATGGAAGGTTCTGG + Intergenic
935274919 2:101467825-101467847 CGGGAAAGGAAGGTAGTGGCTGG - Intronic
935401243 2:102662667-102662689 AAGGAAAGGAAAGCAGGAGCAGG + Intronic
936355948 2:111749403-111749425 CAGGTAAGGAAGAGAGTTGTTGG + Intergenic
937145257 2:119638956-119638978 CAGGAAGAGGAGGCAGTTGAGGG - Intronic
937277036 2:120691541-120691563 CAGGAGAGACAGGCAGCTGCTGG + Intergenic
940216370 2:151307726-151307748 GGGGAAAGGTAGGCAGTGGCAGG - Intergenic
940307708 2:152244286-152244308 AAGGACAGGAAGGCAGGAGCAGG + Intergenic
941190975 2:162381378-162381400 CAGGAAAGGAAGGAACTTTGAGG - Intronic
941669295 2:168274044-168274066 AAGGGAAGGAAGGCATTTTCTGG - Intergenic
941765545 2:169292569-169292591 CAGGAAATGAACTCAGGTGCCGG + Intronic
941970643 2:171347266-171347288 CAGGAAAGGCAGGCAGGAGAGGG - Intronic
942579010 2:177396260-177396282 AATGAAAGGAGGGCAGTGGCAGG + Intronic
943276670 2:185876352-185876374 CAGTAGAGGAAGGCACTTGTGGG - Intergenic
944022499 2:195123863-195123885 CAGAAAAGGAAGGGAGATGCAGG + Intergenic
944300399 2:198117872-198117894 GAGAACAGGAAGGAAGTTGCTGG - Intronic
946223605 2:218249939-218249961 CAGGAGAGGAAGGTGGTCGCTGG - Intronic
946601539 2:221365269-221365291 CAGGAAAGTGAAGCAGGTGCAGG + Intergenic
946864179 2:224027890-224027912 CAGGACAAGAAGGAAGTTGAAGG - Intronic
947295188 2:228623072-228623094 CAGGTTAGACAGGCAGTTGCTGG - Intergenic
947368237 2:229418294-229418316 CCTGCAAGGAAGGCAGTTGGGGG + Intronic
947588266 2:231370282-231370304 GAGGAAAGGAAGCCACCTGCTGG - Intronic
947714461 2:232332749-232332771 CAGTCAAGGGAGGCAGTTTCCGG - Intronic
947733667 2:232444128-232444150 CAGCCAAGGGAGGCAGTTTCCGG - Intergenic
947802271 2:232937300-232937322 GAGGAAAGGAAGGCTGTTAGAGG - Intronic
947834602 2:233166394-233166416 GAGGAAAAGAAGCCAGTTCCTGG + Intronic
947849537 2:233274459-233274481 CAGGAGAGTAAGGCATGTGCTGG + Intronic
948066769 2:235087066-235087088 GAGGAAAGGCAGGCAGGTGGAGG - Intergenic
948177792 2:235957850-235957872 CAGGAGAGGAAATCAGTTGAGGG - Intronic
948490051 2:238306882-238306904 CAGCAAAGGAAGACAGATGCTGG - Intergenic
948831586 2:240600985-240601007 TATGAAGGGAAGACAGTTGCAGG + Intronic
1168874200 20:1159460-1159482 AAGGCTAGAAAGGCAGTTGCAGG - Intronic
1170431338 20:16279375-16279397 CAGGAAAGCTGGGCAGTTTCAGG + Intronic
1171422322 20:25025438-25025460 CAGAAAATGAACGCAGATGCTGG - Intronic
1172027327 20:31957402-31957424 TAGGACAGGAAGGCAGGTGGAGG + Intergenic
1172053407 20:32137210-32137232 GAGGAAAGGAGGGCAATGGCAGG - Intronic
1172112472 20:32555144-32555166 CAGGAAAGAAAGGGTGTTTCAGG - Intronic
1172119250 20:32588162-32588184 GAGGAGAGGAGGGCAGCTGCAGG + Intronic
1172460737 20:35116453-35116475 CAGGACAGAAAGGCAGCAGCTGG - Intronic
1173901109 20:46589389-46589411 TAGCAAAGGAAGACAGTTGCAGG - Intronic
