ID: 952832556

View in Genome Browser
Species Human (GRCh38)
Location 3:37577108-37577130
Sequence CAGGGAAGACAGAAAGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1159
Summary {0: 1, 1: 0, 2: 7, 3: 120, 4: 1031}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952832545_952832556 21 Left 952832545 3:37577064-37577086 CCTTGGGCTCTGTTCCTCTGATG 0: 1
1: 0
2: 1
3: 29
4: 400
Right 952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG 0: 1
1: 0
2: 7
3: 120
4: 1031
952832549_952832556 7 Left 952832549 3:37577078-37577100 CCTCTGATGTGGCACAGGTGGTC 0: 1
1: 0
2: 0
3: 19
4: 107
Right 952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG 0: 1
1: 0
2: 7
3: 120
4: 1031
952832544_952832556 26 Left 952832544 3:37577059-37577081 CCAGTCCTTGGGCTCTGTTCCTC 0: 1
1: 0
2: 3
3: 33
4: 298
Right 952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG 0: 1
1: 0
2: 7
3: 120
4: 1031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952832556 Original CRISPR CAGGGAAGACAGAAAGATGA GGG Intronic
900182414 1:1317509-1317531 CAGGAAAGACAAACAGATGACGG + Intronic
900297968 1:1961783-1961805 CAGGGAAGAGAGGAAGGAGACGG + Intronic
900491791 1:2952950-2952972 CAAGGAAGAGAGAGAGATGGAGG - Intergenic
900912945 1:5615023-5615045 CAGGGAATATAGCAGGATGAAGG + Intergenic
902095335 1:13939543-13939565 AGAAGAAGACAGAAAGATGAGGG - Intergenic
902788705 1:18750286-18750308 CAGGTAAGTCAGGAAGATGTGGG + Intergenic
903162711 1:21500802-21500824 CACAGAAGACAGGGAGATGATGG + Intergenic
903382860 1:22909000-22909022 CCTGGGAGACAGAAAGAGGAGGG - Exonic
903466466 1:23555230-23555252 CCGGGAAGACAGATAATTGAAGG + Intergenic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904037397 1:27566216-27566238 GAAGAGAGACAGAAAGATGAAGG + Intronic
904069270 1:27780517-27780539 AAGTGAAGTCAGAAAGATCATGG + Intronic
904296600 1:29523434-29523456 CAGGGAACACGGGAAGATTACGG - Intergenic
904969974 1:34411849-34411871 CAGGGAAGACAGAAACCCTATGG + Intergenic
905149835 1:35919032-35919054 CTGGGAAGATAGGAAGGTGAGGG - Intronic
905215812 1:36406684-36406706 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
905282734 1:36859526-36859548 CCGAGAAGGCAGAAAGAAGAAGG - Intronic
905310108 1:37043157-37043179 CAGGGAAGAGAGGAGCATGAAGG + Intergenic
905456351 1:38090706-38090728 CAGTGAACACAGAAGGGTGAAGG + Intergenic
905618617 1:39420567-39420589 CAGGGAACACTGAAAAAGGAAGG - Intronic
905972262 1:42151069-42151091 CAGGGAAGACTGACACATGACGG + Intergenic
906208764 1:44000755-44000777 CAGGGAACTCACGAAGATGATGG + Exonic
906739041 1:48163172-48163194 CATGGAAGAAAGAAAAATTAAGG + Intergenic
906836013 1:49084129-49084151 CTCGGAAGACAGGAAGATGTGGG - Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
908031873 1:60009225-60009247 TATAGAAGACAGAAAGAAGAAGG + Intronic
908424373 1:63991570-63991592 AAGGAAAGACAGAAAGAGGCAGG + Intronic
908469481 1:64429532-64429554 CAGGGAAGCAAGGAAGAAGAAGG - Intergenic
908533502 1:65055956-65055978 CGGGGAAAACAGGAAGATCAGGG + Intergenic
908961682 1:69705503-69705525 CAGGGCATACACACAGATGAGGG + Intronic
909041483 1:70658093-70658115 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
909133352 1:71767195-71767217 AAAAGAAGACAGGAAGATGAGGG + Intronic
909263662 1:73527760-73527782 CAGGGACTAAAGAAAGATGATGG + Intergenic
909369657 1:74869375-74869397 AAAAGAAGACAGGAAGATGAGGG + Intergenic
909432749 1:75608622-75608644 AAATGAAGTCAGAAAGATGAGGG - Intronic
909580031 1:77223121-77223143 CTCAGAAGACAGAAAGATGTAGG - Intergenic
909759938 1:79273612-79273634 CCAGGAAGGAAGAAAGATGAAGG + Intergenic
909833497 1:80224376-80224398 CAGGGAAGAGAGAGAGAAAAGGG - Intergenic
909836199 1:80258655-80258677 CAGGGAAAATTGAAAGATCATGG + Intergenic
909953986 1:81754499-81754521 GAGGGAAGAAAGAAAGAGGAAGG - Intronic
910199857 1:84688832-84688854 CAGGGAAGATAAAAAGCTCATGG - Intronic
910417258 1:87014025-87014047 CTCAGAAGACAGAAAGATGTGGG - Intronic
910455095 1:87389394-87389416 CAGGGAAGACAGAAAGAAGTGGG + Intergenic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
910535801 1:88296123-88296145 CAGGGAAGGCAGAAAGTAGGAGG - Intergenic
910572625 1:88722903-88722925 CAGGGAAGACAAATAAATAAAGG + Intronic
910607124 1:89099399-89099421 CAGGGAAATCAGAAATATAAGGG - Intergenic
910625768 1:89304899-89304921 CAGCCAAGACAGAAAGATGGGGG - Intergenic
911054167 1:93696576-93696598 CATGGAAGACAGAATGGAGAAGG - Intronic
911244296 1:95499777-95499799 TATGGAAGACAGAAATAAGAAGG - Intergenic
911475963 1:98372712-98372734 GCGGGAAGAAAGAAAAATGAGGG + Intergenic
911512671 1:98826891-98826913 CTGAGAAGATAGGAAGATGATGG + Intergenic
911972070 1:104451705-104451727 AAAGGAAGACAGGAAGATGTGGG + Intergenic
912184938 1:107264109-107264131 CAGGCAAGAAGGAAAGATGGTGG - Intronic
912507911 1:110168950-110168972 CAGAGAAGATAGAAAAAGGAAGG - Intronic
912710867 1:111948798-111948820 CAGGGAAGTGGGGAAGATGAGGG + Intronic
913275706 1:117136154-117136176 CTGGGAAGACAGAGAGAAAATGG - Intergenic
913319943 1:117581185-117581207 CAGGGAAGACTGGAGAATGAAGG + Intergenic
913348397 1:117830513-117830535 AAAAGAAGACAGGAAGATGAGGG + Intergenic
913688639 1:121257518-121257540 CAGGACAGGCAGAAAGATGATGG - Intronic
914148960 1:145022758-145022780 CAGGACAGGCAGAAAGATGATGG + Intronic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
914731611 1:150376236-150376258 AAGTGAAGAAAGAGAGATGAGGG - Intronic
915049490 1:153052895-153052917 CAGGGAAGACAAAGAGAGAAAGG + Intergenic
915280417 1:154818604-154818626 CAGGGAAGGCAGGAGGCTGAGGG - Intronic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915694243 1:157722760-157722782 AAAAGAAGACTGAAAGATGAGGG - Intergenic
915737416 1:158093854-158093876 CAGGGAAGACCGACTGAGGAAGG - Intronic
915972178 1:160362671-160362693 CAGGGAAGACAGATGGATGGGGG + Intergenic
916145028 1:161730701-161730723 CAGGGATGGCAGAAAAATGCTGG + Intergenic
916485092 1:165251517-165251539 GAGGTAAGACAGAAAGAAGGGGG + Intronic
916518942 1:165545907-165545929 CAGGGAAGACAGAAACTACATGG - Intronic
916989408 1:170226418-170226440 CAGGAATGAAAAAAAGATGATGG + Intergenic
917704491 1:177618303-177618325 CAGAGGAAACAGAAAGATCAAGG + Intergenic
917894462 1:179474392-179474414 AGAGGAAGACAGAAAGATGTGGG + Intronic
917929146 1:179812000-179812022 CAGCGAAGAAAGCAAAATGAGGG + Intronic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918310342 1:183281205-183281227 CAGTGATGAGAGAAAGCTGAGGG - Intronic
918625507 1:186652354-186652376 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
919061634 1:192641481-192641503 CAGGGAGGACAGAAACAAGGAGG - Intronic
919845922 1:201642099-201642121 AAGGGAAGAAAGAAAGAGGAAGG - Intronic
920372298 1:205486792-205486814 AAGGGAGGACAGAGAGTTGAGGG - Intergenic
920475963 1:206276019-206276041 CAGGACAGGCAGAAAGATGATGG - Intronic
920636708 1:207711315-207711337 CTGGGAAGACAAACAGATAAAGG + Intronic
920792464 1:209106257-209106279 CAGGGAAGGCTAAAAGATGCAGG + Intergenic
920989525 1:210923405-210923427 GAGGGAGGTAAGAAAGATGATGG - Intronic
921132222 1:212229653-212229675 CAAGGAAGAAAAAAAGAAGAGGG - Intergenic
921214397 1:212924820-212924842 GAGGGAAGTCACAAGGATGAAGG - Intergenic
921531162 1:216284725-216284747 CTCAGAAGACAGAAAGATGTGGG + Intronic
922042648 1:221911858-221911880 CTGTGAAGACAGGAAGATGGGGG + Intergenic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
922580729 1:226695865-226695887 GGGGCAAGACAGTAAGATGAGGG + Intronic
923227716 1:231954683-231954705 TAGGGAAGAAAGGAAGAGGAGGG + Intronic
923627219 1:235623771-235623793 CTGGGGAGACAGCATGATGAGGG - Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924059269 1:240154853-240154875 GAGGGAAGAAAGAAAGAGGGAGG - Intronic
924811489 1:247406680-247406702 TATGGCAGACAGAAAGATAATGG - Intergenic
924863085 1:247947002-247947024 TAGGGAAGATAGAAAAATGAGGG - Intronic
1063071357 10:2669700-2669722 CAAGCAAGAGAGAAAGAGGAAGG + Intergenic
1063238221 10:4141531-4141553 CAGGGAAGGCTGGAAGCTGAGGG - Intergenic
1063505571 10:6595176-6595198 AAGGGAAGACAGGGAGATGTTGG - Intergenic
1063717736 10:8545266-8545288 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1064584084 10:16822317-16822339 CTCAGAAGACATAAAGATGAGGG + Intergenic
1064650931 10:17508574-17508596 CAAGGAATACAGATAGGTGACGG + Intergenic
1064880258 10:20044158-20044180 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
1065360031 10:24880950-24880972 AAGGAAAGAAAGAAAGAAGAAGG - Intronic
1065815783 10:29481306-29481328 CAGGGAAGATAGGGAGATGTTGG + Intronic
1066363851 10:34757356-34757378 AAGGAAAGACAGGTAGATGAAGG - Intronic
1067321927 10:45229354-45229376 CTCAGAAGACAGAAAGATGAGGG + Intergenic
1067762546 10:49058953-49058975 CAGAGCAGGCAGACAGATGAGGG + Intronic
1067832778 10:49620010-49620032 CAGGGCAGAAGGAGAGATGAGGG + Intronic
1067907065 10:50303509-50303531 AAAGGAAGACAGAAAAAGGAAGG + Intergenic
1068042637 10:51845242-51845264 CTGGAAAGACAGCAAGAAGAGGG - Intronic
1068123886 10:52814029-52814051 CAAAGAAGCCATAAAGATGAGGG + Intergenic
1068221458 10:54051329-54051351 CTAGGAAGACAGAAAGAAGTGGG + Intronic
1068475862 10:57523644-57523666 CAGAGATGAGAAAAAGATGAAGG + Intergenic
1068876462 10:62001665-62001687 AAGGGAAGACAGAGAGAGGAAGG + Intronic
1069776516 10:70930322-70930344 CAGGGGAGGCAGGAAGATGAAGG - Intergenic
1070427719 10:76305415-76305437 CATGAAAGAAAGAAAGAGGAAGG - Intronic
1070518083 10:77226420-77226442 CAGTGAAGACAGAAAGAGACAGG - Intronic
1070521813 10:77260306-77260328 CAGGAAGGACAGAGAGAGGAAGG + Intronic
1070581520 10:77723957-77723979 AAAAGAAGACAGGAAGATGAGGG + Intergenic
1070784779 10:79156531-79156553 CATGGGAGAGAGAAAGGTGAGGG + Intronic
1070995944 10:80781732-80781754 GATGAAAGACAGAAAGATGTTGG - Intergenic
1071027621 10:81134803-81134825 CAGGGAAGACAGACAGAATAAGG + Intergenic
1071104711 10:82080889-82080911 GAGGGAAGGAAGAAAGAAGAGGG - Intronic
1071338237 10:84619429-84619451 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1071742701 10:88378773-88378795 GAATGAAGACACAAAGATGAAGG - Intronic
1071990239 10:91094180-91094202 CTCAGAAGACAGGAAGATGAGGG - Intergenic
1072050207 10:91696550-91696572 AAGGGAAGAGAGAGGGATGATGG + Intergenic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072519525 10:96218784-96218806 TAGATAAGACAGAAAGAGGAGGG - Intronic
1072602919 10:96947634-96947656 CAGGTAAAACAGTAAGATCAGGG + Intronic
