ID: 952837797

View in Genome Browser
Species Human (GRCh38)
Location 3:37619201-37619223
Sequence ATGCCTCTCCACTACTGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952837797 Original CRISPR ATGCCTCTCCACTACTGATA TGG Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
903541906 1:24101216-24101238 CTGCCTCTCCAGTAGTGATGTGG + Intronic
903973180 1:27132546-27132568 ATGCCTCTCCCCTCCTCACAGGG + Intronic
905014251 1:34766306-34766328 ATGCCTCTCCAGTACTTATCTGG + Intronic
916015789 1:160748826-160748848 TTTCCTCCCCACTACAGATATGG - Intronic
916229966 1:162531944-162531966 ATGATGATCCACTACTGATAAGG - Intergenic
917349053 1:174057840-174057862 ATGCCACTCCAATGCTGATTTGG + Intergenic
1069742624 10:70695256-70695278 CGGCCTCTCCTCTCCTGATAAGG - Intronic
1070361348 10:75692759-75692781 AGGCCTCTCTACTACAGCTAGGG - Intronic
1070403266 10:76072281-76072303 ATCCCTCTCCACCACTTAAAGGG + Intronic
1071457738 10:85863698-85863720 GGGCCTCTCCCCCACTGATAGGG - Intronic
1073074208 10:100813428-100813450 CGGCCTCTCCAATACTGATCTGG - Intronic
1073384367 10:103111069-103111091 ATGCCTCTCCACAGCTGCAAAGG + Intronic
1074209466 10:111316588-111316610 GTGCCTCTCCATTTATGATACGG + Intergenic
1076201679 10:128563918-128563940 ATGCCCCTCAACTTATGATAGGG + Intergenic
1080128334 11:28764411-28764433 AAGCCTCTCCAGTGCTTATATGG + Intergenic
1081638318 11:44735556-44735578 CTGCCTCTCCTCTTCTTATAGGG + Intronic
1085278249 11:75313744-75313766 ATCCCTCTGCATTACTGGTAAGG + Intronic
1093026433 12:14249594-14249616 CTGCCTCTCCACCTCGGATACGG + Intergenic
1093150356 12:15613468-15613490 ATCCCTCTTCACTCTTGATATGG - Intergenic
1100016827 12:90021351-90021373 ATGCCTCTTAGCTACTGAAATGG + Intergenic
1103014743 12:117485225-117485247 ATCTCTCTCCACTGCTGCTAGGG - Intronic
1107410046 13:40150210-40150232 ATGCCTCTCCACTCCTACTAGGG - Intergenic
1108624134 13:52210986-52211008 ATGCCTCACAAACACTGATAAGG + Intergenic
1108661917 13:52595437-52595459 ATGCCTCACAAACACTGATAAGG - Intergenic
1110173329 13:72528143-72528165 CTTCCTCTTCACTATTGATACGG - Intergenic
1112361564 13:98723713-98723735 ATGCCTCTAGACAACTGTTAGGG + Intronic
1113440069 13:110321979-110322001 ATGCATCTTCAGGACTGATATGG - Intronic
1114895787 14:26989382-26989404 ATGATTCTCCACTACAGACAAGG - Intergenic
1120830559 14:88994159-88994181 ATGCCAACCCACCACTGATAAGG + Intergenic
1121140948 14:91541023-91541045 ATCTCACTCCACTAATGATATGG - Intergenic
1123433429 15:20237460-20237482 ATGCCGCTCCCCTTCTGAAAAGG + Intergenic
1128002328 15:64204636-64204658 ATGCTTCCCCACAACTGCTATGG - Intronic
1129044489 15:72721755-72721777 ACACATCTCCACTACTAATAGGG + Intronic
1131069764 15:89458813-89458835 ATGCCTCACCACTCCTGACCTGG + Intergenic
1145119040 17:20239785-20239807 AAGGCTCTCCACTACTGCTCAGG - Intronic
1146461723 17:33051177-33051199 ATGCCTGTCCTCCACTGAAAGGG - Intronic
1153470460 18:5438812-5438834 AGGCCTCTCCAGCACTGAAAAGG + Intronic
1156505972 18:37593324-37593346 ATGCTTCTCAACTTCTGATGGGG - Intergenic
1159270734 18:66146805-66146827 ATACCTGTCCACTGCTGAAAGGG - Intergenic
1159307579 18:66664203-66664225 ATGCCTCAACAATATTGATATGG - Intergenic
926983919 2:18600247-18600269 ATGCCTCTCCAGTCCTGCTCAGG - Intergenic
928824346 2:35401138-35401160 ATGCCTATCCATTACAGATAGGG - Intergenic
930724381 2:54668186-54668208 TTCCCTCTCCTGTACTGATAAGG + Intronic
942736084 2:179114860-179114882 ATGGCTCTCCAGCACTGGTAAGG + Intronic
948029618 2:234806502-234806524 ATGTCTCTCCAAAACTCATATGG + Intergenic