1174623443 20:51894824-51894846 CAGGGCAGGAAGGGAGTGGCAGG - Intergenic
1175702394 20:61149332-61149354 CAGGATGGGCAGGCAGCTGCCGG + Intergenic
1176018215 20:62948993-62949015 CATGAGTGGAAGGCAGTTGTAGG + Intergenic
1176609490 21:8865646-8865668 GAGGAAAGAAAGACATTTGCTGG + Intergenic
1176742196 21:10615169-10615191 CAGGTATGTAAGGCAGTTGCCGG - Intergenic
1176854278 21:13952467-13952489 GAGGAAAGAAAGACATTTGCTGG - Intergenic
1176885363 21:14248956-14248978 CAAGAAAGGATGGCTGTTGTGGG + Intergenic
1177893686 21:26836787-26836809 TAGGAAAGAAAGGAAGTTGGAGG + Exonic
1178548098 21:33510719-33510741 GAGGAAAGAAAGGCAGATACAGG + Intronic
1178630751 21:34259273-34259295 CATGAAAGCAAGGCAGTGGCTGG + Intergenic
1179802143 21:43816180-43816202 CAGGAGAGGGAGGCAGGGGCCGG - Intergenic
1180359586 22:11875492-11875514 GAGGAAAGAAAGACATTTGCTGG + Intergenic
1180926607 22:19559514-19559536 CAAGACAGGAGGGCAGCTGCGGG - Intergenic
1182044575 22:27264222-27264244 GTGGAAAGGAAGGCAGGTGGAGG + Intergenic
1182819493 22:33202898-33202920 CTGGAAAGCAAGGCATTAGCAGG + Intronic
1184341770 22:43890085-43890107 CAGGGAAGGAGGCCAGGTGCAGG + Intronic
1185004020 22:48264804-48264826 CAGGAAAGGAGGCCGGTTCCAGG + Intergenic
949132099 3:515943-515965 CTGGATAGGAAGGCAGTAGAAGG - Intergenic
949568735 3:5270755-5270777 CAGGAAATGAGGGCAGCCGCTGG - Intergenic
950479994 3:13238202-13238224 CAGGAGAGGAAAGCAGGTGGAGG - Intergenic
950533313 3:13565737-13565759 CAGGAAAGGTTGGCAGGTGGAGG - Intronic
950849105 3:16045161-16045183 CAGGTGAAGAAGGCAGTGGCTGG + Intergenic
951702433 3:25509840-25509862 GAGCAAAGAAAGGCAGCTGCTGG - Intronic
952827914 3:37539342-37539364 CAGGAAAGGAAGGCAGTTGCAGG + Intronic
953199529 3:40766509-40766531 CAGGAAGAGAAAGCAGTAGCAGG + Intergenic
953460230 3:43076220-43076242 CAGGATAGGAGGGCAGTTTCAGG - Intergenic
953504957 3:43476466-43476488 CAGGAAGGGAAGACATTGGCTGG + Intronic
953663628 3:44909380-44909402 AAGGAAAAGAAGGGAGTTGAGGG - Intronic
953724120 3:45382575-45382597 CAGGAAAGGGAGGAAGTAACTGG - Intergenic
954831184 3:53422671-53422693 ATGGAAAGGAAGGCATTGGCTGG - Intergenic
955015101 3:55062573-55062595 GAGGAAAGGAAGACAGTAGCTGG + Intronic
955853150 3:63242700-63242722 CATGAAAGGAAGTGAATTGCTGG + Intronic
956387367 3:68734400-68734422 CAGGAAAGAAAGGCTGAGGCAGG + Intronic
956556738 3:70532105-70532127 CAGGAATGGCAGGCATTTACTGG - Intergenic
957538137 3:81532323-81532345 CAGGAGAGGCAGCCAGTTGCGGG - Intronic
959122465 3:102248779-102248801 CAGGAAAAGAAGGAAATTGGTGG - Intronic
959255370 3:104004468-104004490 CTGGAAAAGAGAGCAGTTGCAGG + Intergenic
959544558 3:107578880-107578902 GAGTAGAAGAAGGCAGTTGCAGG + Intronic
959781446 3:110239023-110239045 AGGGAAAGGAAGGTAGTGGCTGG - Intergenic
961500387 3:127328441-127328463 CAGGAGAGGAAAGCATTTGTAGG + Intergenic