1072775191 10:98184206-98184228 AAGGGAAGACCTAAAGCTGAGGG - Intronic
1073054758 10:100692239-100692261 GAGGGGAGAGGGAAAGATGATGG - Intergenic
1073657585 10:105434165-105434187 CAGGGAGTACAAAGAGATGAGGG - Intergenic
1073701636 10:105934282-105934304 AGAGGAAGACATAAAGATGAGGG + Intergenic
1073779307 10:106819764-106819786 CAGGAAGAACAGAAAGATAAGGG + Intronic
1073861303 10:107744687-107744709 CAGCTAAGACAGAAAATTGAAGG + Intergenic
1073864507 10:107786613-107786635 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1074090273 10:110246406-110246428 AAGGGAGGACAAAAAGTTGAAGG - Intronic
1074486741 10:113891653-113891675 CAGGGACGACTGAAAGCTGAGGG - Intronic
1075258105 10:120940938-120940960 AAGGGAAAACAGAAAGAACAAGG - Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075674777 10:124288859-124288881 GAGGAAAGGGAGAAAGATGATGG + Intergenic
1075894364 10:125982219-125982241 CAAGGAAGAAAGAACGATGCAGG - Intronic
1075922461 10:126224683-126224705 CAGGGAAGGCAGGAAGCAGAGGG - Intronic
1076081566 10:127586266-127586288 AAGGGAAGGCAGAGAGGTGAAGG + Intergenic
1076120483 10:127933028-127933050 CAGGAGAGCCAGAGAGATGAGGG - Intronic
1076232398 10:128832525-128832547 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1076375365 10:129980102-129980124 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1076444972 10:130508041-130508063 CAGAAAAGACAGATGGATGAGGG - Intergenic
1077901987 11:6497234-6497256 CGGGGGAGCCAGAAAGAGGAGGG - Intronic
1077941436 11:6847811-6847833 CAAAAAAGACAGAAAGATGAGGG + Intergenic
1078611719 11:12825708-12825730 AAGGGAAGAAAAAAAGATTAGGG + Intronic
1078917046 11:15788087-15788109 CAGTGAAGACAGAAAAAGTAAGG + Intergenic
1079062690 11:17263323-17263345 GAGGCTGGACAGAAAGATGAAGG + Intronic
1079208248 11:18436848-18436870 CATGTATGACAGAAAGAGGATGG - Intronic
1079267427 11:18947307-18947329 CAGGTAAGAGAGATAAATGAAGG + Intergenic
1079331297 11:19535193-19535215 CAGGGAAAACAGGAAGCTGCTGG + Intronic
1079746414 11:24137198-24137220 AAAGAAAGAAAGAAAGATGACGG - Intergenic
1079923555 11:26462481-26462503 CAGAGAACACTGAAAAATGATGG - Intronic
1079957162 11:26879863-26879885 AAAGGAAGACAGGAAGATTAGGG - Intergenic
1080050200 11:27851808-27851830 AAGGGAAGAAAGAAAAAGGAAGG - Intergenic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1081068460 11:38577875-38577897 ACAAGAAGACAGAAAGATGAGGG - Intergenic
1081276116 11:41150890-41150912 CAGAGAAAACATACAGATGATGG + Intronic
1081390071 11:42518784-42518806 CAGGGAAAACAGGCAGGTGAAGG + Intergenic
1082679796 11:56153341-56153363 CCAGGACGAGAGAAAGATGAAGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082746520 11:56968738-56968760 CAGTGAGGACAGACAGATCAAGG + Intergenic
1083332064 11:61903353-61903375 AAAGCAAGAGAGAAAGATGATGG - Intronic
1083623986 11:64062673-64062695 CAGGGAAGCCAGAGTGCTGAAGG + Intronic
1083668414 11:64287455-64287477 CAGGTAAGACAGCAGGATCAAGG + Intronic
1083713375 11:64562129-64562151 CAGTGAACTCAGAAAGATGCCGG - Exonic
1084147024 11:67270415-67270437 CAGGGAAGCCAGAAAGGGGCAGG - Intronic
1084528901 11:69715180-69715202 AAGGGAGGAAAGAAAGAGGAAGG + Intergenic
1084580418 11:70019876-70019898 CGGTGAAGCCAGGAAGATGACGG - Intergenic
1084930007 11:72547581-72547603 CAGGGAAGACAGAAACCTTGAGG - Intergenic
1085658284 11:78337533-78337555 CAGGGAAAAGAGAAAGAAGGTGG + Intronic
1086000757 11:81983383-81983405 CAGAGAAGACAGAAAAAAGGAGG - Intergenic
1086248376 11:84783407-84783429 AAGAGAACACAGAAAGATCAAGG - Intronic
1086438328 11:86803051-86803073 CAGGGAAGAATGGAAAATGAAGG - Intronic
1086669203 11:89526921-89526943 AACAGAAGACAGAAAGATGTGGG + Intergenic
1086890170 11:92248125-92248147 GAGGGAAAAAGGAAAGATGAGGG - Intergenic
1086954763 11:92924668-92924690 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1087571185 11:99929245-99929267 CTCAGAAGACAGAAAGATGGGGG - Intronic
1087823043 11:102732768-102732790 CAATTAAGACAGAGAGATGAAGG - Intergenic
1088189024 11:107206375-107206397 CTCAGAAGACAGGAAGATGAGGG - Intergenic
1088341427 11:108772371-108772393 CAGGGAAGACAGAGACAGAAGGG + Intronic
1088388902 11:109291522-109291544 AAAAGAAGACAGGAAGATGAGGG - Intergenic
1088567034 11:111183308-111183330 AGAAGAAGACAGAAAGATGAGGG + Intergenic
1088938999 11:114434973-114434995 CAGAAAAGACAGGAAGATGAGGG - Intronic
1088974018 11:114798815-114798837 CAGTCAAGACAGGAAGATCAAGG - Intergenic
1088999256 11:115036793-115036815 CAGTGAAGAAAGAAAGTTGGAGG - Intergenic
1089282631 11:117385115-117385137 CAGGGAAGAAAGAGAGCGGAGGG - Intronic
1089418936 11:118316453-118316475 AAGGGAAGAAAGAAAGAGGATGG + Intergenic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089793523 11:120961833-120961855 CCTGGAAAACAGAAAGCTGAAGG - Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090223394 11:125051616-125051638 GAGGGAAGAGAGAAATATAAAGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090352891 11:126118870-126118892 CAGAGAAGACAGAGAGGTGAGGG - Intergenic
1090514609 11:127412077-127412099 CAGAGATGACAGAGAGACGATGG - Intergenic
1090573088 11:128068974-128068996 CTCGGAAGACAGAAAAATGTGGG - Intergenic
1090896302 11:130978663-130978685 CAGGGAAGAAAGACAAATAAAGG - Intergenic
1091602495 12:1926349-1926371 GAGGGAAGGCAGAAAGAAGGAGG - Intergenic
1091642088 12:2245089-2245111 CAGGCAAGACAGAAACAGCATGG + Intronic
1091705793 12:2692033-2692055 AAGTGAAAACAGAAAGGTGAGGG - Intronic
1091811942 12:3406765-3406787 CTCAGAAGACAGAAAGATGTAGG - Intronic
1092255181 12:6923025-6923047 GAGGGAAGAGAGAAAGAGAAAGG - Exonic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092482217 12:8870196-8870218 CAGGAAACACAGTTAGATGATGG - Intronic
1092588939 12:9932592-9932614 AAGGAAAAAAAGAAAGATGATGG - Intergenic
1092692684 12:11131186-11131208 CATGGAAGAGAGAGAGAGGAGGG - Intronic
1092931770 12:13322291-13322313 CGGGAAAGACAGCAACATGATGG + Intergenic
1093038934 12:14357511-14357533 CACCTAAGAAAGAAAGATGATGG - Intergenic
1093546217 12:20352237-20352259 CAGAGAAGACAGAAAGTTGCCGG + Intergenic
1093624159 12:21326468-21326490 CTCGGAAGACAGGAAGATGTGGG + Intronic
1094285301 12:28786029-28786051 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
1094379958 12:29831891-29831913 CTCAGAAGATAGAAAGATGAGGG - Intergenic
1094421257 12:30273503-30273525 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1095328460 12:40927293-40927315 TAGGAAAGACACAAAGAAGATGG + Intronic
1095413286 12:41947169-41947191 AAAAGAAGACAGGAAGATGAGGG - Intergenic
1095727969 12:45473272-45473294 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1095861462 12:46922531-46922553 TAGGGAAGACTCAGAGATGAAGG - Intergenic
1095952295 12:47788189-47788211 TAGGGAAGGCAGAGAGATGGGGG + Intronic
1097072394 12:56364674-56364696 CAAGGAAACCAGAAAGTTGATGG + Intergenic
1097083057 12:56447433-56447455 CAGAGAAGTCTGGAAGATGAGGG + Intronic
1097629059 12:62037171-62037193 CAAGTAAGAGAAAAAGATGAAGG - Intronic
1097665682 12:62474848-62474870 CAGTGAATAAAGAGAGATGAGGG - Intronic
1097772800 12:63608200-63608222 AAGGAAAGAGAGACAGATGATGG + Intronic
1098130714 12:67347223-67347245 CTCAGAAGACAGAAAGATAAGGG + Intergenic
1098203797 12:68084641-68084663 CAAAGAAGACAGGAAGATGTGGG - Intergenic
1098319745 12:69231375-69231397 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1098499213 12:71171036-71171058 CAGGAAAGACAGAAAAATGCTGG - Intronic
1098675029 12:73279273-73279295 CTGGGAAAAAAGAAAGATGTTGG + Intergenic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1099319349 12:81125508-81125530 CAGGAAAGAAAGGAAAATGAGGG - Intronic
1099325014 12:81203934-81203956 AAGGGAAAACAAAAAGATAATGG + Intronic
1099609426 12:84848640-84848662 AAAGGAAGAAAGAAAGAGGAAGG + Intergenic
1099658604 12:85526889-85526911 CAAAAAAGACAGGAAGATGAGGG + Intergenic
1099921828 12:88967698-88967720 CAGGAGAGACAGAAAGCTAAGGG + Intergenic
1100305255 12:93344421-93344443 CAGGGATGACCTAAAGATGCTGG - Intergenic
1100430115 12:94524323-94524345 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
1100563130 12:95769074-95769096 CAGGGAAGAAAGAGAGCGGAAGG + Intronic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1101033934 12:100686278-100686300 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1101193127 12:102355220-102355242 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1101409098 12:104454537-104454559 AAGGGAATTTAGAAAGATGAGGG + Intergenic
1101455251 12:104824931-104824953 CAGGAAAGAGAGAAAGGTGGTGG - Intronic
1101505694 12:105344355-105344377 CAGGGATGGCAGAACGGTGATGG - Intronic
1101693578 12:107103484-107103506 AAGGGAATAGAGAAGGATGAGGG - Intergenic
1102028923 12:109728928-109728950 CTGGGAAGACTGAAAGGAGATGG - Intronic
1102052956 12:109876503-109876525 CAGAGAAGAAAGAAAGAGGGAGG + Intronic
1102195522 12:111022596-111022618 CAGGGAAGTAATAAACATGATGG - Intergenic
1102248072 12:111367732-111367754 CTGGGAAGACAGGAAGCTGCAGG + Intronic
1102555016 12:113721023-113721045 CAGCAAGGACAGAATGATGAAGG + Intergenic
1102818159 12:115885664-115885686 CAGGGAAGGGAAAAAGAAGAGGG + Intergenic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1103926606 12:124426867-124426889 CAGGGAAGACACAGAGGGGACGG + Intronic
1104373299 12:128243174-128243196 CTGGGAAGACAGGAGGATGGTGG - Intergenic
1104679924 12:130742807-130742829 GAGGGATGACAGATAGAAGATGG + Intergenic
1105256835 13:18749246-18749268 GGAAGAAGACAGAAAGATGAGGG - Intergenic
1105261749 13:18784756-18784778 GAAAGAAGACAGGAAGATGAAGG - Intergenic
1105305706 13:19167320-19167342 CAGGGAAGACAGAAAGGCAGAGG + Intergenic
1105588631 13:21769416-21769438 AAGGGAAGAAAGAGAGCTGAAGG - Intergenic
1105707591 13:22977694-22977716 AAGGAAAGAGAGAAAGAAGAAGG + Intergenic
1106318173 13:28613618-28613640 CAGGGAAGACAGGAAGATTGTGG - Intergenic
1106660514 13:31794766-31794788 CAGGGAACAGGGTAAGATGAAGG + Intronic
1108100133 13:46945629-46945651 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1108238803 13:48439451-48439473 CAGGCATGATAGAAAGATTACGG + Intronic
1109167192 13:59050898-59050920 GAGGGAAGTCAAAAAGAAGAGGG + Intergenic
1109175199 13:59146468-59146490 CAGAGAAAAGAGCAAGATGATGG + Intergenic
1109295725 13:60528121-60528143 AAGGGACCACAGAAAAATGATGG - Intronic
1109490980 13:63099937-63099959 GGAGGAAGACAGGAAGATGAGGG + Intergenic
1109851523 13:68071560-68071582 AGGGGAAGACAGGAAAATGAAGG + Intergenic
1110034764 13:70669308-70669330 GAGGGAAGAAAGGAGGATGAGGG - Intergenic
