ID: 952838866

View in Genome Browser
Species Human (GRCh38)
Location 3:37627646-37627668
Sequence CCTAGGGAACTGAGGTTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952838858_952838866 18 Left 952838858 3:37627605-37627627 CCATGCAGTCTATTTAATTTCAG 0: 1
1: 0
2: 1
3: 15
4: 239
Right 952838866 3:37627646-37627668 CCTAGGGAACTGAGGTTCATAGG 0: 1
1: 0
2: 2
3: 13
4: 217
952838857_952838866 19 Left 952838857 3:37627604-37627626 CCCATGCAGTCTATTTAATTTCA 0: 1
1: 0
2: 0
3: 20
4: 376
Right 952838866 3:37627646-37627668 CCTAGGGAACTGAGGTTCATAGG 0: 1
1: 0
2: 2
3: 13
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952838866 Original CRISPR CCTAGGGAACTGAGGTTCAT AGG Intronic
900459091 1:2791751-2791773 CCTTGGGACCTGAGGGTGATGGG + Intronic
902439913 1:16422416-16422438 CATAGGGAAGTGTGGTTCTTTGG - Intronic
904825615 1:33272018-33272040 CCCAGGGAACTGAGGCTGGTGGG + Intronic
905333453 1:37225983-37226005 GCTAGCAAACTGAGGTTCAGAGG - Intergenic
905345523 1:37308725-37308747 GCTAGGGAGCTGAGCTTCCTTGG - Intergenic
908489675 1:64630898-64630920 CCAAGGGAAAAGAGGTTCAAGGG - Intronic
912053740 1:105568212-105568234 CCTAAAGAACCGAGGTTCTTGGG + Intergenic
912407961 1:109457357-109457379 CCTAAAGAACTGAGGGTCCTGGG + Intergenic
912560469 1:110548064-110548086 CCTGGGGAATGGAGGTTCAGGGG - Intergenic
912577848 1:110691525-110691547 CCTAAAGAACTGAAGATCATGGG - Intergenic
915478520 1:156169160-156169182 CCTCTGGAAGTGAGGTTAATGGG - Intronic
917654659 1:177113969-177113991 CATAGGGGACTGAGCTTCAAAGG + Intronic
917722603 1:177800321-177800343 CCTAAGGAACTAAGGGTCCTGGG - Intergenic
918277753 1:182970148-182970170 CCCAGGGAACTGAGTTTTCTGGG - Intergenic
920023521 1:202974806-202974828 CCTAGCCACTTGAGGTTCATCGG - Intergenic
920974580 1:210773826-210773848 GATAGGGAACTGAGTATCATTGG + Intronic
921518150 1:216123430-216123452 CTTAGGAAACTGAGGCTTATAGG - Intronic
922030854 1:221796291-221796313 CCTAGAGAACTGAGGGCCCTGGG + Intergenic
922527518 1:226317045-226317067 CCTAAAGAACTGAGGGTCCTGGG - Intergenic
923904628 1:238370164-238370186 ACTAAGGAACTGAGGTACATAGG + Intergenic
1064129746 10:12698584-12698606 CCTAAAGAACTGAGGGTCCTGGG + Intronic
1068797124 10:61095534-61095556 CCTAAAGAATTGAGGGTCATGGG + Intergenic
1069918649 10:71802709-71802731 CCAAGGTAACTGAGGCTCAGGGG + Intronic
1070479020 10:76862965-76862987 CCTAAAGAACTGAGGGTCCTGGG - Intergenic
1070601434 10:77869052-77869074 CCAAGGCAGCTGGGGTTCATGGG - Intronic
1073135485 10:101217911-101217933 CCTAGGGCACTGAGTTTCAGAGG + Intergenic
1073752216 10:106541544-106541566 CAAGGGAAACTGAGGTTCATAGG - Intergenic
1075512954 10:123086930-123086952 CCTGGGGGACTGGGGTTCAGTGG + Intergenic
1076232118 10:128829270-128829292 CCTAGCAAACTGAGGGTCCTGGG - Intergenic
1076582811 10:131524465-131524487 CTTAGGGAGCTGAGTTTCAGAGG + Intergenic