962599383 3:136979456-136979478 CAGCAAAGGGAGGCAGGTGTTGG + Intronic
962967280 3:140366591-140366613 CAGGAAAGGCAGCAACTTGCTGG - Intronic
963119441 3:141763779-141763801 CAGGAAGGGGTGGGAGTTGCAGG - Intergenic
964212668 3:154245722-154245744 AAGGAAAGGAAGGATGTAGCAGG - Intronic
965068114 3:163878679-163878701 CAGGAAAGGAATGCATTCCCAGG - Intergenic
965359747 3:167724119-167724141 GAGTAAAGTAAGGCAGTTTCAGG - Intronic
965644394 3:170864827-170864849 CAGGGAAGGTAGGCAGTATCTGG - Intergenic
966842895 3:184103853-184103875 GAGGAAAGGAAGGAAGGAGCTGG + Intronic
967133766 3:186496193-186496215 CAGGAAAAGCGGGCAGCTGCAGG - Intergenic
968027116 3:195451697-195451719 CAGGAAAGGTTGGCAGGTGCTGG - Intergenic
968082587 3:195856925-195856947 CAAGAAGGGAAGGGAGTAGCGGG + Intergenic
968502423 4:957118-957140 CAGCAAGGGCAGGAAGTTGCTGG - Intronic
968914807 4:3492725-3492747 CAGGAAGCCAAGGCAGTTGTGGG - Intronic
969348087 4:6581668-6581690 CAGCAAAGGAAGACAGGAGCAGG + Intronic
969829822 4:9786256-9786278 AAGGAAATGAAGGCATTGGCAGG + Intronic
971015686 4:22486588-22486610 AAAGAAAGGGAGGCAGATGCAGG + Intronic
972047665 4:34688114-34688136 CAGGAAAGAAAGACATTTTCAGG + Intergenic
973982358 4:56316682-56316704 GAGGAAAGGTAGGTAGCTGCAGG + Exonic
976132485 4:81899210-81899232 AAGGAAAGGCAGGCATGTGCAGG + Intronic
976291989 4:83428645-83428667 CAGGAAAAAAAGCAAGTTGCAGG + Intronic
977553682 4:98467867-98467889 CCCGAAAGGAAAGCAGTAGCAGG - Intergenic
977593784 4:98855389-98855411 CAGAGAATGAAGGCAGTGGCTGG + Intergenic
979075080 4:116260889-116260911 TAGGAAAGGAATGCATTTCCTGG + Intergenic
980948750 4:139350151-139350173 CATGAAAGGAAGCCAGGTGTAGG + Intronic
981660163 4:147157513-147157535 CAGGAAATGAAGAAAGTGGCAGG - Intergenic
981840307 4:149103936-149103958 GACGAAAGGAAGGCTGTTGAGGG - Intergenic
982151144 4:152458796-152458818 CAGGAAAGAAAGGGAGGTGGGGG + Intronic
982584872 4:157222927-157222949 CAGGAAATGATGGCAGCTGCTGG - Intronic
982761869 4:159294389-159294411 CTGGAGAGGGAGGCAGCTGCTGG - Intronic
983981712 4:174005685-174005707 CAAGATAGGAACTCAGTTGCAGG - Intergenic
1202769752 4_GL000008v2_random:192862-192884 GAGGAAAGAAAGACATTTGCTGG - Intergenic
987369557 5:17180646-17180668 CAGGACAGGAAGGAAAGTGCTGG - Intronic
988499975 5:31776361-31776383 CAGGGCAGGGAGGCAGTTGGAGG - Intronic
989244352 5:39237242-39237264 AAGGCAAGGAAGGCAGTTAGGGG + Intronic
989538863 5:42595752-42595774 AAGGAAAGGAAGTGGGTTGCTGG + Intronic
991010116 5:61873414-61873436 CAGGAAAGGCAAGGAGTGGCAGG - Intergenic
992655802 5:78908462-78908484 GAGCACAGGAAGGCAGTTTCAGG + Intronic
992828690 5:80573191-80573213 CAGGAGAGGAGGGCTGATGCTGG + Intergenic
994005651 5:94834599-94834621 CAGGAACAGTAGGCAGTGGCAGG + Intronic
994464659 5:100111592-100111614 CAGGCAAGGAAAGCATGTGCAGG + Intergenic