1110305988 13:73987569-73987591 CAGGGAAGAGAAAAAGAAGAAGG + Intronic
1110390995 13:74973839-74973861 CAGGGAAGGGAGGAAGAGGAAGG + Intergenic
1110515732 13:76410541-76410563 CAGTGTAGACAGATAGATGGTGG + Intergenic
1110914772 13:81008324-81008346 AGAGGAAGACAGAAAGATGTGGG + Intergenic
1111013482 13:82344584-82344606 AAAAGAAGACAGAAAGTTGAGGG + Intergenic
1111123667 13:83884389-83884411 CAAGGAAAACAGAAAAATGCTGG + Intergenic
1111315640 13:86555296-86555318 CAGGGAAGAGAGCAGGATCAAGG + Intergenic
1111343338 13:86916334-86916356 CAGAGAAGACTGAAAGAGTAGGG + Intergenic
1111385376 13:87520726-87520748 CTGAGAAGACAGAAAGATGTGGG + Intergenic
1111463498 13:88576791-88576813 AGAGGAAGACAGGAAGATGAAGG - Intergenic
1111910992 13:94311815-94311837 CAGGGAAGACAAATAGCTCAAGG + Intronic
1111996515 13:95170959-95170981 CAGGGGAGAAAGAAAGATCGAGG + Intronic
1112164450 13:96903239-96903261 AAGGAAAGACAGAAAGCAGAGGG + Intergenic
1112531327 13:100206742-100206764 CAGGGAAGAGAGGAAGGGGAAGG - Intronic
1112857342 13:103787479-103787501 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1113203179 13:107888925-107888947 AGAGGAAGACAGGAAGATGAGGG - Intergenic
1113324909 13:109271705-109271727 CAGGCAATAGAGAAAGATGGCGG + Intergenic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1113890373 13:113732254-113732276 CAGGGAAGTCAGAAGGGAGAGGG - Intronic
1114534026 14:23411957-23411979 GAGGGGAGGCAGACAGATGAGGG - Intergenic
1115010512 14:28539692-28539714 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1116199421 14:41771780-41771802 CTCAGAAGACAGAAAGATGAGGG - Intronic
1116286984 14:42986485-42986507 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1116742571 14:48775760-48775782 AGAAGAAGACAGAAAGATGAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117256440 14:53982891-53982913 CAGTGAATGGAGAAAGATGAAGG + Intergenic
1117261226 14:54035683-54035705 AAGGGAAGACAGAAAACTGAAGG - Intergenic
1117652510 14:57921676-57921698 AAGGGAAGACAGGGAGAAGATGG - Intronic
1117858518 14:60062758-60062780 CAGGGATGCCAGGAAGATGGGGG - Intronic
1117886597 14:60370803-60370825 AGAAGAAGACAGAAAGATGAGGG + Intergenic
1118010120 14:61602255-61602277 CAGATAATACAGAAAGATCAGGG + Intronic
1118024547 14:61755680-61755702 CTCAGAAGACAGGAAGATGAGGG - Intergenic
1118092580 14:62498469-62498491 AGAAGAAGACAGAAAGATGAGGG - Intergenic
1118538336 14:66793327-66793349 CAGGGAAAGCACAAAGAAGATGG + Intronic
1118859541 14:69651804-69651826 CAGGGAAGAAAGAGAGGTTAAGG + Intronic
1119081085 14:71694343-71694365 CAGTGAAAACAGAGAGTTGAAGG - Intronic
1119548718 14:75492717-75492739 AAAGAAAGAAAGAAAGATGAAGG + Intergenic
1119854019 14:77885985-77886007 GAGGGAAGGAAGAAAGAAGAAGG + Intronic
1120357965 14:83458538-83458560 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1120515380 14:85464193-85464215 AGGGAAAGACAGGAAGATGAGGG + Intergenic
1120954674 14:90071495-90071517 CAGGGAGCACAGAGAGATGTGGG - Intronic
1121097927 14:91230711-91230733 AAGGGAAGACCCCAAGATGATGG + Intergenic
1121416812 14:93785062-93785084 GAGGGCAGCCACAAAGATGATGG + Intronic
1121423206 14:93830149-93830171 AAGGAAGGAGAGAAAGATGATGG + Intergenic
1121497956 14:94410158-94410180 CAGGGAAGACAATAAAAGGAGGG - Intergenic
1121780449 14:96618782-96618804 GAAGGGAGACAGAAAGGTGAGGG - Intergenic
1122018562 14:98817822-98817844 GAACGGAGACAGAAAGATGATGG + Intergenic
1122198771 14:100109227-100109249 CAGGGAGGACAGACTGAAGAAGG - Intronic
1122518890 14:102328669-102328691 CATAGAAGACAGAAAGTCGAAGG - Intronic
1122647565 14:103205659-103205681 CTGTGAAGTGAGAAAGATGAAGG + Intergenic
1123388918 15:19849114-19849136 AAAGGAAGAAAGAAAGATGAAGG + Intergenic
1123878694 15:24652922-24652944 CAGGGGAGAGAAAAAGAAGAGGG + Intergenic
1124153103 15:27199932-27199954 CAGGAAAGAGAGAAGGATGAAGG - Intronic
1124444872 15:29721680-29721702 AAGAGAAGACAGAAAAATGAGGG + Intronic
1124792793 15:32745641-32745663 CAGACAAGACATAAAGCTGAGGG - Intergenic
1125004631 15:34803389-34803411 CAGGGAACACAGAAAGTAGATGG - Intergenic
1125049159 15:35277587-35277609 AGAAGAAGACAGAAAGATGAAGG + Intronic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125279748 15:38031123-38031145 AAGGGAAAGCAGAAAGATGGAGG - Intergenic
1125404526 15:39338599-39338621 TATGGAAGACGGGAAGATGAAGG - Intergenic
1125428530 15:39573719-39573741 GAAGGAAGACAGAAAGAAGAGGG + Intergenic
1125514982 15:40313583-40313605 CAGCGAAGACAGGAATATGTTGG + Intergenic
1125835811 15:42749726-42749748 AAGGGAAAAAAGAAAAATGAGGG - Intronic
1125859373 15:42984009-42984031 GAAGGAAGATAAAAAGATGAGGG + Intronic
1126245551 15:46500460-46500482 CAGGGAAGAGAGAGAAATAAAGG + Intergenic
1126519422 15:49574472-49574494 CAGGAAAGACAGAAAGGGAAGGG - Intronic
1126882744 15:53116929-53116951 AAGGGAAGAAAGAAAGAGCAAGG - Intergenic
1126888148 15:53174622-53174644 CAGGGATAACAGATAGATGTTGG + Intergenic
1127357347 15:58213174-58213196 AAAGGAAGACAGAAGGCTGAGGG + Intronic
1127817354 15:62622947-62622969 CAGGGCACACAGACAGATGATGG - Intronic
1128550756 15:68596606-68596628 CTGGGAGGACAGATAGGTGAAGG + Intronic
1128715363 15:69903823-69903845 CAGGGCAGAGAGCAAGATGAAGG - Intergenic
1129790526 15:78338004-78338026 GAGGGAAGAGGGAAAGAAGAAGG - Intergenic
1129792644 15:78351720-78351742 CAGGTAAAACAGAAAGAACAAGG + Intergenic
1129901669 15:79156361-79156383 GAGGGGAGACAGAGAGATGAGGG - Intergenic
1129905248 15:79182627-79182649 AAGAAAAGACAGAAAGAGGAAGG - Intergenic
1129905268 15:79182807-79182829 AAGGGAAGAAAGAAAGAGAAAGG - Intergenic
1130029374 15:80297777-80297799 GAGGGAAGACAGAGAGAGGGAGG + Intergenic
1130096603 15:80860860-80860882 GAGGGAACACAGAAAGAGAAGGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130533285 15:84764201-84764223 CAGAGAGGACAGAAAGACAAGGG - Intronic
1130751269 15:86715684-86715706 AAAGAAAGAAAGAAAGATGAAGG + Intronic
1131312679 15:91305033-91305055 CAGAAAAGACAGACAAATGACGG + Intergenic
1131619656 15:94054143-94054165 AGAAGAAGACAGAAAGATGAGGG + Intergenic
1131687677 15:94788157-94788179 GAGGGAAGGAAGAAAGAGGAAGG - Intergenic
1131707258 15:95011263-95011285 AAAGGAAGACAGATAGATGGAGG + Intergenic
1132012523 15:98288393-98288415 CAGGGAAGACAGACAAGTGAGGG + Intergenic
1132403686 15:101529503-101529525 CTGTGAACACAGAAAGATTAAGG - Intergenic
1133094258 16:3430536-3430558 CAGGGGAGACAGAAACATTCAGG + Intronic
1133622440 16:7539373-7539395 CTGGGAATAGAGAGAGATGAGGG - Intronic
1133865313 16:9636713-9636735 CAGGGGAGAGAGAAAGGGGAGGG + Intergenic
1133948841 16:10372561-10372583 AAAGAAAGAAAGAAAGATGAAGG - Intronic
1134059940 16:11193189-11193211 CAGGGAAGACAAAATGATGATGG - Intergenic
1134181530 16:12051785-12051807 GAGGCAAGACAAAAGGATGATGG - Intronic
1134289208 16:12890130-12890152 CAGGAAAGACAGAAACAAAAAGG + Intergenic
1134770544 16:16805518-16805540 AAGGGAAGACAGAATGATTATGG + Intergenic
1134825636 16:17282017-17282039 CCGGGAAGACAGCCAGATTAAGG - Intronic
1135615902 16:23910821-23910843 CAGGGAAGAGAGAAAAAAAATGG - Intronic
1136083725 16:27869547-27869569 CAGAGAGGAGAGAGAGATGAAGG - Intronic
1136380480 16:29892284-29892306 CAGGGAAGACTGAGCAATGAAGG + Intronic
1136590164 16:31213867-31213889 CAGAAAAGACAGAAAATTGAAGG - Intergenic
1136872222 16:33817772-33817794 CATGGAAGACAGAAAGTAAAGGG - Intergenic
1137358756 16:47792840-47792862 AAAAGAAGACAGGAAGATGAGGG - Intergenic
1137459528 16:48647916-48647938 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1137611875 16:49823672-49823694 CAGAGGAGACAGTAAGAGGAAGG + Intronic
1137713522 16:50583575-50583597 CAGGAAAGATAGTAAAATGATGG + Intronic
1137906695 16:52330906-52330928 AAGGGAAGAAGGAAAGGTGAAGG + Intergenic
1137946777 16:52740638-52740660 AAAGAAAGAAAGAAAGATGAAGG + Intergenic
1138022507 16:53497362-53497384 TAGGGAAGAGACAAAGATGTGGG - Intronic
1138342524 16:56299517-56299539 CAGGGAAGAAAGGAAGGTGGGGG - Intronic
1138460020 16:57142606-57142628 CAAGGCAGAGGGAAAGATGAAGG - Intronic
1139092899 16:63670793-63670815 TAGGAAAGAAAGAAAGAAGAGGG + Intergenic
1139541904 16:67624285-67624307 CAGACAAGAGGGAAAGATGAGGG - Intronic
1140228783 16:73100242-73100264 CAGAGAAGACAGACAGCTGAGGG + Intergenic
1140984663 16:80146695-80146717 CAAGTCACACAGAAAGATGATGG - Intergenic
1141237648 16:82233568-82233590 TAGAGAAGACAGAAAGTGGAAGG - Intergenic
1141542689 16:84738180-84738202 CGGGGAAGAGAGAATGCTGAAGG - Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1203099950 16_KI270728v1_random:1298296-1298318 CATGGAAGACAGAAAGTAAAGGG + Intergenic
1142884355 17:2903618-2903640 CCAGGAAGAAAGAAAGAGGAAGG + Intronic
1142928344 17:3260422-3260444 AAGGAAAGAGAGAAAGAGGAAGG - Intergenic
1143046567 17:4085409-4085431 TAGGCAAGTCACAAAGATGAAGG + Intronic
1143373173 17:6453059-6453081 AAAGGAAGACAGAGAGAGGAAGG - Exonic
1143669315 17:8385492-8385514 GTGGGAAGACAGGAAGACGATGG - Intergenic
1143706620 17:8702350-8702372 CAAAGAAGAAAGAAAGAGGAAGG - Intergenic
1143743254 17:8969706-8969728 CAGAGAGGACAGAGAGAGGAAGG - Intergenic
1143771681 17:9173141-9173163 CAGGGCAGACAGAGAGACCAGGG - Intronic
1143952436 17:10644262-10644284 AAGGGAAGATAGCAAGATGGCGG - Intronic
1144464134 17:15482933-15482955 CAGAGATGATCGAAAGATGATGG + Intronic
1144465768 17:15496061-15496083 TATGGAGGAGAGAAAGATGAAGG - Intronic
1145053422 17:19681800-19681822 CAGGGAAGAAAGGGAGATAAGGG - Intronic
1145846375 17:28042111-28042133 CAGGGAGGAATGAAAGATGTGGG - Intronic
1146595770 17:34167169-34167191 CAGGGAGGACAGTAAGCTTAAGG - Intronic
1146686635 17:34845597-34845619 CAGGGAAGACAGAGAAGCGACGG + Intergenic
1147376590 17:40026333-40026355 TAGGGGAGACGGAAAGGTGATGG + Intronic
1148671246 17:49411947-49411969 TGGGGAAGACAGAGAGAAGAGGG - Intronic
1149023537 17:51998092-51998114 CAGTGCAGACAGACAGAGGAAGG + Intronic
1149600270 17:57888928-57888950 CAGGGGAGGAAGAAAGAAGATGG + Intronic
1150321382 17:64217256-64217278 CTGGGAGGACAGAGAGAAGAGGG - Intronic
1150515626 17:65806976-65806998 AAAAGAAGACAGAAAGATGTGGG + Intronic
1150552219 17:66221340-66221362 AAGGAAAGAAAGAAAGAGGAGGG + Intronic
1150740244 17:67773572-67773594 CAGGGAAGAAGGACAGATGATGG + Intergenic
1150772043 17:68050445-68050467 AAAGGAAGAAAGAAAGAGGAAGG - Intergenic
1150978946 17:70120296-70120318 AGAAGAAGACAGAAAGATGAGGG - Intronic
1151013248 17:70525966-70525988 GAGCAAAGACATAAAGATGAAGG + Intergenic
