ID: 952841171

View in Genome Browser
Species Human (GRCh38)
Location 3:37646749-37646771
Sequence TGTTTGCCAGAGGACTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952841167_952841171 8 Left 952841167 3:37646718-37646740 CCGATTTGTCTGATTGAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 111
Right 952841171 3:37646749-37646771 TGTTTGCCAGAGGACTTAGGAGG 0: 1
1: 0
2: 2
3: 4
4: 147
952841166_952841171 20 Left 952841166 3:37646706-37646728 CCAAGCTGGGTTCCGATTTGTCT 0: 1
1: 0
2: 0
3: 7
4: 93
Right 952841171 3:37646749-37646771 TGTTTGCCAGAGGACTTAGGAGG 0: 1
1: 0
2: 2
3: 4
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952841171 Original CRISPR TGTTTGCCAGAGGACTTAGG AGG Intronic
901023134 1:6265083-6265105 TGTTTGCTACTGGACTTCGGTGG + Intronic
903198141 1:21709029-21709051 TGTTAGCCAGACTACTCAGGAGG - Intronic
903482352 1:23663019-23663041 TGGTTGCCAGAGGACGAAGACGG - Intergenic
906252098 1:44318572-44318594 TGTTTGCCAGCTGACCCAGGTGG - Intronic
907247926 1:53120008-53120030 TGGTGGCCAGATGGCTTAGGAGG - Intronic
907811999 1:57880111-57880133 TGTTTGCCAAAGGTACTAGGGGG - Intronic
909041995 1:70665454-70665476 TGTTTATCAGAGGACTTTTGGGG - Intergenic
910304109 1:85741959-85741981 TGTTTGCCAGAGGAGGAGGGAGG - Intronic
910374467 1:86553319-86553341 TGTTTGCACGAGGACTGAAGGGG - Intronic
910743865 1:90551928-90551950 TGTTTCCCAGAGGACTCGGAAGG - Intergenic
911437233 1:97876825-97876847 TGATTGACAGTGGATTTAGGAGG + Intronic
914704966 1:150162847-150162869 TGTTAGCCAGGGGCCTGAGGAGG + Intronic
1063759806 10:9060541-9060563 TGTTTGCCACAGGAAGTAGCTGG - Intergenic
1063821861 10:9845411-9845433 TGTTTGCCAGAGTCATTGGGAGG - Intergenic
1065035746 10:21637131-21637153 TTTTTGCCAGAGGATTCAGTTGG + Intronic
1065234375 10:23633526-23633548 TGATTGCCAGAGGATGTAGATGG - Intergenic
1065363429 10:24911245-24911267 TGTTTGCCAGAGGCTATAAGTGG - Intronic
1065717457 10:28586280-28586302 TGTTTATCAGAGGACTTAGCAGG - Intronic
1066450056 10:35520861-35520883 TGCTTGTCAGAGGACTTGGTGGG - Intronic
1070967912 10:80540897-80540919 ATGTTGCCAGAGGACTCAGGAGG + Intronic
1072497340 10:95974820-95974842 TGGTTGCCAGAGGTTCTAGGGGG + Intronic
1074398491 10:113120631-113120653 TGTTTTCAAGGGGACGTAGGAGG + Intronic
1075507666 10:123039206-123039228 GGTTTGCCTGAGAACTGAGGAGG - Intronic
1075950386 10:126472518-126472540 TGTTTGGGAGTGGACTTGGGTGG + Intronic
1077375033 11:2201752-2201774 TGCTTGGCAGAGGACTTAGAAGG - Intergenic
1078538896 11:12197865-12197887 TGTTTCTCAGAGGAATTAGTTGG + Intronic
1078722631 11:13898290-13898312 TGTTTCCCAGAGAACTTAGGAGG - Intergenic
1084438697 11:69158340-69158362 GGTAAGCCAGAGGACTCAGGTGG + Intergenic
1087265197 11:96053030-96053052 TGTTTGCCAGATGAAGTAAGTGG - Intronic
1091258728 11:134216424-134216446 TGATTGTCAGAGCACTGAGGAGG - Intronic
1093684287 12:22038794-22038816 TGTTTCTCAGAGCACTTGGGAGG + Intergenic
1096080377 12:48828650-48828672 TGTGTAGCAGAGAACTTAGGGGG + Exonic
1096912395 12:54997391-54997413 TCTTTACCAGAGGACATATGGGG - Intergenic
1099979277 12:89580362-89580384 TCTTTGCCAGAGACTTTAGGAGG + Intergenic