1076688735 10:132209913-132209935 CCTATGGATCTGAGGTTCTGTGG - Intronic
1077546486 11:3172629-3172651 CTTATGGAACTGGGGTTGATTGG + Intergenic
1078808146 11:14727376-14727398 TCTAAGGATCTGAGGTTCAGAGG + Intronic
1079295146 11:19226265-19226287 CTGAGGGACCTGAGGTCCATGGG + Intronic
1079595013 11:22233492-22233514 CCTGAGGAACTGAGGGTCCTGGG + Intronic
1079853320 11:25566570-25566592 CCTAAAGAACTGAGGTTACTGGG + Intergenic
1080663394 11:34315263-34315285 ACCAGGGCACTGAGGTTCCTGGG + Intronic
1080753407 11:35171733-35171755 CCTAAAGAACTGAGGGTCCTGGG + Intronic
1085409797 11:76284282-76284304 CCTAGGGAACTGGGGCTCCTGGG - Intergenic
1085599251 11:77840177-77840199 ACTAGGTATCTGGGGTTCATGGG + Intronic
1085638829 11:78178569-78178591 CATAGGGGACTGAGGCTCAGTGG - Intronic
1086865164 11:91971617-91971639 CCTAGGGAACCATGGTTCAGTGG - Intergenic
1087121360 11:94577712-94577734 CCTAGAGAACTAAGGGTCCTGGG + Intronic
1087607660 11:100395876-100395898 CCTAGGGAACTGAGGTACCTAGG - Intergenic
1088152704 11:106765213-106765235 CTTAGGGAAGTGAGGTTGAAAGG - Intronic
1088785182 11:113175042-113175064 CCTTGGCAACTGAGGTTGCTGGG + Intronic
1088876077 11:113937545-113937567 CCTAGGGATGTGAGGATTATAGG - Intronic
1089178093 11:116562741-116562763 CAGAGGGAACTGAGGGTCCTTGG - Intergenic
1091465088 12:677188-677210 TCTAGGGAACTGTGGTTAAAAGG + Intergenic
1092902493 12:13072824-13072846 CCTAAAGAACTGAGGGTCCTGGG + Intronic
1094129125 12:27055762-27055784 CCTAAAGAACTGAGGATCCTGGG + Intronic
1094629904 12:32163290-32163312 ACTAGGGTACTGAGGTGGATAGG + Intronic
1095658050 12:44694711-44694733 CCTAGAGAACTGAGCTCTATGGG - Intronic
1098466562 12:70793854-70793876 CCTAAAGAACTGAGGGTCCTGGG - Intronic
1098547202 12:71724855-71724877 CCTAAAGAACTGAGGGTCCTGGG + Intergenic
1100184118 12:92119876-92119898 CATAGAGAACTGAGGGTCCTGGG - Intronic
1100282748 12:93133926-93133948 CCTAAAGAACTGAGGGTCCTGGG - Intergenic
1102034806 12:109765093-109765115 CCTAGGCAAATGAGCTTCAGTGG - Intronic
1104384991 12:128342833-128342855 CCTAAGGAAATGAAGTTCAAAGG - Intronic
1107222444 13:38001055-38001077 CCTAAAGAACTGAGGGTCCTGGG - Intergenic
1108215851 13:48183684-48183706 CCTAAAGAACTGAGGGTCCTGGG - Intergenic
1108367326 13:49729022-49729044 CCTAAAGAACTGAGGGTCCTGGG - Intronic
1109304895 13:60627380-60627402 CTCAGGAAACTGAGGTTCAGTGG - Intergenic
1110044139 13:70807912-70807934 CTTAAGGAACTGAGGGTCCTGGG + Intergenic
1113044161 13:106136619-106136641 CCTAAAGAACTGAGGATCTTGGG + Intergenic
1114455881 14:22853256-22853278 CCTAGGGAACTGAGAGGCAGAGG + Intergenic
1114942211 14:27627043-27627065 CCTAAAGAACTGAGGGTCTTGGG + Intergenic
1115823073 14:37233506-37233528 CCTAAAGAACTGAGGGTCCTAGG + Intronic
1117031196 14:51672539-51672561 CCTAAAGAACTGAGGGTCCTGGG - Intronic
1117689141 14:58287376-58287398 CCTAAAGAACTGAGGGTCCTGGG + Intronic
1120345603 14:83285705-83285727 CCTAAGGAACTGAGGGTCCTGGG - Intergenic