1151183340 17:72345533-72345555 CCAGGAAGGCAGAAAGAAGAGGG + Intergenic
1151249704 17:72824564-72824586 AAAGGAAGACAGGAAGATGAGGG + Intronic
1151411672 17:73934592-73934614 CAGGGCAGAGAGAAAGATAGAGG - Intergenic
1151415517 17:73960015-73960037 AGAAGAAGACAGAAAGATGAGGG + Intergenic
1151524283 17:74653264-74653286 AAGGGAAGAGAGGAAGAGGAGGG + Intergenic
1152860644 17:82695170-82695192 AAAGAAAGAAAGAAAGATGAGGG - Intronic
1153138044 18:1940584-1940606 AAAGGAAGAAAGGAAGATGAGGG + Intergenic
1153400955 18:4683148-4683170 CATGGAAGAAAGAGAGATGGAGG + Intergenic
1153492636 18:5665125-5665147 CTGGGAAAACAGGAAGATAATGG + Intergenic
1153763027 18:8349978-8350000 CAACTAAGACAGAAAGGTGAAGG + Intronic
1153896356 18:9565566-9565588 CAGTGAACACACAAAGAAGAAGG + Intronic
1153957437 18:10109957-10109979 CAGGCTAGAAAGAAAGATGTCGG - Intergenic
1154000404 18:10477728-10477750 CAGGGGAGAAAGGAAGAGGATGG + Intronic
1154386252 18:13895056-13895078 CCGGGAAGATACAAAGAAGAGGG - Intronic
1154424276 18:14260067-14260089 GAAAGAAGACAGGAAGATGAAGG + Intergenic
1154426508 18:14276190-14276212 GGAAGAAGACAGAAAGATGAGGG + Intergenic
1154426962 18:14279420-14279442 GAAAGAAGACAGGAAGATGAAGG + Intergenic
1154429693 18:14298952-14298974 GAAAGAAGACAGGAAGATGAAGG + Intergenic
1154431519 18:14312128-14312150 GGAAGAAGACAGAAAGATGAGGG + Intergenic
1154431966 18:14315297-14315319 GAAAGAAGACAGGAAGATGAAGG + Intergenic
1154434200 18:14331431-14331453 GGAAGAAGACAGAAAGATGAGGG + Intergenic
1155272346 18:24153057-24153079 CAGAGAAGGCTGAAAGCTGAGGG - Intronic
1155378033 18:25183224-25183246 AGGGGAAGAAAGAGAGATGAGGG - Intronic
1155679569 18:28473411-28473433 TAGAGAAGACAGAAAAATGTGGG + Intergenic
1156157816 18:34324327-34324349 CTGGGAAGGCAGAAAAATGTGGG - Intergenic
1156595386 18:38542551-38542573 AAAGGAAGACAGAAACATGGGGG - Intergenic
1156773159 18:40754544-40754566 CAAGCAAGACAGAATGAGGAAGG + Intergenic
1157578286 18:48758441-48758463 CAGGGAGGACAGCAAGAGGTAGG + Intronic
1157990625 18:52491651-52491673 CAATGAAGACAGAAAAATGGAGG + Intronic
1158299328 18:56034017-56034039 CTCAGAAGACAGGAAGATGAGGG - Intergenic
1158604893 18:58887102-58887124 GAGGGAACACAGGCAGATGATGG + Intronic
1159360580 18:67396407-67396429 AAGTGATGACAGAAAGATGAGGG - Intergenic
1159380968 18:67658676-67658698 CATGAACCACAGAAAGATGAGGG + Intergenic
1159727211 18:71976038-71976060 GAGGGAAAATAAAAAGATGAAGG - Intergenic
1159892605 18:73966656-73966678 CAGGAGAGACAGAAAGCTAAGGG - Intergenic
1159980890 18:74778168-74778190 CAGGGAGGATAGAAAAAAGAGGG - Intronic
1160041861 18:75352797-75352819 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1160258344 18:77266356-77266378 CTGAGAAGACAGGAAGATGTGGG - Intronic
1161157175 19:2738575-2738597 CAGAGAAGCAAGAAAGAAGAAGG - Intronic
1161362112 19:3856204-3856226 CGGGGAAGCCAGCAGGATGAAGG + Intronic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161886305 19:6998833-6998855 AATGGAAAACAGAAAGATGAAGG - Intergenic
1162104710 19:8363444-8363466 AAGGAAAGAGAGAAAGAGGAAGG - Intronic
1162131174 19:8526984-8527006 CAGGTGAGAGAGACAGATGAAGG + Intronic
1162243740 19:9381206-9381228 AAGGGAAGACTGAAAAATGAAGG - Exonic
1162549676 19:11351542-11351564 CAGGGAAGACAGAAAGCTGGAGG + Intronic
1163176474 19:15567088-15567110 AAAGGAAGAAAGAAAGAGGAAGG - Intergenic
1163178282 19:15581020-15581042 AAGGAAAGAAAGAAAGATGGAGG - Intergenic
1164441249 19:28282287-28282309 CAGGGGAGTCAGAAAGAAGATGG - Intergenic
1164604466 19:29587483-29587505 CAGGGAAGGAAGAGAGTTGATGG + Intergenic
1165076942 19:33284800-33284822 TTGGAAAGACAGAAAGATGAAGG - Intergenic
1166381852 19:42358867-42358889 CCGGGAAGTCAGGAAGAAGATGG + Exonic
1166685365 19:44793358-44793380 TGGGGAAGACAGACAGAGGAAGG - Intronic
1166800124 19:45451376-45451398 CAGGGGAGACAGACAGACAAGGG + Intronic
1166812490 19:45522566-45522588 CAGGAAAGTCAGCAAGGTGAGGG + Exonic
1166936646 19:46337597-46337619 CAGAGAGGAGAGAAAGGTGAGGG + Intronic
1167223666 19:48221032-48221054 GAGGGAAAAAAGAAAGAGGAAGG + Intronic
1167298054 19:48663433-48663455 CTGGGGAGACAGACAGCTGAAGG - Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168356953 19:55706615-55706637 CAGGAAAGAGAGAAAAAGGAGGG + Intronic
1168462155 19:56568036-56568058 CAGGTAAGAGTGACAGATGACGG + Exonic
1168548948 19:57277622-57277644 CAGGGAAGGCAAAATGATCAGGG + Intergenic
1168679024 19:58300378-58300400 CAGTGAAGACTGAAAGAAGGGGG + Exonic
924978576 2:199464-199486 CAGCGAGGACAGCAAGGTGACGG + Intergenic
925318687 2:2944460-2944482 CAGGGAAGATCTAAAGCTGAAGG + Intergenic
925560110 2:5182507-5182529 CTGAGAAGACAGGAAGATGTGGG + Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925781473 2:7386027-7386049 GGGGGAAGACAGAAAGATAAAGG + Intergenic
926142698 2:10377762-10377784 CAGTGAACACAGAAACATAAAGG + Intronic
926221553 2:10939150-10939172 AGGAGAAGACAGGAAGATGAGGG - Intergenic
926877367 2:17496320-17496342 CAGGGAATAGAGAAAGTTGTTGG + Intergenic
927204938 2:20602039-20602061 GCAGGAAGACAGAAAGATGTGGG + Intronic
927253583 2:21019987-21020009 GAGGGAAGACAGGAGGATAAGGG - Intronic
927275346 2:21257771-21257793 AAGGGAGGACAGAAAAAGGAAGG - Intergenic
927302735 2:21535167-21535189 GAAGACAGACAGAAAGATGAGGG + Intergenic
928017555 2:27672351-27672373 TAGAGAAGACAGAAAGATAAAGG - Intronic
928070317 2:28208624-28208646 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928138620 2:28708208-28708230 CAGGGAAGACAGAAAGAATGAGG + Intergenic
928859076 2:35834028-35834050 CAGGGAAAACAGGAAAATCATGG + Intergenic
928879325 2:36079720-36079742 CAGGGACGACAGAAATATCAAGG + Intergenic
929211345 2:39360382-39360404 CTCAGAAGACAGAAAGATGTGGG - Intronic
929269111 2:39953457-39953479 CAGGGAAAACAGTAAGAGAAAGG + Intergenic
929325938 2:40610726-40610748 CTCAGAAGACAGGAAGATGAGGG - Intronic
929373388 2:41254238-41254260 CAAGGGAGACACAAAGAAGAAGG + Intergenic
929430454 2:41881992-41882014 AAGGAAAGAGAGAAGGATGATGG - Intergenic
930177112 2:48313084-48313106 AAGGGAAGATTGAAAGAAGATGG - Intergenic
930237387 2:48900979-48901001 CAGGAACAACAAAAAGATGAGGG - Intergenic
930480518 2:51943161-51943183 GAGAGAAGATAGAAAGATGTAGG + Intergenic
930626919 2:53708574-53708596 TGAAGAAGACAGAAAGATGAGGG + Intronic
930878076 2:56242450-56242472 CAAGAAAGAGAGAAAGTTGATGG + Intronic
930882707 2:56290204-56290226 CTAGGATGACAGAAAGATAATGG - Intronic
930952392 2:57158345-57158367 GAGGGAAGACCTAAAGGTGAAGG + Intergenic
931349164 2:61472294-61472316 CAAGGAAGAAGGGAAGATGATGG - Intergenic
931592675 2:63902257-63902279 CAGAGATGACTAAAAGATGAGGG + Intronic
931784987 2:65610562-65610584 CAGGGAAGACAGACAAATGGAGG - Intergenic
932054721 2:68432710-68432732 GGGAGAAGACAGAGAGATGAAGG - Intergenic
932067567 2:68582517-68582539 AAGGGAATACAGAAAGTAGAGGG + Intronic
932218490 2:69982681-69982703 CAGGGAAGACAGAGTCATGCAGG + Intergenic
932481905 2:72046787-72046809 CAGGGAAAACAGAAAGCACAAGG + Intergenic
932569280 2:72929521-72929543 CAGGGAAGAGAGAAAGCTGAGGG + Intronic
932969902 2:76528031-76528053 GAGGAAAGAAAGAAAGAAGAAGG - Intergenic
933420400 2:82038290-82038312 CTCAGAAGACAGGAAGATGAGGG - Intergenic
933482049 2:82870109-82870131 AGAGGAAGACAGAAAGATGTGGG - Intergenic
933588270 2:84203246-84203268 CAGGAGAGACAGAAAGAAAATGG + Intergenic
933639994 2:84748642-84748664 CTCAGAAGACAGGAAGATGAGGG - Intronic
933857137 2:86426787-86426809 CAGGGAATACAAAAAGATTAGGG + Intergenic
934491897 2:94767078-94767100 GGAAGAAGACAGAAAGATGAGGG - Intergenic
934772989 2:96919838-96919860 CAGGAAAGACAGAAAGAGATGGG + Intronic
935479156 2:103562924-103562946 CTCAGAAGACAGAAAGATGTGGG - Intergenic
935754827 2:106268905-106268927 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
935931761 2:108134182-108134204 CTCAGAAGACAGGAAGATGAGGG - Intergenic
936231797 2:110708778-110708800 AATAGAAGACAGAAAAATGATGG - Intergenic
936233619 2:110725125-110725147 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
936437852 2:112523381-112523403 CAGGGTAGAAATAAAGAAGAAGG - Intronic
936940556 2:117879701-117879723 CAGCACAGAAAGAAAGATGAAGG - Intergenic
937459488 2:122073606-122073628 CAGGGAAGAGAGAAAAACTAAGG + Intergenic
937555690 2:123152454-123152476 CAAGGAAGATAGAATGATCATGG - Intergenic
937726513 2:125173739-125173761 AGAGGAAGACAGGAAGATGAGGG + Intergenic
938222462 2:129581936-129581958 CAACGAAGACAGGAAGGTGAGGG - Intergenic
938294511 2:130169228-130169250 CAGGAAAGACAGAAAGGCAAGGG + Intronic
938462139 2:131504668-131504690 CAGGAAAGACAGAAAGGCAAGGG - Intergenic
938884726 2:135632838-135632860 CAGGAAAGAAAGAAAAATAATGG - Intronic
939094246 2:137815405-137815427 TAGGGAACACAGAAAAATTAAGG - Intergenic
939138388 2:138323923-138323945 CAGGGATGGCTGAAAGCTGAGGG - Intergenic
939236353 2:139499065-139499087 AATGGAAGACAGAAAAATGCAGG + Intergenic
939362036 2:141184833-141184855 TAGGGAAGAAATAAAGATGAAGG - Intronic
939393594 2:141600599-141600621 CAGCAAAGTCAGAAACATGAGGG - Intronic
939905685 2:147910972-147910994 CATGGAAGACAGAATCATAATGG - Intronic
940148436 2:150572960-150572982 CAGGGAAGACAGCAAGACAAAGG + Intergenic
940156386 2:150661245-150661267 CTCAGAAGACAGGAAGATGAGGG + Intergenic
940402130 2:153259875-153259897 CAGGAAGGAAAGAAAGAAGAAGG - Intergenic
940582994 2:155604900-155604922 CAGGGAAGACTAAAAAATAAAGG - Intergenic
940629634 2:156221414-156221436 AAGGGAAGCCAGAGAGAAGAAGG + Intergenic
940704481 2:157086824-157086846 GAATGAAGACACAAAGATGAAGG + Intergenic
940728034 2:157357727-157357749 CAGGGAAGAAAGAGAGCTGGTGG - Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941501637 2:166285769-166285791 CAGGGAGGCCTGAGAGATGAAGG + Intronic
941684610 2:168435805-168435827 TAGGGAAAACAGTAAGATCAAGG - Intergenic
941900430 2:170672739-170672761 CAGGGAAGCTAGAGAGAAGAGGG - Intergenic
942234225 2:173888824-173888846 CTCAGAAGACAGAAAGATGTGGG + Intergenic
942365620 2:175223187-175223209 AAGGAAAGAGAGAAAGAGGAAGG - Intergenic
943183484 2:184575016-184575038 CAGGAAAGAAAGAAAGAAGGAGG + Intergenic
943481595 2:188426853-188426875 AGAAGAAGACAGAAAGATGAGGG + Intronic
943828019 2:192420804-192420826 CAGGCAAGACAGAGTGAAGATGG - Intergenic
943889478 2:193268577-193268599 AAAAGAAGACAGGAAGATGAGGG - Intergenic
943935703 2:193913469-193913491 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
944160940 2:196658858-196658880 GAGGTAAGACAAAAAGATGGAGG + Exonic