997512373 5:134462410-134462432 CAGGCAAGGAGGGCAGATGGTGG + Intergenic
997566970 5:134895449-134895471 CAGGTTAGGGAGGGAGTTGCGGG - Intronic
997812709 5:136987828-136987850 AAGGACAGGAAGCCAGTGGCAGG - Intronic
998099436 5:139419736-139419758 AAAGAAAGGAAGGCAGCTGGTGG + Intronic
998807868 5:145936605-145936627 GAGGAAAGGAAGCCGGTTGGAGG + Intronic
999633724 5:153598617-153598639 CAGTTAAGGAAGGCAGTTAAGGG - Intronic
1000168816 5:158681567-158681589 AAGAAAAGAAAGGAAGTTGCCGG + Intergenic
1000289305 5:159855287-159855309 GAGGAAAGGAACCCAGTTGATGG + Intergenic
1000328391 5:160188814-160188836 CAGAGAAGGAAGGGAATTGCAGG - Intronic
1001242667 5:170082004-170082026 AAGGAAAGGAAGGCATTGGGAGG + Intronic
1001325635 5:170721802-170721824 CAGAAAAGGAGGGCAGGTGATGG - Exonic
1001791200 5:174459279-174459301 CAGGGAAGGAAGCCAATGGCAGG - Intergenic
1001806511 5:174591355-174591377 AAGGAGAGGAAGGCAGGAGCAGG - Intergenic
1001886228 5:175293139-175293161 GAGGACAGTAAGGCAGCTGCAGG - Intergenic
1001923530 5:175619103-175619125 CAAGAAAAGAGGGCAGTTTCAGG + Intergenic
1002254669 5:177950420-177950442 CAGTGAAGGACGGCTGTTGCTGG - Intergenic
1003855521 6:10269952-10269974 CAGGGAAGGAAGGAAGGTGGAGG + Intergenic
1004097703 6:12575061-12575083 AAGGCAATGAAGGTAGTTGCGGG - Intergenic
1004191735 6:13470225-13470247 CTGGAAAGAAGGGCAATTGCCGG + Intronic
1005503559 6:26450789-26450811 TAGGAAGGGGAGGCAGTTACTGG + Intronic
1006453741 6:34120371-34120393 GAGGCAAGGAAGGCAGGTGAGGG + Intronic
1006593348 6:35174113-35174135 GAGGCAAGGAAGGCAGGGGCAGG + Intergenic
1006634273 6:35451243-35451265 CTGGAACGGAGGGCACTTGCTGG - Intergenic
1007738130 6:43994509-43994531 CAGGAAGGGAGGGAAGCTGCAGG + Intergenic
1008053499 6:46923374-46923396 CAAGAAGGGAAGGCAGCTGGAGG - Intronic
1010445251 6:75942227-75942249 CAAGAAAAAAAGGCAGCTGCTGG - Intronic
1011441067 6:87387894-87387916 CAAGAAAGGAAGGCAGCTGGAGG + Intronic
1013460200 6:110367288-110367310 CAGGAAAGCACAGCAGGTGCTGG - Intergenic
1014300472 6:119675567-119675589 CAGGAAAGGGAGGCACGGGCAGG - Intergenic
1014948789 6:127529823-127529845 AAGGAAAGGAAGTGAGTTGAGGG + Intronic
1015343637 6:132130696-132130718 CAGGAAAAGAAGGCAGATGCTGG - Intergenic
1015606797 6:134965410-134965432 TAGGAAAGGAAGAAAGTTGCAGG - Intronic
1015790055 6:136957607-136957629 CAGGAAAGGCAGGGAGGTGGCGG - Intergenic
1016069557 6:139723893-139723915 CAGGATAGGAAGCAAGTTGAAGG - Intergenic
1017049230 6:150374907-150374929 CAGGAAAGAAGGGCAGTGGAAGG + Intronic
1018944489 6:168337008-168337030 CAGGAAAGGATGGCGGCTACTGG - Intergenic
1019316225 7:388212-388234 CAGGAAAGGAAGTCGGTGGCTGG - Intergenic
1019374145 7:680260-680282 CAGGAAGGGAAGGGACTCGCTGG - Intronic
1019631245 7:2050978-2051000 AAGGAAAGGAAGTTAGCTGCAGG - Intronic