1125226161 15:37398648-37398670 ACAAGGGAACTGAGGCTCAAAGG + Intergenic
1128837019 15:70817378-70817400 CATGGGGAACTGAGCTTCATGGG - Intergenic
1137483110 16:48868887-48868909 CCTAGGGAAAGCAGGATCATGGG - Intergenic
1137968592 16:52961054-52961076 ACAAGGAAACTGAGGTTCAGAGG - Intergenic
1139097761 16:63726200-63726222 CCTAGAGAACTGAGGGTACTAGG - Intergenic
1139623645 16:68167554-68167576 CCTGGGGAACTGTGGATCTTGGG + Intronic
1144316636 17:14068614-14068636 GCTAGATAACTGAGGTTCAGAGG + Intergenic
1144435572 17:15236852-15236874 CCTAGAGATCTGAGGTTCCCTGG + Intronic
1144599901 17:16602339-16602361 TCTAGGCTACTGAAGTTCATAGG - Intergenic
1146102297 17:29994871-29994893 CCTAAAGAACTGAGGGTCCTGGG + Intronic
1146636345 17:34508346-34508368 ACTGGGGAACAGAGGTTCTTGGG - Intergenic
1148339110 17:46862970-46862992 CCCCAGGAACTGAGGTTCAGAGG + Intronic
1149307184 17:55359422-55359444 CCTAAAGAACTGAGGGTCCTGGG + Intergenic
1149559625 17:57599274-57599296 CCTGGGAAACTGAGGCTCAGGGG + Intronic
1150891978 17:69162710-69162732 CCTACAGAACTGAGGATCCTGGG - Intronic
1154324302 18:13379099-13379121 CCAAGGAAACTGAGGCTCAGGGG + Intronic
1156255310 18:35389881-35389903 CCTAAAGAACTGAGGGTCCTGGG - Intergenic
1156295266 18:35783759-35783781 CCTTTAGAACTGAGGTCCATGGG - Intergenic
1156526709 18:37774790-37774812 ACTAAGAAACTGAGGTTCAGGGG + Intergenic
1156696376 18:39773075-39773097 CCTAGGGAAGTGAGGGTCATAGG + Intergenic
1157752523 18:50192795-50192817 CCTAAAGAACTGAGGGTCCTGGG - Intronic
1158270079 18:55703377-55703399 CCTAAAGAACTGAGGGTCCTGGG - Intergenic
1163672579 19:18637367-18637389 CCTAGGGACCTGAGAATCCTGGG + Intronic
1164812827 19:31171623-31171645 CCCATAGAACTGAGGTTTATGGG - Intergenic
1168565982 19:57424127-57424149 CCTAAAGAAGTGAGGTTCCTGGG + Intronic
927120923 2:19962051-19962073 CCTAAAGAACTGAGGGTCCTGGG - Intronic
928587239 2:32772910-32772932 CTTGGGGAACTGAGACTCATAGG + Intronic
928641488 2:33303969-33303991 CTTGGGTAACTGATGTTCATTGG + Intronic
930678862 2:54233933-54233955 CCTAAAGAACTGAGGGTCCTGGG + Intronic
932095340 2:68842609-68842631 CCTAAAGAACTGAGGGTCCTGGG + Intergenic
932625309 2:73292251-73292273 CCCAGGGAACTGTGGGTCACAGG - Exonic
933635391 2:84702974-84702996 CCTAGGGAGATGAGGTCCAGAGG - Intronic
937288791 2:120769409-120769431 CACAGGGCACTGAGGTTCAGGGG - Intronic
937861238 2:126712229-126712251 CCTAAAGAACTGAGGGTCCTTGG - Intergenic
939971757 2:148670058-148670080 CCAAGGCAGCTAAGGTTCATAGG - Intronic
941004565 2:160234874-160234896 CCTAAGGAACTGAGAGTCCTGGG - Intronic
941323178 2:164081150-164081172 GCTAGGGAACAGAGGTTAAAGGG - Intergenic
941619986 2:167766511-167766533 CCTAAAGAACTGAGGGTCCTGGG + Intergenic
941634344 2:167919387-167919409 CCTAAAGAACTGAGGGTCTTGGG - Intergenic
945841604 2:214893649-214893671 CCTAAAGAACTGAGGGTCCTGGG + Intergenic