944938047 2:204590179-204590201 CTGTGAGGACAGAGAGATGATGG - Intronic
945084821 2:206120358-206120380 CTCAGAAGACAGAAAGATGAGGG + Intronic
945410343 2:209499424-209499446 AGAAGAAGACAGAAAGATGAGGG - Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946047541 2:216833617-216833639 GAAAGAGGACAGAAAGATGAGGG + Intergenic
946087202 2:217186031-217186053 GAAGGAAGACAGAAACGTGAGGG + Intergenic
946190142 2:218003635-218003657 CAGGAAAGAAAGAAAGAAGGGGG - Intergenic
946373476 2:219294655-219294677 GAGGGGAGACAGAAAGCAGAGGG + Intronic
946389462 2:219406747-219406769 GTGAGAAGACAGAAGGATGATGG + Intergenic
946483240 2:220076379-220076401 TATGGAAGACAGAAAAATCAAGG + Intergenic
946748475 2:222869337-222869359 CAGGGGAGCCAGAGAGATGAAGG - Intronic
946874413 2:224113616-224113638 AAAAGAAGACAGGAAGATGAGGG + Intergenic
946906972 2:224426841-224426863 CAGGAAAGAGAGAAAGAGAAGGG - Intergenic
947202345 2:227625549-227625571 AAGGGAAGCCAGAAAGATCGTGG - Intronic
947443073 2:230140328-230140350 CTCAGAAGACAGGAAGATGAGGG + Intergenic
947745477 2:232505078-232505100 AAGGGAAGGCAGAACCATGATGG + Intergenic
947820016 2:233063050-233063072 CAGGGAACACAGAAAACTAAGGG - Intronic
948209733 2:236183971-236183993 CAAAGAAGACAGGAAGATGAGGG + Intergenic
948362391 2:237432307-237432329 CTGGGAGGCCGGAAAGATGAGGG - Intergenic
948447177 2:238041987-238042009 TAGAGCAGACAGAAAGATGTTGG + Exonic
948558404 2:238834131-238834153 CAGGGAAGATGGATAGATGGCGG - Intergenic
948960871 2:241335805-241335827 CAGAGAAGTCAGAAAGGGGAAGG - Intronic
1168848000 20:958615-958637 CAGGGAAGTCAGAGAGAGGGTGG + Exonic
1169505771 20:6209428-6209450 GAGGGAGGAAAGAAAGAGGAAGG - Intergenic
1169757752 20:9061674-9061696 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1170043830 20:12065359-12065381 CAGAGACTACAGAGAGATGATGG - Intergenic
1170293313 20:14795335-14795357 TAGGGAAGAGATAAAGATGGTGG + Intronic
1170330347 20:15202811-15202833 CAGTGTAGACAGAAAGAAAAAGG + Intronic
1170372056 20:15659829-15659851 CAGGGGAAACAGACATATGAGGG + Intronic
1170506217 20:17028256-17028278 TAGGGAAGACAGAGAGAAGTTGG + Intergenic
1170951410 20:20939663-20939685 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
1171039187 20:21743976-21743998 CAGGGTAGAAAGAAAAAAGATGG - Intergenic
1172943359 20:38669775-38669797 AAGGGAAGAAAGAAAGAAAAAGG + Intergenic
1173069535 20:39749182-39749204 AAGAGAAAATAGAAAGATGAAGG - Intergenic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173304586 20:41836131-41836153 CAGGACACAGAGAAAGATGAAGG - Intergenic
1173716530 20:45211720-45211742 GAAGGAAGAAAGAAAGAGGAAGG + Intergenic
1174280333 20:49434524-49434546 CAGGGAGCCCAGGAAGATGATGG - Intronic
1174729367 20:52900317-52900339 TAGTGAAGACAGAAAGAGGCAGG - Intergenic
1174983912 20:55428201-55428223 GAGGGGAGACAGGAAGAGGAAGG + Intergenic
1175136443 20:56827835-56827857 CATGGAAGACAGAAAGGCAACGG - Intergenic
1175153139 20:56951006-56951028 AAGGGGAGAAAGAAAGAAGAAGG + Intergenic
1175229695 20:57465890-57465912 CATGGAAGCCACAAAGATGCAGG - Intergenic
1175507970 20:59499793-59499815 AAGGGAAGACAGAGAGAACAAGG + Intergenic
1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG + Intergenic
1175978431 20:62725264-62725286 CAGGGAGGCCAGAATGATGCTGG - Intronic
1176296673 21:5076770-5076792 CAGAGACCACAGAAAGCTGAGGG + Intergenic
1176842824 21:13854291-13854313 GGAAGAAGACAGAAAGATGAGGG - Intergenic
1176847804 21:13890021-13890043 GAAAGAAGACAGAGAGATGAAGG - Intergenic
1176848248 21:13893189-13893211 GGAAGAAGACAGAAAGATGAGGG - Intergenic
1176849178 21:13899780-13899802 GAAAGAAGACAGAGAGATGAAGG - Intergenic
1177536213 21:22431557-22431579 CTGGGGAGAGAGAGAGATGAGGG - Intergenic
1178261965 21:31107850-31107872 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1178479421 21:32966835-32966857 GCTGGAAGACAGAAAGATGTGGG + Intergenic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1179087830 21:38236130-38236152 CAGGTAAGACAGAAAACAGAGGG - Intronic
1179465029 21:41566348-41566370 GAGGGAAGACAGCACGATGGGGG + Intergenic
1179860376 21:44185351-44185373 CAGAGACCACAGAAAGCTGAGGG - Intergenic
1180511585 22:16096018-16096040 AAAGAAAGAAAGAAAGATGAAGG + Intergenic
1181135201 22:20760748-20760770 CTGGGAAGACAGAGAAATGGTGG - Intronic
1181294818 22:21828474-21828496 CCGGGAAAACACAAAGGTGAGGG + Intronic
1181448730 22:23001381-23001403 AAAGGAAGACAGAAAGGTGAGGG - Intergenic
1181896504 22:26112886-26112908 AGAAGAAGACAGAAAGATGAGGG - Intergenic
1182420167 22:30245150-30245172 CTGGGATGACGTAAAGATGAGGG + Intronic
1182957404 22:34439525-34439547 CAGGGTAGAGAGAAAAATGTGGG - Intergenic
1183151315 22:36039930-36039952 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1183197164 22:36361387-36361409 CAGGAAACAATGAAAGATGATGG + Intronic
1183290684 22:36999998-37000020 CAGGGATGACAGACAGGGGATGG + Intronic
1183292571 22:37011903-37011925 AAGGCCACACAGAAAGATGAAGG + Intronic
1183889600 22:40915698-40915720 CAGAATAGCCAGAAAGATGAAGG + Intronic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184351708 22:43948567-43948589 TAGGGAAGACAGAGAGAGGTTGG - Intronic
1184631931 22:45788462-45788484 CAGTGGGGACAGAAAGATGCAGG - Intronic
1184846208 22:47089063-47089085 CAGAGAAGCAAGAAAGAGGAGGG + Intronic
1184989899 22:48160282-48160304 GAGGGAGGAGAGAAAGAAGAAGG + Intergenic
949229375 3:1732439-1732461 AAGGGAAAACAGGAAGATGGAGG - Intergenic
950044839 3:9943051-9943073 GAGAGAGGAGAGAAAGATGAGGG - Intronic
950153299 3:10704834-10704856 CAGGGGAGATACAAAGAAGATGG + Intronic
951064933 3:18252794-18252816 CAGGAAAGAAAGAAATGTGAAGG + Intronic
951449454 3:22819930-22819952 AGAAGAAGACAGAAAGATGAGGG - Intergenic
951680234 3:25286997-25287019 TAGTAAAGACACAAAGATGAAGG + Intronic
951873483 3:27393844-27393866 GATGGAAGACAGAATGAGGATGG + Intronic
951922484 3:27871681-27871703 CTGGGAAGACACAGGGATGAGGG + Intergenic
952183695 3:30945576-30945598 CAGGGAAGAAACAAACTTGAGGG - Intergenic
952202421 3:31144828-31144850 CAGGGAAAACAGAACTAAGAGGG - Intergenic
952221496 3:31328111-31328133 CTCGGAAAACAGGAAGATGAGGG - Intergenic
952369249 3:32703870-32703892 CAGGGAGCAGAGAAACATGAAGG + Exonic
952429558 3:33209597-33209619 GAAGGAAGAGAGAAAGAGGAAGG - Intronic
952808087 3:37376061-37376083 CTCAGAAGACAGAAAGATGAGGG - Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
953032505 3:39187722-39187744 CAGGAACGACAGAAAGAAGAAGG - Exonic
953386892 3:42511739-42511761 CAGGCAAGACAGACCAATGATGG + Intronic
953545542 3:43861520-43861542 CTGGGAACACAGTAAGAGGAAGG + Intergenic
953788462 3:45928879-45928901 CACGGGGGATAGAAAGATGAAGG - Intronic
954285667 3:49617381-49617403 CAGGAAGGGCAGAGAGATGAAGG - Intronic
954484715 3:50837082-50837104 CTCAGAAGACAGAAAGATGTGGG - Intronic
954560958 3:51556191-51556213 AAAGGAGGACAGAAAGAAGAAGG - Intronic
954856977 3:53652523-53652545 TAGGGAAAAGAGAAAGATCAGGG + Intronic
955592823 3:60556298-60556320 CAGAGGAGACAGAAAGGTAAAGG + Intronic
955868407 3:63410576-63410598 CAAGGCAGACACAAACATGAGGG - Intronic
956080199 3:65549290-65549312 GAGGGAAGACGGAAAGAGGGAGG - Intronic
956282982 3:67578525-67578547 CAGGGAAGCCAGAAAGAGAGGGG + Intronic
956471625 3:69573150-69573172 CAGTGAAGATAGAGAGAAGAGGG + Intergenic
956621005 3:71221494-71221516 AAGGGAGGGCAGAAGGATGAAGG - Intronic
956956880 3:74351510-74351532 CATGGAAATCAGAAAGATGTGGG - Intronic
957145395 3:76416780-76416802 GAGGCAAGAAAGAAAGTTGACGG - Intronic
957262172 3:77916542-77916564 CAGGGAGGAGGGAAAGACGATGG - Intergenic
957784326 3:84861816-84861838 CAGGAAAGGCATAAAGATAATGG + Intergenic
958005960 3:87812235-87812257 CTCAGAAGACAGGAAGATGAGGG + Intergenic
958057076 3:88427045-88427067 CTCAGAAGACAGAAAGATGTGGG + Intergenic
958128298 3:89385807-89385829 CTTAGAAGACAGAAAGATGTGGG + Intronic
958466598 3:94467528-94467550 CAGGATAGAAAGAAGGATGAAGG + Intergenic
958523547 3:95223169-95223191 CAGAGAAGAGAGAAAAATAAAGG - Intergenic
958869188 3:99537233-99537255 CAAAGAAGACAGAAAGTGGAGGG - Intergenic
959149380 3:102590477-102590499 AGAAGAAGACAGAAAGATGAAGG + Intergenic
959675526 3:109031096-109031118 CAGGGACAACAGTAAGTTGAAGG + Intronic
959756598 3:109906748-109906770 AAAAGAAGACAGAAAGATGTGGG - Intergenic
959862167 3:111228909-111228931 AGAGGAAGACAGGAAGATGAGGG + Intronic
959962898 3:112320749-112320771 CAGGAAAGAAAGAAAGAAGAAGG + Intergenic
959998599 3:112706017-112706039 CAGGCAAGAGAGAAAAATAAAGG - Intergenic
960440864 3:117686578-117686600 CAGTAAATACAGAAAGATAAGGG + Intergenic
960569611 3:119172945-119172967 CAGGGAAGAAGGAAAAAAGAAGG + Intronic
960724829 3:120659605-120659627 CTCAGAAGACAGGAAGATGAGGG - Intronic
960794202 3:121467393-121467415 CACCGTAGACAGAAAGATGGAGG + Intronic
960933711 3:122881523-122881545 GAGGGAAGAGAGAAAGGAGAGGG + Intergenic
961303345 3:125936586-125936608 CATGCAAGACAGAGAGGTGAGGG + Intronic
961601672 3:128067045-128067067 CAGGGCAGACTGCAGGATGATGG - Exonic
961664255 3:128486392-128486414 CAGGGTGGGCAGAAAGATCAGGG + Intronic
961943371 3:130659879-130659901 GAGGGAAGACAGAAAGAAGAGGG - Intronic
962320788 3:134388775-134388797 AAGGGAAGAAAGGAAGAAGATGG + Intergenic
962580492 3:136793270-136793292 CTGGGCAAACAGAAAAATGATGG + Intergenic
962641226 3:137388836-137388858 AAAAGAAGACAGAAAGAGGAAGG - Intergenic
962931482 3:140041624-140041646 CATGGAAGCCAGAGAGATGGAGG - Intronic
963025559 3:140915473-140915495 CAGGGAAGAAAGAAAAGTGAAGG - Intergenic
963230364 3:142903570-142903592 GAGGGAAGAGAGATAAATGAGGG - Intergenic
963253997 3:143126528-143126550 TAGGGAAGAAAGAAAGTTGGAGG - Intergenic
963625876 3:147671694-147671716 CAGAGATGAAAGAAATATGATGG - Intergenic
963931080 3:151004877-151004899 AAGAAAAGACAGAAAGAAGAGGG - Intergenic
964241740 3:154602176-154602198 AAAAGAAGACAGGAAGATGAGGG - Intergenic
964506114 3:157401529-157401551 CAGGTTAGACAGAAAGATTTGGG + Intronic
964897119 3:161612078-161612100 CTCAGAAGACAGAAAGATGTGGG + Intergenic
964919949 3:161884436-161884458 CACAGAAGACAGGAAGATGAGGG + Intergenic
965057929 3:163745527-163745549 AAAAGAAGACAGAAAAATGAGGG - Intergenic
965341974 3:167502463-167502485 CTCAGAAGACAGGAAGATGAGGG + Intronic
965394943 3:168152021-168152043 CTCAGAAGACAGAAAGATGAGGG + Intergenic
965448746 3:168809947-168809969 CTGTGAAGACAGAAAGGGGAAGG - Intergenic
965647206 3:170896821-170896843 CTCAGAAGAAAGAAAGATGAGGG + Intronic
965910788 3:173772788-173772810 CAGTGAATACAGAAAAAGGATGG - Intronic