1020108186 7:5432434-5432456 CAGGTGAGGAAGGCAGGGGCAGG - Intronic
1020501844 7:8932955-8932977 AAATAAAGGAAGGCATTTGCTGG + Intergenic
1021199303 7:17710502-17710524 CAGGGATGAAAGGCTGTTGCTGG - Intergenic
1021562870 7:21986396-21986418 CAGGACAAGAAGGCATTTGTGGG - Intergenic
1021856227 7:24859239-24859261 TAGGAAAGGAAGGCAATAGAGGG + Intronic
1022500481 7:30879521-30879543 TGGGAGAGGAAGGCAGGTGCAGG - Intronic
1022628678 7:32064849-32064871 CTGGAAAGGAAGGCAGAGGCTGG - Intronic
1023655990 7:42421682-42421704 CAGGAGAGGAGGGCAGATACTGG - Intergenic
1023715484 7:43039569-43039591 CATCAAAAGAAGGAAGTTGCTGG + Intergenic
1023885290 7:44349669-44349691 CAAGAAAGGAAGGCAGAGCCAGG - Intergenic
1024007319 7:45235352-45235374 CAGGGAAGGAAGGCAGACCCAGG + Intergenic
1026057431 7:66996752-66996774 CGGGAAAGGAAGCCAGTGCCCGG - Intronic
1026179372 7:68025185-68025207 TAGAAAAGGAAGGCACTGGCTGG - Intergenic
1026720677 7:72828280-72828302 CGGGAAAGGAAGCCAGTGCCCGG + Intergenic
1026791454 7:73335167-73335189 AAGGAAGGGAGGGCAGCTGCTGG + Intronic
1026977007 7:74505179-74505201 CAGAAAATGAAGGCAGAGGCCGG - Intronic
1028451364 7:90988324-90988346 CAAGAAAGGAAGGAAGATGATGG + Intronic
1028891619 7:95994403-95994425 CAGGCAAGGAAGGAAGTGGTTGG + Intronic
1029654998 7:101918468-101918490 CAGGAAGGGGAGGCAGATGATGG + Intronic
1029662619 7:101972980-101973002 AAAGGAAGGAAGGCAGTGGCTGG - Intronic
1031275831 7:119722335-119722357 TGGGAAAGGGAGGCAGGTGCTGG - Intergenic
1031299575 7:120047497-120047519 GAGGGATGGAAGGCAGTGGCGGG - Intergenic
1031979754 7:128116882-128116904 CAGGACAGGAGGGCAGCAGCAGG + Intergenic
1032414380 7:131725139-131725161 AAGGAATGGAAGGAAGTTGCTGG + Intergenic
1032892033 7:136207313-136207335 CAGGCAAAGAAGGCATGTGCAGG - Intergenic
1034292597 7:149944916-149944938 CAGGAAAGAAAGGCCGTGCCAGG + Intergenic
1034813473 7:154151976-154151998 CAGGAAAGAAAGGCCGTGCCAGG - Intronic
1034869148 7:154668061-154668083 CAGGAAGGGAAGGAAGGTGAAGG - Intronic
1035202006 7:157273661-157273683 CAGGCCAGGCAGGCACTTGCTGG - Intergenic
1035393353 7:158520117-158520139 CAAGAAAGGAAAGCATTTTCTGG + Intronic
1035453328 7:158993101-158993123 CAGGAAAGGAAGGCAGGAAGGGG - Intergenic
1036376734 8:8206969-8206991 CAGGAATGGGAGGCAGCAGCTGG - Intergenic
1036396923 8:8377763-8377785 CAGCAAAGGCAGCCAGTTTCTGG + Exonic
1036707515 8:11056312-11056334 TGGGAAAGGAAGGCACTTGTGGG - Intronic
1036852802 8:12216169-12216191 CAGGAATGGGAGGCAGCAGCTGG + Intergenic
1036874173 8:12458691-12458713 CAGGAATGGGAGGCAGCAGCTGG + Intergenic
1037132005 8:15417884-15417906 AAGGAAAGGAAGGAAGGTACAGG + Intronic
1037472092 8:19220743-19220765 AGGGAAAGGAAGTCACTTGCAGG - Intergenic
1037604465 8:20425727-20425749 CTGGGAAGAAAGGAAGTTGCTGG + Intergenic