946445561 2:219737198-219737220 CCTGGGGAAGTGGGGCTCATTGG + Intergenic
1172688204 20:36773285-36773307 ACAGGGGAACTGAGGTTCAGAGG + Intronic
1172828487 20:37811203-37811225 AATAGGGACCTGAGGTTCCTTGG - Intronic
1174893334 20:54421941-54421963 CCTAAAGAACTGAGGGTCTTGGG + Intergenic
1175874639 20:62223612-62223634 CCTGTGGATCTGAGGTCCATAGG - Intergenic
1176055365 20:63142858-63142880 CCTAAGGCACTGAGGGTCCTGGG + Intergenic
1180945912 22:19693288-19693310 CATAGAGTAGTGAGGTTCATAGG - Intergenic
1181005415 22:20011121-20011143 CCTGGGGAGCTGAGGCTTATGGG + Intronic
1181037772 22:20178204-20178226 CCGAGGGATCTGAGGTTCACTGG - Intergenic
1182444877 22:30384291-30384313 CCTAGGGAAAGGAGGCTCGTGGG - Intronic
1182823860 22:33245062-33245084 CCTGGAGAACTGAGGGTCCTGGG + Intronic
1183937718 22:41273118-41273140 TCAAGGGAACTGAGGCTCAGAGG - Intronic
950710084 3:14807799-14807821 CCTGGGGAACTTAGGATCAAAGG - Intergenic
950884089 3:16347685-16347707 ACTAGGGAATTGAGGGTCAGAGG + Intronic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
952838866 3:37627646-37627668 CCTAGGGAACTGAGGTTCATAGG + Intronic
953216742 3:40925360-40925382 CAGTGGGAACTGAGGTTCTTGGG - Intergenic
955431637 3:58851680-58851702 CCTAAGAAACTGAGGATCCTGGG + Intronic
955920498 3:63949696-63949718 CCCAGGGAGCTCAGTTTCATAGG + Intronic
956164900 3:66389911-66389933 CCTAAAGAACTGAGGGTCCTGGG + Intronic
957762884 3:84582407-84582429 CCTAAAGAACTGAGGGTCCTGGG - Intergenic
959451292 3:106506292-106506314 CCTAAAGAACTGAGGGTCCTGGG + Intergenic
965754406 3:172010837-172010859 CCTAGGGAAGTGTAGTACATTGG - Intergenic
970505995 4:16731096-16731118 CCTAGGGAAAGGATGTACATAGG + Intronic
971620166 4:28845531-28845553 CATAGGTAACTGTGTTTCATGGG + Intergenic
971878144 4:32330685-32330707 CCTAAGGAACTGAGCGTCCTGGG - Intergenic
972141140 4:35960846-35960868 CCTAAAGAACTGAGGGTCATGGG - Intronic
972734456 4:41827075-41827097 CCTAAGTAACTGAGGGTCCTGGG + Intergenic
974385052 4:61193481-61193503 CCTAAAGAACTGAGGGTCCTGGG + Intergenic
975285279 4:72610166-72610188 CCTAAAGAACTGAGGTTCTTGGG - Intergenic
976082142 4:81367618-81367640 ACCAGGCAACTGAGGTTCAGAGG - Intergenic
977156840 4:93584713-93584735 CCTAAAGAACTGAGGGTCCTGGG + Intronic
978318209 4:107463741-107463763 CCTAGACAAGTGAGGATCATGGG + Intergenic
978490963 4:109311641-109311663 CCTAAAGAACTGAGGGTCTTGGG - Intergenic
979359848 4:119748711-119748733 CCTAAAGAACTGAGGGTCCTGGG + Intergenic
980651618 4:135724396-135724418 CCTAAAGAACTGAGGGTCCTGGG + Intergenic
983733765 4:171031415-171031437 CAAAGGGAACTGAGGAACATAGG - Intergenic
989415327 5:41168689-41168711 CGTAAGGAACTGAGGGTCCTAGG - Intronic
990854842 5:60253079-60253101 CCTTGGGTACTGATGTTCTTTGG - Intronic
992435717 5:76754369-76754391 ACTAGGAAAGTGAGATTCATGGG + Intergenic
997276084 5:132592291-132592313 CCTAAAGAACTGAGGGTCCTGGG + Intronic
