ID: 952835199

View in Genome Browser
Species Human (GRCh38)
Location 3:37596421-37596443
Sequence CACCCTTTTCTCTCCTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952835199_952835201 1 Left 952835199 3:37596421-37596443 CCCTTGGAGGAGAGAAAAGGGTG 0: 1
1: 0
2: 1
3: 22
4: 293
Right 952835201 3:37596445-37596467 TCTTCCTCCAGCCCAGAGAAAGG 0: 1
1: 2
2: 2
3: 52
4: 604
952835199_952835207 16 Left 952835199 3:37596421-37596443 CCCTTGGAGGAGAGAAAAGGGTG 0: 1
1: 0
2: 1
3: 22
4: 293
Right 952835207 3:37596460-37596482 GAGAAAGGAGGAGACCAGACAGG 0: 1
1: 0
2: 4
3: 69
4: 622
952835199_952835202 4 Left 952835199 3:37596421-37596443 CCCTTGGAGGAGAGAAAAGGGTG 0: 1
1: 0
2: 1
3: 22
4: 293
Right 952835202 3:37596448-37596470 TCCTCCAGCCCAGAGAAAGGAGG 0: 1
1: 0
2: 2
3: 35
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952835199 Original CRISPR CACCCTTTTCTCTCCTCCAA GGG (reversed) Intronic