1037783226 8:21885721-21885743 CAGGAAAGGAATGGAGAGGCAGG - Intergenic
1038629513 8:29227990-29228012 CAGGAAAGAAAGGTAGCTGAAGG - Intronic
1038643628 8:29346970-29346992 CAGGACAGGAAGCCAGTGGAAGG - Intronic
1038984289 8:32791905-32791927 CCTGAAAGGAAGTCAGTTGCTGG - Intergenic
1039095750 8:33883021-33883043 ACGAAAAGGAATGCAGTTGCTGG - Intergenic
1039355323 8:36809120-36809142 AAGGAAATGAAGCCAGTTACAGG + Intronic
1039973636 8:42341313-42341335 CAGGAAAGGCAAGTAGTTCCAGG - Intronic
1042796710 8:72671608-72671630 CAGGAAAGGATGGAAGATGGAGG - Intronic
1043537954 8:81226746-81226768 CAGGCAAGGAAGGAAGATGGTGG - Intergenic
1044224068 8:89700404-89700426 CTAGAAAGGAAGCCAGTTGACGG - Intergenic
1044524274 8:93233721-93233743 AAGGAAAGGAAGACACTTTCTGG - Intergenic
1044924125 8:97195381-97195403 CGGGAAAGCAAGCCAGTTGTGGG + Intergenic
1045412596 8:101933604-101933626 CAGCATGGAAAGGCAGTTGCAGG - Intronic
1046056380 8:109083699-109083721 TATGAAAGGAAGGCATTTGTGGG - Intergenic
1048003855 8:130402368-130402390 CGGCAAAGGAAACCAGTTGCAGG + Intronic
1048190416 8:132282991-132283013 AAAGAAAGGAAGACAGTGGCTGG + Intronic
1048494174 8:134921554-134921576 CAGGAATGGAACACAGCTGCCGG + Intergenic
1049149674 8:141026575-141026597 TTGGAAGGGAAGGCATTTGCGGG - Intergenic
1049159500 8:141088342-141088364 CAGACAAGGAAAGCAGTAGCAGG - Intergenic
1049287130 8:141781935-141781957 GGGGAAAGGCAGGAAGTTGCTGG + Intergenic
1049372666 8:142275134-142275156 CAGGAAAGGGTGGGAGTGGCAGG + Intronic
1051371327 9:16361881-16361903 GAGGAAAGGAAGCCACTTGGAGG - Intergenic
1052044227 9:23775814-23775836 GAAGAAAGGTAGGCTGTTGCAGG - Intronic
1052291335 9:26845086-26845108 CAGGATAAGAAGACAGTAGCAGG - Intronic
1052385422 9:27818112-27818134 CACGAAAAGAATGGAGTTGCTGG - Intergenic
1052722075 9:32184105-32184127 CGGGAAAGGTAGGCAGTGGGAGG + Intergenic
1052850832 9:33377504-33377526 CAGGCAAGGTAGGGAGTGGCTGG - Intergenic
1053014944 9:34656575-34656597 AAGGAAAGGAAGGCAAGGGCTGG + Intronic
1053271637 9:36754063-36754085 CAGGAAGTGAAGGCACTTGAAGG + Intergenic
1053611010 9:39713017-39713039 CAGGCAAGGAAGAGAGTTACTGG + Intergenic
1053658938 9:40250132-40250154 GAGGAAAGAAAGACATTTGCTGG + Intronic
1053909305 9:42879403-42879425 GAGGAAAGAAAGACATTTGCTGG + Intergenic
1054087244 9:60758141-60758163 CAGGCAAGGAAGAGAGTTACTGG - Intergenic
1054242511 9:62629378-62629400 CAGGCAAGGAAGAGAGTTACTGG - Intergenic
1054359974 9:64102817-64102839 GAGGAAAGAAAGACATTTGCTGG + Intergenic
1054371058 9:64396422-64396444 GAGGAAAGAAAGACATTTGCTGG + Intronic
1054525660 9:66126090-66126112 GAGGAAAGAAAGACATTTGCTGG - Intronic
1054556635 9:66663896-66663918 CAGGCAAGGAAGAGAGTTACTGG - Intergenic
1054678690 9:67886151-67886173 GAGGAAAGAAAGACATTTGCTGG + Intronic
1057546303 9:96022014-96022036 GAGGAAGGGAAGGCAGCTGCAGG - Intergenic