966142238 3:176769571-176769593 AAAGGAAGAAAGAAAGAAGAGGG + Intergenic
966203722 3:177384142-177384164 CAGGGATGAGAGCTAGATGAAGG - Intergenic
966241431 3:177758750-177758772 CTGAGAAAACAGGAAGATGATGG - Intergenic
966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG + Intergenic
966567039 3:181395364-181395386 CAGGGAAGAGAAAAAGAATAAGG - Intergenic
966733736 3:183172275-183172297 CAGAGAAGACCTAAAGTTGAAGG - Intergenic
967330105 3:188281713-188281735 CTTGGAAGAAAGAAAGATGGGGG - Intronic
967349727 3:188500090-188500112 CAGGGAAGAAAAAAAAATAAAGG - Intronic
967937061 3:194737539-194737561 CACAGAAGAGAGGAAGATGAAGG - Intergenic
967957414 3:194887919-194887941 CTTGGAAGACAGGAAGATGTGGG - Intergenic
967986925 3:195102024-195102046 AAAGGAAGAGAGAAAGAGGAAGG + Intronic
968135190 3:196215611-196215633 CAGGTCAGACAGAAAGCTGTGGG - Intronic
968351006 3:198051868-198051890 CTTTGAAGACAGGAAGATGAGGG - Intergenic
968810743 4:2798702-2798724 CAGGGCAGAGGGGAAGATGACGG + Intronic
969481826 4:7450443-7450465 CTGAGCAGACACAAAGATGATGG - Intronic
969686258 4:8675982-8676004 CAGGGGAGACAGAGAGGTGGGGG + Intergenic
969895824 4:10303563-10303585 CAGGGAACCCAGGTAGATGAGGG - Intergenic
970044853 4:11840577-11840599 CAGGGAAGAAAGAGAGGGGAAGG - Intergenic
970150371 4:13082879-13082901 CACAGAAGACAGCAAGATGTGGG - Intergenic
970165509 4:13232858-13232880 GAGGGAAGAAAGAAAGAAAAAGG + Intergenic
970477596 4:16439453-16439475 CTGGGAAGACAGAAAGCAGGAGG - Intergenic
970665788 4:18334530-18334552 AGAAGAAGACAGAAAGATGAAGG + Intergenic
971219779 4:24694221-24694243 CAGGAGAGAGAGAGAGATGAAGG + Intergenic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
971361729 4:25944273-25944295 CAGGTAGGAAAGAAAGATCAGGG + Intergenic
971688243 4:29799165-29799187 TAGGGAAGTTAGAAAGATGTGGG - Intergenic
971795191 4:31217801-31217823 CAGGAAAGACAGAAAGAAAGAGG + Intergenic
971856855 4:32055041-32055063 AGAAGAAGACAGAAAGATGAGGG - Intergenic
972054503 4:34782041-34782063 AAAGGAAGACAGGAAGATGTGGG - Intergenic
972314454 4:37912990-37913012 GAGGGATGAGAGACAGATGAGGG + Intronic
972923796 4:43977274-43977296 CAGGAAAGAAAAAAAAATGAAGG + Intergenic
973010669 4:45069009-45069031 AGAGGAAGACAGGAAGATGAGGG + Intergenic
973304697 4:48632856-48632878 CAGGGCAGGAAGAAAGTTGAAGG - Intronic
973368113 4:49224087-49224109 GGAAGAAGACAGAAAGATGAGGG - Intergenic
973614135 4:52662244-52662266 AGAAGAAGACAGAAAGATGAGGG + Intergenic
973835587 4:54806233-54806255 AAGGAAAGAAAGAAAGAAGAAGG + Intergenic
973835612 4:54806375-54806397 AAGGAAAGAAAGAAAGAAGAAGG + Intergenic
974435809 4:61856346-61856368 AAGGGAAGAAGGAAAGAAGAAGG - Intronic
974457316 4:62144933-62144955 CTCAGAAGACAGGAAGATGAAGG + Intergenic
974820020 4:67054721-67054743 CAGGGAAGAGAGTATGATAAAGG - Intergenic
975204148 4:71624764-71624786 CTCAGAAGACAGAAAGATGTGGG - Intergenic
975456895 4:74601962-74601984 CAAGCAAGACAGAATCATGAAGG - Intergenic
975543831 4:75541567-75541589 CATGAAAGAAAGAGAGATGAAGG + Intronic
976382318 4:84413666-84413688 CTGGGAAGACAGCATGAAGAGGG + Intergenic
976947298 4:90786143-90786165 CTGGGCAGATAGAAAGACGATGG + Intronic
977377798 4:96229359-96229381 CAGGGAAGGGAGAAAAATGGGGG + Intergenic
977707474 4:100087465-100087487 CTCAGAAGACAGGAAGATGAAGG - Intergenic
977925158 4:102692315-102692337 TAGGGAAAGAAGAAAGATGAGGG + Intronic
978394020 4:108258648-108258670 CAGGGAAAAGAGGAACATGATGG + Intergenic
978845218 4:113265449-113265471 GAGGGAAGGCAAACAGATGAAGG - Intronic
979075893 4:116269818-116269840 CAGGGAAGAGTGAAAGGTCATGG - Intergenic
979211855 4:118114240-118114262 TAGGGAAAACTGAAGGATGAAGG - Intronic
979384063 4:120042865-120042887 CAGAAAAAACAGAAAAATGAAGG - Intergenic
979418670 4:120476302-120476324 GAAGGAAGACAGATAGAAGAAGG + Intergenic
979775305 4:124582566-124582588 AGAGGAAGACAGGAAGATGAGGG - Intergenic
979853200 4:125599268-125599290 CAGGGCTGACAGAAAAATGTTGG + Intergenic
980090932 4:128442276-128442298 CTCAGAAGACAGGAAGATGAGGG - Intergenic
980389956 4:132131688-132131710 CAGTGAGGATAGAAAGAAGATGG + Intergenic
980448734 4:132944239-132944261 AGAGGCAGACAGAAAGATGAGGG - Intergenic
981064590 4:140469578-140469600 GGGGGAAGAAAGAAAAATGACGG - Intronic
981154730 4:141421203-141421225 CAGGAAGGAAAGAAAGAAGAAGG - Intergenic
981453083 4:144921324-144921346 CACAGAAGACAGGAAGATGAGGG - Intergenic
981503198 4:145474253-145474275 CACAGAAGACAGGAAGATGTGGG - Intergenic
981831896 4:149011359-149011381 CAGAACAGACAGAAAGAAGAAGG + Intergenic
982154994 4:152510518-152510540 AAGGGAGGAGAGAAAGAGGAGGG + Intronic
982210288 4:153029258-153029280 CTCAGAAGACAGGAAGATGAGGG - Intergenic
982920538 4:161268202-161268224 CAGGGAAGACAGGAAAATGTGGG - Intergenic
983034545 4:162847478-162847500 CAGTGAAGACAGATAGTAGAAGG + Intergenic
983089618 4:163488058-163488080 AGAAGAAGACAGAAAGATGAGGG - Intergenic
983766270 4:171488779-171488801 CTCAGAAGACAGAAAGATGTGGG + Intergenic
983847319 4:172536360-172536382 CTCAGAAGACAGAAAGATGTGGG + Intronic
984562784 4:181290737-181290759 CAAGGAAGAAAAAAAGATGAAGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985277688 4:188254476-188254498 ATGGGATGACAGAAAGATTAGGG - Intergenic
985386298 4:189451605-189451627 AAAAGAAGACAGGAAGATGAGGG + Intergenic
985394215 4:189524987-189525009 CTCAGAAGACAGGAAGATGAGGG + Intergenic
985809449 5:2072320-2072342 AAAAGAAGACAGGAAGATGAGGG + Intergenic
985988915 5:3539068-3539090 CAAGGAAGACAGGAAGAAGATGG + Intergenic
986085244 5:4438274-4438296 CAGGGAAGAAAAGAAGAAGAAGG + Intergenic
986127789 5:4899432-4899454 CAGGGAAGTCAGAAGGACCAGGG - Intergenic
986205646 5:5622772-5622794 AGAAGAAGACAGAAAGATGAGGG + Intergenic
986507873 5:8471441-8471463 CTCAGAAGACAGAAAGATGTGGG - Intergenic
986867430 5:12006460-12006482 GAAGGAAGACAGAAAGAGAAAGG - Intergenic
987389568 5:17363317-17363339 CAGGAAAGCCTGAAAAATGAAGG - Intergenic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987432255 5:17849217-17849239 AAGGAAAGACAGAAAGAAAAAGG - Intergenic
987515745 5:18905829-18905851 CAGTAAAGACTGAGAGATGAGGG + Intergenic
987562479 5:19541291-19541313 CTCGGAAGACAGGAAGATGTGGG - Intronic
987610581 5:20198250-20198272 AAGAAAAGACAGAAAGATGTGGG + Intronic
987687393 5:21223047-21223069 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
987689149 5:21244623-21244645 AGGGGAAGACAGGAAGATGAGGG + Intergenic
989744160 5:44808346-44808368 TGGGGAAGACAGAAAGAAAAGGG - Intergenic
989975156 5:50576863-50576885 CAGGGAGGACAGATGGATAAAGG + Intergenic
990135244 5:52636986-52637008 CATGGAAGATAAAAAAATGAGGG + Intergenic
990794430 5:59524227-59524249 CTCAGAAGACAGAAAGATGTGGG + Intronic
990855387 5:60261055-60261077 ATGGGAAGACATAAAAATGAAGG + Intronic
991558560 5:67923866-67923888 CAGAGAAGTCAGGAAGATCATGG + Intergenic
992083804 5:73259971-73259993 TAGGGAAGCCAGTAAGCTGAGGG + Intergenic
992735377 5:79714026-79714048 TAGGAAAGACAGAATGATGGTGG + Intronic
993036871 5:82768629-82768651 CGAAGAAGACAGAAAGATGTGGG + Intergenic
993198623 5:84782887-84782909 CTCAGAAGATAGAAAGATGAGGG - Intergenic
993387623 5:87278869-87278891 CAGGGAATAAGGAAAGAGGAAGG - Intronic
993613232 5:90079940-90079962 CAAGAATGAAAGAAAGATGATGG - Intergenic
993628512 5:90255147-90255169 TAGGGAAGAAAGAAAGCAGAAGG - Intergenic
993743395 5:91566057-91566079 CAAAGAAGACAGAAATATGTGGG - Intergenic
993781051 5:92065791-92065813 CTCAGAAGACAGAAAGATGAGGG + Intergenic
993835303 5:92812503-92812525 CAGAGAAGAAAGAAAGATAAAGG + Intergenic
993946684 5:94123794-94123816 AAAAGAAGACAGAAAGATGAGGG - Intergenic
994633664 5:102318041-102318063 CAGGAAGGAAAGAAAGAAGAAGG - Intergenic
994902786 5:105797763-105797785 AGAAGAAGACAGAAAGATGAGGG + Intergenic
994992407 5:107014065-107014087 TAAGGAAGAGAGAGAGATGAAGG + Intergenic
995132662 5:108646914-108646936 AAAGGAAGACAGGAAGATGAGGG + Intergenic
995487194 5:112651248-112651270 AGGGGAAGAGAGAAAGAGGACGG - Intergenic
995816112 5:116169995-116170017 CAGGGAAGAGAAAAAAATAAAGG + Intronic
996547903 5:124700101-124700123 CAGAGAACAAAGAAAAATGAAGG - Intronic
996637047 5:125704702-125704724 GAGAGAAGACAGAAAGATAGAGG + Intergenic
996829265 5:127721522-127721544 AGAAGAAGACAGAAAGATGAGGG - Intergenic
996988243 5:129594829-129594851 AAAGTAGGACAGAAAGATGAAGG - Intronic
997170635 5:131716189-131716211 TATGGAAGACAGAAGGAAGAAGG + Intronic
997191647 5:131942590-131942612 GAGGAAAAACAGAAAGCTGAGGG + Intronic
998278484 5:140782042-140782064 CAGAAAAGACAGGAAGATGAGGG + Intergenic
998537732 5:142950216-142950238 CAGGACAGGCAGAAAGCTGAAGG + Intronic
998686413 5:144532016-144532038 CAGGCAAGAGAGAAATGTGAAGG - Intergenic
998856179 5:146397438-146397460 CTGGAAAGACACAAAGATGACGG - Intergenic
999758004 5:154679663-154679685 CAGAGAAGACAGACAGATGGTGG - Intergenic
999779757 5:154839801-154839823 CAGGGATGACAGAGTGATGGAGG - Intronic
1000620609 5:163481663-163481685 TAAGGAAGAGAGAATGATGAAGG - Intronic
1001013399 5:168118771-168118793 AAGAGAAGACAGAAAGACAAAGG - Intronic
1001041910 5:168342243-168342265 GAGGGAAAACATAAAGATCAGGG + Intronic
1001120069 5:168972707-168972729 TAGAGAAGACAGCAAGAGGAAGG - Intronic
1001232932 5:170005259-170005281 CAGGGCAGACAGAAAAATCTGGG + Intronic
1001241917 5:170077774-170077796 CATGGAAGCCAGAGAGATGATGG - Exonic
1001632206 5:173183757-173183779 CCCAGAAGAGAGAAAGATGAAGG - Intergenic
1001760251 5:174202231-174202253 CAGGCAAGACAAAAAAATAAGGG - Intronic
1001810434 5:174623486-174623508 CAGGGAAGGATGAAAGAGGAAGG - Intergenic
1002372912 5:178769031-178769053 GAGGAAACACAGAGAGATGAGGG - Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003557650 6:7155200-7155222 CAGGGCAGGCAGATGGATGATGG - Intronic
1004167196 6:13267138-13267160 CAGAGAAGACTGGAAGAGGATGG - Exonic
1004171369 6:13297830-13297852 AAGGGCAGTCAGAAAGATGATGG + Intronic
1004725648 6:18308917-18308939 AAGGGAAGAGAGAGAGAGGAAGG - Intergenic
1004754871 6:18600609-18600631 CCAGGAAGAAAGACAGATGATGG - Intergenic
1005210488 6:23454899-23454921 TAGGGAAGACACAGAGATAAGGG + Intergenic
1005365787 6:25075516-25075538 GAGGGAAGAGAGGAAGATGGAGG + Intergenic
1005368129 6:25100233-25100255 CAGAGAAGTCAGATAGATGGTGG + Intergenic
1005394998 6:25372728-25372750 CAGGCAAGAGAGAAAAATAAAGG - Intronic
1005450070 6:25963494-25963516 TAGGGAAGGCAGAAAGAAGATGG - Intronic