997498733 5:134353962-134353984 GCTAGGGAAAGGAGGTTAATAGG - Intronic
998789948 5:145755561-145755583 CCTAAAGAACTGAGGGTCTTGGG - Intronic
998928392 5:147153386-147153408 CCTAAAGAACTGAGGGTCCTGGG - Intergenic
1000161127 5:158598680-158598702 CCCAAGGAACTGAGGTTTTTAGG - Intergenic
1001138634 5:169124175-169124197 CCTAAAGAACTGAGGGTCCTGGG - Intronic
1001794855 5:174493377-174493399 CCTAGGGACTTGAGGTTGAGAGG + Intergenic
1001976453 5:176003777-176003799 CCTAAAGAACTGAGGGTCCTGGG + Intronic
1003642199 6:7885331-7885353 CTGAGGGAACTGGGGTTCAAAGG + Intronic
1004225563 6:13781432-13781454 CTTAAGGAACTGAGGGTCCTGGG - Intergenic
1004251990 6:14030458-14030480 AATAAGGAACTGGGGTTCATGGG - Intergenic
1005777057 6:29145471-29145493 CCTACTGAACTGAGGTTGGTAGG + Intergenic
1006285268 6:33088443-33088465 CCTAGGGAACTGAGGGTGTCAGG + Intergenic
1006501220 6:34460187-34460209 CTGAGGAAACTGAGGCTCATTGG - Intergenic
1007322914 6:41040181-41040203 ACAAGGGAATTGAGGTTCAGAGG - Intronic
1008642288 6:53476348-53476370 CCTAGGAAACACAGTTTCATGGG + Intergenic
1011156635 6:84340860-84340882 CCTTGGGAACCTAGGTCCATTGG - Intergenic
1011930799 6:92709742-92709764 CCTAAAGAACTGAGGATCCTGGG - Intergenic
1012216182 6:96587416-96587438 CCTAAAGAACTGAGGATCCTGGG - Intronic
1014468162 6:121781945-121781967 ACTAGGAAACTGAGGCTCAGAGG + Intergenic
1014488435 6:122031006-122031028 CAAAGTGTACTGAGGTTCATTGG - Intergenic
1015540853 6:134312177-134312199 CCAAGGAAACTGAGGGTCAGAGG - Intronic
1015901329 6:138070952-138070974 CCATGGGAAGGGAGGTTCATGGG - Intergenic
1016148975 6:140714705-140714727 CCTAAAGAACTGAGGGTCCTGGG + Intergenic
1016301996 6:142643049-142643071 CCTACAGAACTGAGGGTCCTGGG - Intergenic
1017168442 6:151432536-151432558 CTGAGGAAACTGAGGGTCATAGG - Intronic
1017313137 6:152997945-152997967 CCTAAAGAACTGAGGGTCCTGGG - Intronic
1017344057 6:153358619-153358641 CCTAAGGAACTGAGGGTCCTGGG - Intergenic
1017838020 6:158197896-158197918 CCTAAAGAACTGAGGGTCCTGGG - Exonic
1018078358 6:160236769-160236791 CCTAGGTAACTCAGGCTCCTGGG - Intronic
1019540250 7:1548064-1548086 CCCAGGAGACTGAGGTTCAGGGG + Intronic
1019796378 7:3052302-3052324 CCTAAAGAACTGAGGGTCCTTGG + Intergenic
1019818610 7:3220918-3220940 CCTAAAGAACTGAGGATCCTGGG - Intergenic
1022029387 7:26478725-26478747 CATAGGGAACTCAGGTACACTGG + Intergenic
1022463138 7:30630968-30630990 ACTTGGTCACTGAGGTTCATAGG + Intronic
1022492512 7:30831762-30831784 CCAAGGGGAATGATGTTCATAGG - Intronic
1022870896 7:34478612-34478634 CCAAGGGAACTGAGGAGGATGGG + Intergenic
1028709814 7:93894067-93894089 TCTAGGGAAATGAGCTTCAAGGG + Intronic
1031412459 7:121456587-121456609 CCTAGGGCACTGATGGCCATGGG - Intergenic
1033126620 7:138712412-138712434 CCTAGGGACCTGAGATTTAGAGG + Intronic
1033599755 7:142880659-142880681 CATAGGGAATGGAGGTTTATGGG - Intronic
1034918541 7:155060331-155060353 CCTCAGGAACTGAGGCTCAATGG + Intergenic