1058950549 9:109899691-109899713 AAGGAATGGCAGGTAGTTGCTGG - Intronic
1059568800 9:115411928-115411950 CAGGAATGGAAAGTAGTTGGAGG - Intergenic
1059796628 9:117704509-117704531 CAGGAGAGGAAGGCCATGGCTGG - Exonic
1059870151 9:118563736-118563758 AAGCAAAGGAAGGGGGTTGCTGG - Intergenic
1060169932 9:121453193-121453215 CCAGAAAGGAAGGCATTTGATGG + Intergenic
1060293948 9:122330429-122330451 CAGGAAAGGAAGAGAATAGCAGG - Intergenic
1060382937 9:123193779-123193801 AAGGAAAGAGAAGCAGTTGCTGG - Intronic
1060670784 9:125467583-125467605 CAGGGAAGGAAGGCAGGTCCAGG + Intronic
1060679242 9:125546724-125546746 CAGGAAAGGAAGGGTGCTCCTGG + Intronic
1061592690 9:131608240-131608262 CAGGAGAGGACGGCTGCTGCTGG - Intronic
1062062476 9:134503861-134503883 AAGGCAGGGAAGGCAGTTGAAGG - Intergenic
1062669230 9:137696868-137696890 GAGGAAAGGAAGGAAGACGCAGG - Intronic
1203694653 Un_GL000214v1:86578-86600 GAGGAAAGAAAGACATTTGCTGG - Intergenic
1203559107 Un_KI270744v1:34957-34979 GAGGAAAGAAAGACATTTGCTGG - Intergenic
1203641620 Un_KI270751v1:17485-17507 GAGGAAAGAAAGACATTTGCTGG + Intergenic
1185463258 X:341932-341954 CTGGAAAGGAATGCGGTTGATGG + Intronic
1186193009 X:7084379-7084401 TAGGAATGGAAGGCAGTGGTGGG + Intronic
1186439386 X:9572402-9572424 CAGGAAAGGAAGGTTGTAGAGGG - Intronic
1186890280 X:13953042-13953064 CAGGAAAGCAATGAAGTTGAGGG + Intergenic
1187737662 X:22321336-22321358 CAGGAGAGAAAAGCAATTGCAGG - Intergenic
1188328326 X:28835405-28835427 AAGGAAAGAATGGCACTTGCTGG + Intronic
1190061602 X:47215150-47215172 CAGGGAAGGAAGGGACTTCCTGG + Intergenic
1190427192 X:50345005-50345027 GAGGAGAGGAAGGCAGGAGCTGG - Intronic
1190758936 X:53423777-53423799 CAGGAAAGTGAGGAAGTGGCTGG + Intronic
1190870279 X:54419164-54419186 CAGGAAATAAAGGGAGCTGCAGG - Intergenic
1191677715 X:63809253-63809275 CAGGGTAGCCAGGCAGTTGCTGG - Intergenic
1192487174 X:71537907-71537929 CAAGGAAAGAGGGCAGTTGCAGG + Exonic
1192808535 X:74530394-74530416 CAGAAAAGAAATGGAGTTGCCGG - Intronic
1196829003 X:119761702-119761724 AAGGCCAGGAAAGCAGTTGCTGG + Intergenic
1197984271 X:132250730-132250752 CTAGAAAGGAATGCAGCTGCTGG + Intergenic
1198624226 X:138551096-138551118 CAGGTAAGGAAGGCAGAAGTTGG - Intergenic
1199022786 X:142902079-142902101 AAGGATACGAAGGCAGTTTCAGG + Intergenic
1200058248 X:153472661-153472683 CAGGAGAGGAAGGGAGCTCCCGG + Intronic
1200092135 X:153640993-153641015 CAGAGCAGGAAGACAGTTGCAGG + Intergenic
1200971477 Y:9157138-9157160 CAGGAAAGAAACACAGTTGAAGG + Intergenic
1201564949 Y:15355826-15355848 TAGGAATGGAAGGCAGTGGTGGG + Intergenic
1202139543 Y:21707156-21707178 CAGGAAAGAAACACAGTTGAAGG - Intergenic
1202600519 Y:26589354-26589376 AAGGTATGTAAGGCAGTTGCTGG - Intergenic
1202600734 Y:26590712-26590734 CATGAAAGGAAAGAAGTTGTAGG - Intergenic