1169640835 20:7750159-7750181 ATGCCTCTCCAGTATTGTTTAGG + Intergenic
1171960167 20:31487768-31487790 CTGCCTCTCCACCATTGATCTGG - Intergenic
1176728798 21:10468862-10468884 ATGCCTCTCATCTAATTATAAGG - Intergenic
1176971228 21:15268234-15268256 ATGCCTGTCTACTACAAATATGG + Intergenic
1177096265 21:16837743-16837765 GTGCCTCTCCTCTAATGAGATGG + Intergenic
1179219775 21:39395871-39395893 ATGCCTCTCCATTATTGGTGGGG + Intronic
1180558031 22:16593041-16593063 ATGCCCCTGCACTCCAGATAGGG - Intergenic
1180703412 22:17794186-17794208 ATGCCACTGCCCTCCTGATAAGG - Intronic
1181885398 22:26018312-26018334 ATGCCTGGCCACTCCTGACATGG - Intronic
1182315197 22:29441470-29441492 ATGCCTCTCCTCTACTTCAAAGG - Intronic
1182410358 22:30180251-30180273 CTGCCTCTCCACTCCTGCCATGG - Intergenic
1182465933 22:30516198-30516220 ATGGCTCCCCACCACTGAGAAGG - Intergenic
951001445 3:17564671-17564693 ATGCCCCACCACTACTGCTGAGG + Intronic
951905170 3:27699129-27699151 ATGCCTTCCCACTACTTTTAGGG + Intergenic
952837797 3:37619201-37619223 ATGCCTCTCCACTACTGATATGG + Intronic
956521130 3:70105499-70105521 ATGCCACTCAAATACTGAAACGG - Intergenic
958660150 3:97056659-97056681 ATTCATATGCACTACTGATAAGG - Intronic
960985259 3:123275267-123275289 ATGCTTTTCACCTACTGATAGGG - Intergenic
965569258 3:170154854-170154876 CTTCCTTTCCACAACTGATAAGG + Intronic
968150317 3:196332719-196332741 ATGCTTCTCCACTTATGATGGGG + Intronic
972851146 4:43052311-43052333 ATGCTTCTCAACTTCTGATGGGG - Intergenic
975680962 4:76875593-76875615 ATGACTTTTCACTGCTGATATGG + Intergenic
975765378 4:77662122-77662144 TTGCCTCTCAAATACTGATGAGG - Intergenic
979822934 4:125196420-125196442 ATGACTCCCCAGTAGTGATAGGG + Intergenic
987044446 5:14093850-14093872 CTGCCTCGCCACTTCTGATATGG - Intergenic
989273411 5:39558508-39558530 AGCCCTCTCCACTCCTGATATGG - Intergenic
1002654454 5:180733093-180733115 TGGCCTCTCCATTACAGATATGG - Intergenic
1006675485 6:35759658-35759680 CTGCCTCACCCCTACTGACAGGG - Intergenic
1009735116 6:67666545-67666567 ATGCATCTCTACTAGTGAGAGGG - Intergenic
1020285494 7:6676556-6676578 AGGCCTCTCCACAAATGAAATGG + Intergenic
1023759537 7:43451163-43451185 GTGCCTCTCAACTTCTGAAATGG + Intronic
1024272467 7:47652961-47652983 ATACCTCTACACAATTGATATGG + Intergenic
1024917393 7:54516531-54516553 ATGCCTCTGCAATTTTGATAGGG + Intergenic
1028739099 7:94251373-94251395 ATGCCCCTGTACTACTGAAAAGG - Intergenic
1032978082 7:137248738-137248760 AAGACTCTCCACTGCTGAGATGG + Intronic
1034601300 7:152259056-152259078 ATGCCTCTCATCTAATTATAAGG + Intronic
1034903113 7:154920143-154920165 ATTCCTCTGCAATACTAATACGG - Intergenic
1040921507 8:52625527-52625549 ATGCCTTTCAACTTATGATAAGG + Intronic
1041245273 8:55882914-55882936 ATGCCTCTCAACTTATGATGAGG + Intronic
1043687944 8:83111863-83111885 GTGCCTGTCCACTACTGTTTTGG + Intergenic
1045408201 8:101888848-101888870 ATGCCTGCCCACTGCTGACAGGG - Intronic
1050633666 9:7586742-7586764 ATTCCTCTCCACAACTGAGCTGG - Intergenic
1051501702 9:17785188-17785210 ATGCCCCTCCCCAACTGATGAGG + Intronic
1053363917 9:37509396-37509418 ACACCTCTCCACATCTGATAGGG + Intergenic
1203778423 EBV:87135-87157 ATGCCTCTCCGCGCGTGATATGG - Intergenic
1203585449 Un_KI270746v1:65202-65224 ATGCCTCTCATCTAATTATAAGG + Intergenic
1187529661 X:20084893-20084915 AAGCCTTACCACTACTAATAAGG - Intronic
1190527080 X:51339104-51339126 ATGCCACTGCACTCCTGTTAGGG - Intergenic
1198601920 X:138293454-138293476 ATGCCTCACAACCACTGCTAGGG + Intergenic
1202087062 Y:21149422-21149444 ATGCCACTCCACTCCAGCTAGGG - Intergenic