1037020074 8:13959193-13959215 CCTAGAGATCTGAGTTTCACAGG + Intergenic
1037076812 8:14730712-14730734 CCTAGGGAATGGAGGTGCCTTGG - Intronic
1037661519 8:20931420-20931442 CCTAGAGAATTGAGGCTCCTGGG + Intergenic
1038268099 8:26051351-26051373 GCTAGGAAACCGAGGTTCAGAGG - Intergenic
1038853509 8:31304622-31304644 CCTAAAGAACTGAGGGTCCTGGG + Intergenic
1039169806 8:34730924-34730946 CCTAAGGAACTGAGGGTGCTGGG + Intergenic
1039402846 8:37286067-37286089 CCTAAAGAACTGAGGGTCCTGGG - Intergenic
1039802606 8:40972904-40972926 CCTAAAGAACTGAGGGTCCTGGG - Intergenic
1040740764 8:50571601-50571623 CCTAAGGAACTTAGGGTCATAGG - Intronic
1041490643 8:58428947-58428969 CATATGGAACTGACGTTTATAGG - Intronic
1043222487 8:77684825-77684847 CATTAGGAACTGAGGTACATCGG - Intergenic
1044598994 8:93985077-93985099 ACAAGGGAACTGAGGCTCAGAGG - Intergenic
1045781885 8:105875208-105875230 CCTAAGGAACTGAGGGTTCTAGG + Intergenic
1045976844 8:108138969-108138991 CCCAGGAAACTAAGGTTCAGAGG + Intergenic
1048489044 8:134874878-134874900 CCTAAAGAACTGAGGGTCCTGGG + Intergenic
1050433554 9:5586118-5586140 CTCAGGAAACTGAGGCTCATAGG - Intergenic
1050916534 9:11142370-11142392 AATAGGGTACTGAGGATCATAGG - Intergenic
1055870124 9:80866758-80866780 CCTAGTAAACTGTGATTCATAGG + Intergenic
1056419807 9:86413219-86413241 CCTAAAGAACTGAGGGTCCTGGG - Intergenic
1056457733 9:86778817-86778839 CCTAGCAATCTGAGGTTCATTGG - Intergenic
1057936080 9:99239951-99239973 ACCAGGGAACTGAGGTTCAGAGG - Intergenic
1060834266 9:126743224-126743246 GCTAGGGAAGTGAAGGTCATGGG + Intergenic
1186691635 X:11983923-11983945 CCTAAAGAACTGAGGGTCCTGGG + Intergenic
1187134170 X:16530506-16530528 ATGAGGGAACTGAGGTTCAGAGG - Intergenic
1187503713 X:19861583-19861605 CCTAAAGAACTGAGGGTCTTGGG + Intronic
1188120258 X:26297346-26297368 CCTAAGGAACTGAGGATCCTGGG - Intergenic
1188153805 X:26715740-26715762 CCTAAGGAACTGAGGGCCCTGGG + Intergenic
1188734252 X:33693045-33693067 CCTAAAGAACTGAGGGTCCTGGG - Intergenic
1188889171 X:35588660-35588682 CCTAAAGAACTGAGAGTCATTGG + Intergenic
1189684138 X:43546165-43546187 CCTAGAGAAATGAGGATCCTGGG + Intergenic
1190034956 X:47013562-47013584 CCTAGAGAACTGAGCGTCCTGGG + Intronic
1190908760 X:54753268-54753290 CCTAAAGAACTGAGGGTCCTGGG - Intronic
1190925737 X:54902175-54902197 CCTGGGAAACTGGGGTTAATTGG - Intergenic
1192286303 X:69741905-69741927 CCTAGGGAACTGACTTTATTTGG - Intronic
1192531148 X:71887393-71887415 CCTAAAGAACTGAGGGTCCTGGG - Intergenic
1194560050 X:95409144-95409166 CCTAAAGAACTGAGGATCCTTGG + Intergenic
1195387150 X:104324194-104324216 CCTTTAGAACTGAGGTGCATTGG - Intergenic
1197235294 X:124055466-124055488 CCTGGGGTACTGTGGTTGATGGG + Intronic
1198500529 X:137241128-137241150 CCTAAGGAACTGAGGGGCCTTGG + Intergenic
1199822582 X:151463879-151463901 GCTAGGAAACTGAGGCTCAGAGG + Intergenic