1005478795 6:26234927-26234949 CTGGGAAGACAAAAACATGTCGG - Exonic
1005673342 6:28129109-28129131 AAGGGAAGACGGATAAATGAGGG - Intronic
1006180633 6:32151643-32151665 AGGGGGAGACAGAAAGAGGAGGG + Intronic
1006244026 6:32714177-32714199 CAGAGAAAACAAAAAGATAATGG - Intergenic
1006375592 6:33670072-33670094 GAGGGACGTCTGAAAGATGAGGG - Intronic
1006767331 6:36519406-36519428 CAGGGGAGACAGGCAGATGAAGG - Intronic
1007039379 6:38707603-38707625 GAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1007251422 6:40497745-40497767 TGGGGAAGACAGGAAGGTGAGGG - Intronic
1007387232 6:41528195-41528217 CAGGGAAGCCAGGGAAATGAAGG - Intergenic
1007797515 6:44362116-44362138 CCAGGAAGACAGAAAAGTGAAGG + Intronic
1007814601 6:44512443-44512465 CAGAAAAGACAGAATGAAGAAGG + Intergenic
1008713224 6:54255137-54255159 CAGGGAAGACAGAGAGACAGGGG - Intronic
1008748080 6:54697710-54697732 CAATGAAAACAGAATGATGAGGG + Intergenic
1009287537 6:61839832-61839854 CAGGTAAGAAAGAAATATGAAGG + Intronic
1009488376 6:64254614-64254636 CAGGGAACAAAGCAAGAGGAAGG - Intronic
1009559420 6:65220744-65220766 AGAGGAAGACAGAAAGATGTGGG + Intronic
1010330844 6:74622751-74622773 CAGAGAAGGCAGGAAGATGTGGG + Intergenic
1010605866 6:77889236-77889258 CTGAGAAGACAGGAAGATGTGGG + Intronic
1010682373 6:78811732-78811754 CAGGGTTGGGAGAAAGATGAAGG - Intergenic
1010947860 6:81999184-81999206 GAGGGATGTCAGCAAGATGATGG + Intergenic
1011262393 6:85483143-85483165 TACGGAAGGCAGAAAGATAAAGG + Intronic
1011391748 6:86861484-86861506 CAGGAAAGAGAGAGAGATGAGGG + Intergenic
1011495215 6:87930679-87930701 AAGCTAAGACAGGAAGATGAAGG + Intergenic
1011544403 6:88468018-88468040 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1011757987 6:90525177-90525199 CAGAGAAAACAGAAAGTTAAAGG + Intronic
1011870371 6:91885599-91885621 CTCGGAAGACAGGAAGATGTGGG + Intergenic
1012097273 6:94978030-94978052 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012325611 6:97912477-97912499 TAGGGAAGAGAGAAATATGAGGG + Intergenic
1012514118 6:100038887-100038909 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1012652671 6:101776407-101776429 CAGAGAAGACAGACAAATAAGGG + Intronic
1012677778 6:102138553-102138575 CAAAGAAGACAGGAAGATGAGGG - Intergenic
1012751303 6:103167350-103167372 AAAAGAAGACAGAAAGATGTGGG + Intergenic
1012768220 6:103396634-103396656 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1012780170 6:103547536-103547558 CTTGGAAGACAGGAAGATGAGGG - Intergenic
1013087363 6:106867812-106867834 CATAGAAGACAGACAGATGAGGG - Intergenic
1013224702 6:108112421-108112443 GAGAGAAGGTAGAAAGATGAGGG + Intronic
1013273064 6:108560422-108560444 AAGGAAAGACAGAAAGAAGGGGG - Intronic
1013476511 6:110511974-110511996 CAGGGAAGAAAGCAAGATGTAGG - Intergenic
1014040871 6:116823520-116823542 CAAAGAAGACAGGAAGATGAAGG - Intronic
1014162063 6:118181470-118181492 GAGGGAAGACAATAAAATGAGGG + Intronic
1014525981 6:122502200-122502222 CTCAGAAGACAGAAAGATGAGGG - Intronic
1015336078 6:132040565-132040587 CAAGGAATAGAGAAACATGATGG - Intergenic
1015594088 6:134849642-134849664 GAGGGAGGAAAGAAAGAAGAAGG + Intergenic
1015917792 6:138235323-138235345 CAGGGAACACACAAAGATGCAGG - Intronic
1016778290 6:147930296-147930318 AGAAGAAGACAGAAAGATGAAGG - Intergenic
1016927144 6:149362061-149362083 TCAGGAAGACAGGAAGATGAGGG - Intronic
1017869936 6:158478754-158478776 CAAGGGAGAAAGAAAGGTGAAGG - Intronic
1018341885 6:162859543-162859565 CAGGGGAGAAAGGAAGATGAAGG - Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018681620 6:166270192-166270214 CAGGGAGGACAGGAGGATGGAGG + Intergenic
1019830779 7:3327249-3327271 TAGAGAAGACAGAAATTTGAGGG + Intronic
1020123675 7:5520248-5520270 AAGGAAAGAAAGATAGATGATGG - Intergenic
1020149863 7:5673541-5673563 CAGGGAAGAGAGCAAGTTGCAGG + Intronic
1020565373 7:9788139-9788161 CTTAGAAGACAGGAAGATGAGGG - Intergenic
1020784186 7:12554336-12554358 AAGAGAAGGCAGAAAAATGAAGG - Intergenic
1020814024 7:12882243-12882265 CAGGTATTACAGAAAGAAGAGGG + Intergenic
1021371962 7:19860396-19860418 AACGGAAGAAAGAAAGAGGAAGG + Intergenic
1021626545 7:22599082-22599104 CAGGCCAGACAGGAAGATGAGGG + Intronic
1021758734 7:23882314-23882336 CTTAGAAGACAGGAAGATGAGGG - Intergenic
1021840763 7:24719921-24719943 CAGGGAATACAGGATTATGATGG + Intronic
1022028493 7:26470024-26470046 AAAGGAAGAAAGAAAGAGGAAGG + Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022267707 7:28773683-28773705 CAGGGAAAGCAGAAAGATATGGG - Intronic
1022491473 7:30823423-30823445 CAAGGAAAAGAGAAAGAAGATGG - Intronic
1022908215 7:34876185-34876207 AAGGGAGGAGAGAAAGAAGAGGG + Intronic
1022932364 7:35131894-35131916 AAGGAAAGAGAGACAGATGATGG + Intergenic
1023030751 7:36088592-36088614 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1023139943 7:37091817-37091839 CAGGCAAGACAGAATGAGAACGG + Intronic
1023275582 7:38515724-38515746 AGAAGAAGACAGAAAGATGAGGG + Intronic
1023307439 7:38845641-38845663 CAGGTAAGACAGAAAACTAATGG + Intronic
1023413028 7:39906639-39906661 CATGGAAGACAAAAAGAACAAGG + Intergenic
1023557432 7:41437828-41437850 CAGGGGAGACAGCAAGATCCAGG - Intergenic
1023571602 7:41578191-41578213 CAACCAAGACAGACAGATGAGGG + Intergenic
1024015241 7:45307672-45307694 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1024566813 7:50688219-50688241 CTGGGAAAACTGAAAGATGTTGG - Intronic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1024799319 7:53057899-53057921 CAAGGAAGAAAGAAAGAGGGAGG - Intergenic
1024845372 7:53635922-53635944 AAGAGAAGACAGGAAGATGTGGG + Intergenic
1026077830 7:67189099-67189121 CAGGGTAGATAGAAAAAGGAAGG - Intronic
1026259705 7:68744447-68744469 CAAGCAACACAGAACGATGACGG - Intergenic
1026292403 7:69019519-69019541 GAAAGAAGACAGGAAGATGAGGG - Intergenic
1026509341 7:71015562-71015584 AAAGGAAGACAGGAGGATGAAGG + Intergenic
1026699025 7:72623018-72623040 CAGGGTAGATAGAAAAAGGAAGG + Intronic
1026967453 7:74449263-74449285 AAGGAAAGAAAGAAAGAAGAGGG - Intergenic
1027155211 7:75762464-75762486 CAGGGAAGAGACAAAAGTGAAGG - Intergenic
1027157164 7:75776597-75776619 CAAGAAAGAAAGAAAGAAGAAGG + Intronic
1027787272 7:82596010-82596032 CAGGAAAGACAGAAGAGTGAAGG - Intergenic
1027928448 7:84498813-84498835 CAGGGCAGAAAGTAAGAAGATGG - Intergenic
1027967225 7:85027653-85027675 CATGGAAGACAGGAAGAAGGAGG + Intronic
1028084141 7:86616238-86616260 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1028197057 7:87919787-87919809 CAAGGAAGACAGCAAAATTAGGG + Intergenic
1029238427 7:99142802-99142824 CAGGAAAGCAAGAGAGATGATGG + Intronic
1029316628 7:99721514-99721536 AAGGGAAGAAAAAAAGAAGAGGG + Intronic
1029552929 7:101247571-101247593 CAGGGGACACAGGAAGATGAAGG + Intronic
1029828289 7:103224689-103224711 AAGGAAAGAGAGACAGATGATGG + Intergenic
1030329083 7:108253854-108253876 CAGGGATGACAGAAGGTTGCTGG + Intronic
1030645689 7:112058873-112058895 AAGTGAAGGCAGAAAGAAGAAGG + Intronic
1030829236 7:114200462-114200484 CAGGAAACACTGAAAGAAGAAGG + Intronic
1031360761 7:120845791-120845813 CTCAGAAGACAGAAAGATGAGGG - Intronic
1031618079 7:123904480-123904502 CAGAGAAGACAGGAACATGATGG - Intergenic
1031637468 7:124119251-124119273 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1031741700 7:125440521-125440543 GAGGTAAAACAGAAATATGAGGG - Intergenic
1032502598 7:132411030-132411052 CATGGAATAAAGAAACATGAGGG + Intronic
1032634366 7:133690445-133690467 CAGGAAGGAGAGAAAGAAGAAGG - Intronic
1032688136 7:134256517-134256539 CAGGAATGATAGAAAGATGCTGG - Intronic
1032761314 7:134945999-134946021 GAGGGAAGACAGAAAGGTTCAGG - Intronic
1032858581 7:135857839-135857861 AAGAGAGGACAGAGAGATGATGG - Intergenic
1033031684 7:137833094-137833116 CAGAGAAGACAGGAAAATGTGGG - Intronic
1033131971 7:138752486-138752508 AACTGAAGACACAAAGATGAAGG + Intronic
1033805927 7:144954218-144954240 TTCAGAAGACAGAAAGATGAGGG - Intergenic
1033843420 7:145403009-145403031 AGAAGAAGACAGAAAGATGAGGG + Intergenic
1033873717 7:145788597-145788619 CAGGGAGCCAAGAAAGATGAAGG - Intergenic
1033983311 7:147192655-147192677 CAGGGAAGAAGGAAAGTAGAAGG - Intronic
1034403099 7:150879303-150879325 AAGGGAAGAAAGAAAAAAGAAGG + Intergenic
1034510829 7:151533262-151533284 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1034876232 7:154726986-154727008 CTCAGAAGACAGAGAGATGAGGG - Intronic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035522282 8:284473-284495 CAGCCCAGACAGAAGGATGAGGG - Intergenic
1035814612 8:2526125-2526147 CAGGGATCTCAGAAGGATGAAGG + Intergenic
1036618342 8:10405363-10405385 CAGCCAAGACAGCCAGATGAGGG + Intronic
1036926978 8:12916400-12916422 GAGGGAGGACAGAGAGAGGATGG - Intergenic
1037244359 8:16815231-16815253 CAGGCAAGACAGAGAGTTGGGGG + Intergenic
1037254709 8:16940872-16940894 GAGGGAACACAGCAAGATGGTGG + Intergenic
1037819650 8:22129513-22129535 GAGGGAGGACAGAAAGTGGAAGG + Intronic
1038278144 8:26139053-26139075 CAGGGAAGACAAGAAGAACATGG - Intergenic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038588480 8:28812885-28812907 TAAGGAAAACAGAAAGATGATGG + Intronic
1038880547 8:31606140-31606162 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1039778559 8:40761028-40761050 GAAGGAAGAAAGAAAGGTGAGGG + Intronic
1040894217 8:52349179-52349201 AAGGGAAGGGAGAAAGAAGAAGG - Intronic
1041124538 8:54621779-54621801 CAGGGAAGAGAGAAAGGGGTAGG - Intronic
1041397031 8:57401919-57401941 CAGGGGAGAATGAGAGATGAGGG + Intergenic
1041499583 8:58525933-58525955 CTGGAAAGTCAGAAAGGTGAGGG + Intergenic
1042072423 8:64950348-64950370 AGAAGAAGACAGAAAGATGAGGG - Intergenic
1042618435 8:70675846-70675868 CAGAGAAGAAGGGAAGATGAGGG - Intronic
1042635517 8:70869115-70869137 CATGGAAGACAGGAAAATGTGGG - Intergenic
1042886449 8:73557826-73557848 CAGGGACAAAAGATAGATGATGG - Intronic
1043085460 8:75826500-75826522 AGAAGAAGACAGAAAGATGAGGG + Intergenic
1043111297 8:76186399-76186421 CATGGCAGACAGAAAGGAGAAGG + Intergenic
1043199010 8:77339583-77339605 AAAAGAAGACAGGAAGATGAGGG + Intergenic
1043204858 8:77425481-77425503 AGGAGAAGACAGAAAGATGCAGG + Intergenic
1043587861 8:81790583-81790605 TAGGGAAGACAGAAAACTGTTGG - Intergenic
1043811903 8:84752019-84752041 AACAGAAGACAGGAAGATGAGGG + Intronic
1044789676 8:95834673-95834695 CAGAGAAGACAGAGAGAATATGG + Intergenic
1044945507 8:97385338-97385360 GGAAGAAGACAGAAAGATGAGGG - Intergenic
1045217603 8:100163688-100163710 CAGGGAAGAAAGGAAGCTAAAGG - Intronic
1045235307 8:100347456-100347478 CAGGGATGAATGAAAGATGAAGG + Intronic
1045444826 8:102249944-102249966 CAAGGAAGCTAGAAAGATGAAGG - Intergenic
1045683078 8:104683283-104683305 CAGAGAAGAAACAGAGATGAAGG + Intronic
1045949970 8:107840568-107840590 GAAGGGAGAGAGAAAGATGAGGG - Intergenic
1045993803 8:108339978-108340000 AAAAGAAGACAGAAAGATGTGGG - Intronic
1046215744 8:111143695-111143717 CAGTGAACAGAGAAAGATGTGGG + Intergenic
1046695639 8:117336249-117336271 CAGGGAAGGCAGCAAGAAGAAGG - Intergenic
1046741230 8:117831163-117831185 CACAGAAGTCAGAAAGATCAAGG + Intronic
1047071342 8:121347382-121347404 TAGGGGAGACTGAAAGAAGAGGG - Intergenic
1047151766 8:122272081-122272103 AAGGGAAGAAAGAAGGAAGAAGG - Intergenic
1047546685 8:125824889-125824911 CAGGGAAGTAAGAAAGCAGAGGG - Intergenic
1048096539 8:131301345-131301367 AGAAGAAGACAGAAAGATGAGGG - Intergenic
1048128570 8:131665465-131665487 ATTGGAAGACAGGAAGATGAAGG - Intergenic
1048245813 8:132797550-132797572 GAAGGAAGACAGAAAGTTGCAGG + Intronic
1048940449 8:139396077-139396099 CAGGGCAGACAGAGAGAAGACGG - Intergenic
1049370261 8:142261021-142261043 CAGGGAGGAGAGAAAGAGGAGGG + Intronic
1049696615 8:143987013-143987035 CAGGCAGGACAGAAAGCTGCAGG - Intronic
1049984997 9:942050-942072 CAGAGAATAAAGGAAGATGATGG - Intronic
1050305419 9:4300561-4300583 CAGGGAAGAGAGGAAGGTGATGG + Intronic
1050415069 9:5408202-5408224 AGAGGAAGACAGAAGGATGACGG + Intronic
1050584203 9:7093223-7093245 CAGGAAACACAGGAAAATGAAGG + Intergenic
1051492667 9:17683760-17683782 AAGGGAAGACCTAAAGCTGAGGG + Intronic
1051862264 9:21639424-21639446 CATGGAGGACAGAAAGAAGAAGG + Intergenic
1052004447 9:23329606-23329628 AAAAGAAGACAGGAAGATGAGGG + Intergenic
1052077649 9:24163099-24163121 CAGAAAAGAAAGAAAAATGATGG - Intergenic
1052167607 9:25352406-25352428 TAGGGAAAACAGAAATATAAGGG - Intergenic
1052179464 9:25506367-25506389 AGAAGAAGACAGAAAGATGAGGG - Intergenic
1052526776 9:29628959-29628981 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1055006219 9:71510475-71510497 CAGGAAAGACAGAAGAGTGAAGG + Intergenic
1055115130 9:72597774-72597796 CAGGGAAGACAGAGAACAGAGGG - Intronic
1055170660 9:73254272-73254294 CTCAGAAGACAGGAAGATGAAGG + Intergenic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1055520954 9:77080687-77080709 GTGGGAACACAGAAAGAAGATGG - Intergenic
1055735495 9:79324968-79324990 AAGGGAAGAAATTAAGATGAAGG - Intergenic
1056007474 9:82287439-82287461 TAGAGGAGACAGAAAAATGAAGG + Intergenic
1056648234 9:88433510-88433532 CTAGGAAGACATCAAGATGATGG + Intronic
1056918847 9:90768440-90768462 CATGGAAGACAGGAAGAGGCAGG + Intergenic
1057176274 9:93002672-93002694 CAGTGATGTCAGCAAGATGATGG - Intronic
1057239406 9:93395213-93395235 CTCAGAAGACAGGAAGATGAAGG - Intergenic
1057718780 9:97516285-97516307 CTGGGAACACAGAGAGATGTGGG + Intronic
1058222931 9:102325225-102325247 CGAGGAAGACAGGAAGATGTGGG + Intergenic
1058288452 9:103209099-103209121 CAGGGGAGACAGAGAGAAGGGGG + Intergenic
1058573224 9:106370833-106370855 TAAGGAAGACAGGAAGATGTGGG - Intergenic
1058941343 9:109815524-109815546 CAGGGTAGACAGAAACAGGGGGG + Intronic
1058983502 9:110191431-110191453 CAGGCAAGACAGCAAGTGGAGGG - Intronic
1059355317 9:113694726-113694748 CAGGAAAGACAGACAAAGGAAGG + Intergenic
1059677455 9:116553024-116553046 CAGGTAAGACAGAGAATTGAAGG + Intronic
1059895502 9:118859768-118859790 CAGGAAAGAGAAAAAAATGAAGG + Intergenic
1060045429 9:120336711-120336733 GTGGGGAGTCAGAAAGATGAGGG + Intergenic
1060165887 9:121414886-121414908 CATGGCAGTCAGAAAGGTGATGG - Intergenic
1060212242 9:121717759-121717781 AGGGGAAGAGAGAAAGAAGAGGG - Intronic
1060483264 9:124030311-124030333 CTGGGAAGACAGGCAGATGCAGG + Intronic
1061224817 9:129275176-129275198 AAAGGAAGAAAGAAAGATAAAGG - Intergenic
1061414025 9:130436232-130436254 AAGGGAAGACAGAAAGGTCAAGG + Intergenic
1061915326 9:133749168-133749190 CAGGGAGGAAAGATAGAAGAAGG - Intergenic
1185703462 X:2248907-2248929 GAGGGAAGACCCAAAGATGCAGG - Intronic
1185834169 X:3329441-3329463 GAGGGAAGGAAGGAAGATGAAGG + Intronic
1186130934 X:6464661-6464683 CAGGTAAGACAGAAAGGGGAGGG - Intergenic
1186206317 X:7204596-7204618 AAGGGAAGGAAGAAAGAAGATGG - Intergenic
1186265587 X:7830221-7830243 CAGGGAAAACACAAAACTGAGGG + Intergenic
1187428451 X:19200199-19200221 CAGGGTAGAGTGAGAGATGAGGG + Intergenic
1187866970 X:23731745-23731767 CAGGAAAGAGAGACAGAGGAGGG + Intronic
1188245479 X:27831758-27831780 CTGGGATCACAGAGAGATGAGGG + Intergenic
1188430088 X:30096840-30096862 AAAGAAAGAAAGAAAGATGAAGG + Intergenic
1188430152 X:30097291-30097313 AAGGAAAGAAAGAAAGAAGAAGG + Intergenic
1188457048 X:30379155-30379177 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1188657525 X:32716659-32716681 CTCAGAAGACAGGAAGATGAGGG + Intronic
1188662449 X:32776258-32776280 AGAAGAAGACAGAAAGATGAGGG - Intronic
1189206110 X:39240448-39240470 GAAGGAAGACAGAAGGAAGAGGG - Intergenic
1189590794 X:42508559-42508581 CAGGGAAAACAGAACCATGTTGG + Intergenic
1189649655 X:43175841-43175863 AAGGGAAAAGAGAAAGAAGAGGG + Intergenic
1189656719 X:43252164-43252186 CTCAGAAGACAGGAAGATGAGGG - Intergenic
1189788625 X:44582651-44582673 CACAGAAGACAGGAAGATGTGGG + Intergenic
1189977116 X:46472993-46473015 TATGTAAGAAAGAAAGATGATGG + Exonic
1189980078 X:46501071-46501093 TATGTAAGAAAGAAAGATGATGG - Exonic
1190123384 X:47682406-47682428 AAAGAAAGAAAGAAAGATGAAGG - Intergenic
1190950524 X:55139021-55139043 GAGAGAAGACAGAAAGATGTGGG + Intronic
1191112152 X:56812370-56812392 TAGGGAGGGCAGAAAGAGGAGGG - Intergenic
1191136772 X:57072666-57072688 CATGGAAAACAGAACGATCAAGG - Intergenic
1191159000 X:57307172-57307194 CAGAGAGAATAGAAAGATGAAGG - Intronic
1191211161 X:57886218-57886240 AGAAGAAGACAGAAAGATGAGGG - Intergenic
1191211544 X:57890134-57890156 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1191585646 X:62823730-62823752 CAGGGAAGTCAGGAAGAAGAAGG + Intergenic
1191633614 X:63351606-63351628 CCTGGAAGACAGAAAGCAGATGG - Intergenic
1191731212 X:64337624-64337646 CAGGGCAAAAAGAAAGATGAGGG + Intronic
1191735613 X:64385338-64385360 AGAGGAAGACAGGAAGATGAGGG - Intronic
1191873243 X:65768349-65768371 AATAGAAGACAGCAAGATGAGGG + Intergenic
1192810324 X:74541579-74541601 CAGGGAAGAGACAAAACTGAGGG + Intergenic
1192905918 X:75550142-75550164 CAGGCAAGACAAAGAAATGAAGG + Intergenic
1193008045 X:76643280-76643302 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1193066297 X:77264095-77264117 CAAAGAAGACAGGAAGATGTGGG + Intergenic
1193160323 X:78221277-78221299 CAGGCAAGAGAAAAAGATAAAGG - Intergenic
1193484295 X:82067412-82067434 CCAGCAAGAGAGAAAGATGAAGG + Intergenic
1193501172 X:82276549-82276571 AGGAGAAGACAGAAAGATGTGGG - Intergenic
1193612674 X:83651553-83651575 CAGGGAAGAGAAAGAAATGAAGG - Intergenic
1193678307 X:84484055-84484077 CTCAGAAGACAGAAAGATGTAGG - Intronic
1193741842 X:85226391-85226413 TAAGGAAGACAGAAGGATAATGG - Intergenic
1193919777 X:87410786-87410808 CTCAGAAAACAGAAAGATGAGGG - Intergenic
1193997078 X:88379410-88379432 AAGGAAAGAAAGAAAGAAGAAGG + Intergenic
1194054770 X:89117913-89117935 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1194084267 X:89506432-89506454 CTTAGAAGACAGAAAGATGTGGG - Intergenic
1194368886 X:93046394-93046416 AGAGGAAGACAGAAAGATGAGGG + Intergenic
1194850127 X:98859214-98859236 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1194881269 X:99254491-99254513 AGAAGAAGACAGAAAGATGAGGG - Intergenic
1194940947 X:100009472-100009494 TAGGGAAAATAAAAAGATGAGGG - Intergenic
1194969107 X:100323281-100323303 CAGTAAAGCCAGAAAGATCAGGG - Intronic
1195118437 X:101723776-101723798 GAGGGAGGACAGAAAGAAAAAGG - Intergenic
1195307612 X:103600714-103600736 CAGTGAAAATAAAAAGATGAAGG - Intergenic
1195650491 X:107278369-107278391 TTCAGAAGACAGAAAGATGAGGG + Intergenic
1196000248 X:110775800-110775822 CAGAGAAGACAGAAAAAGAAAGG - Intronic
1196022114 X:111001273-111001295 CACAGATGACAGAAACATGAAGG + Intronic
1196066749 X:111472254-111472276 AAAAGAAGACAGGAAGATGAGGG - Intergenic
1196282654 X:113840895-113840917 CAGGGAAGAAAGAAGCATAAGGG - Intergenic
1196288428 X:113910719-113910741 GAGAGAAGAGAGAGAGATGAAGG - Intergenic
1196416690 X:115478764-115478786 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1196543730 X:116938426-116938448 AAAGGAAGACAGAAAAATGTGGG - Intergenic
1197099230 X:122632365-122632387 CAGGCAAGAGAAAGAGATGAAGG - Intergenic
1197131653 X:123012258-123012280 CTGGAAAGACAGAAACATAAGGG + Intergenic
1197312855 X:124927584-124927606 GGGGGAAGAGAGAAAGATGCTGG + Intronic
1197561328 X:128025419-128025441 CAAAGAAGACAGAAAAATGTGGG - Intergenic
1197587197 X:128363504-128363526 AGAGGAAGACAGGAAGATGAGGG - Intergenic
1197634948 X:128904204-128904226 CAGGGAGGAAAGAAAAATGAGGG + Intergenic
1198276632 X:135100200-135100222 CAGAAATAACAGAAAGATGATGG + Intergenic
1198423857 X:136496277-136496299 CAGGGGAGACAGAATTAAGATGG - Intergenic
1198882788 X:141299247-141299269 CAGGGAACAATAAAAGATGAAGG - Intergenic
1199076008 X:143527451-143527473 CAGGAAGGAAAGAAAGAAGAAGG - Intergenic
1199083616 X:143605175-143605197 CTTGGAAGACAGGAAGATGTGGG + Intergenic
1199155125 X:144537557-144537579 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1199269440 X:145865460-145865482 CTGGGAAGAGAGAAAGAGGGAGG + Intergenic
1199330386 X:146551764-146551786 AAAAGAAGACAGAAAGATGAGGG - Intergenic
1199357076 X:146875099-146875121 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1199384479 X:147207899-147207921 AAAGGAAGACAGGAAGATGAAGG + Intergenic
1199423545 X:147675462-147675484 CTCAGAAGACAGGAAGATGAAGG + Intergenic
1200436906 Y:3162319-3162341 CTTAGAAGACAGAAAGATGTGGG - Intergenic
1200677089 Y:6162727-6162749 AGAGGAAGACAGAAAGATGAGGG + Intergenic
1201300171 Y:12498418-12498440 AAGGCAAGAGAGAAAGAGGAAGG - Intergenic
1201386325 Y:13443305-13443327 CAGGAATGACAGAAATATGCGGG - Intronic
1201459250 Y:14204020-14204042 CACTGAAGACCCAAAGATGAAGG - Intergenic
1201594282 Y:15650570-15650592 CAGGGCGAAAAGAAAGATGAAGG - Intergenic
1201613395 Y:15868354-15868376 CAGGTAAGACAGAAAGGGGAAGG - Intergenic
1201746292 Y:17377564-17377586 CAGGGAAGACAAAAAAAAAAAGG + Intergenic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic
1201946682 Y:19518030-19518052 CAGGCAAGACAAAAAAATAAAGG + Intergenic