1102832443 12:116016877-116016899 TGATTAGCAGAGGGCTTAGGAGG - Intronic
1103258340 12:119562782-119562804 TGTCTAGCAGAGAACTTAGGAGG + Intergenic
1104214618 12:126723934-126723956 TTGTTGCCAGAGGGCTCAGGAGG + Intergenic
1106488475 13:30193685-30193707 TGTTTGCCAGGTGGCTAAGGAGG - Intergenic
1107904386 13:45048788-45048810 TGGTTGCCAGAGGAGTGATGGGG - Intergenic
1108087830 13:46813540-46813562 TGTTTGCCAGAGGCAGGAGGTGG - Intergenic
1110079293 13:71290557-71290579 TTTTTCCCACAGGTCTTAGGTGG + Intergenic
1118314060 14:64714882-64714904 TGAGTGCCAGAGGACCTGGGGGG + Intronic
1122946315 14:105011906-105011928 TGTTTGCACGAGGACTGAAGAGG - Exonic
1124618763 15:31262140-31262162 GGGGTGCAAGAGGACTTAGGTGG + Intergenic
1127466377 15:59248543-59248565 TGTCTGCCAGTGGGCTGAGGAGG + Intronic
1129233545 15:74209799-74209821 TGCTTGCCACAGCACCTAGGTGG - Intronic
1129881885 15:79012257-79012279 AGTTTGCTAGACGACTGAGGGGG - Intronic
1130642437 15:85691298-85691320 TGTTTGGCAGAGTACTTGGCTGG - Intronic
1130886449 15:88096484-88096506 TCTTTGCCAGGAGACTCAGGTGG - Intronic
1131866540 15:96717354-96717376 TGTTGGCCAGAGGAGCTGGGAGG - Intergenic
1132777759 16:1605237-1605259 TGTTTCCCAGAGGACTTCACAGG + Intronic
1138528305 16:57621212-57621234 TCTGTGCCCCAGGACTTAGGGGG + Intronic
1139249360 16:65480164-65480186 GGTTTGACAGAGGACTCAGTGGG - Intergenic
1140037595 16:71383059-71383081 TGATAGCCAGAGGAATTTGGAGG - Intronic
1141321416 16:83013027-83013049 TACTTGCCTGAGCACTTAGGTGG + Intronic
1141381088 16:83577638-83577660 TGCTTCCCAGAGGGCTGAGGAGG + Intronic
1141670957 16:85491479-85491501 TATGTGCCAGATGACTTGGGGGG + Intergenic
1146445987 17:32933366-32933388 CCTTTGCCAGAGCACTTAGCTGG + Intronic
1147710361 17:42459040-42459062 TGATTGTCAGAGGAATTAGCGGG + Intronic
1155171200 18:23267823-23267845 TGTGTGCCAGGGGCCTGAGGAGG - Intronic
1157345974 18:46833368-46833390 TGTTTGCTTGAGGACTGAGAGGG + Intronic
1165281807 19:34804161-34804183 TGTCTGCTAGAGGCATTAGGAGG - Intergenic
1166129183 19:40735762-40735784 AGTGTGGCAGATGACTTAGGTGG + Intronic
1166222997 19:41377446-41377468 TGTGTGGCAGGGGACTTCGGGGG + Intronic
926368915 2:12161124-12161146 TGGTTTCCAGAGGACTGAAGTGG + Intergenic
926441451 2:12893030-12893052 GGTTAGCCAGAGTCCTTAGGTGG - Intergenic
931105033 2:59046244-59046266 TGTTTGTCAGAGGACTTCAAAGG + Intergenic
932369815 2:71177666-71177688 TGTTTGCCAGAGGGACTATGGGG + Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
934538437 2:95156063-95156085 GGTTTATCAGAGCACTTAGGTGG - Intronic
935419375 2:102851480-102851502 TGTTTGTCCCAGGGCTTAGGAGG + Intergenic
938105957 2:128530011-128530033 TGTTTGCCATTGGAATTAGCAGG + Intergenic
941758790 2:169218179-169218201 ATTTTGTCAGAGGACATAGGAGG - Intronic
942218122 2:173742407-173742429 TGTTTCCAAGAGGCTTTAGGGGG - Intergenic
943169019 2:184371847-184371869 TGAATGCCAGATTACTTAGGAGG + Intergenic
943670686 2:190657308-190657330 TTTTATCCAGAGGACTGAGGTGG + Intronic
945731745 2:213545941-213545963 TGATTAGCAGAGGACTTGGGGGG + Intronic
946035179 2:216736353-216736375 TGGCTGTCAGAGGACTTAGCAGG - Intergenic
946167876 2:217876401-217876423 TGTTAGCCAGAGCACTGAGCCGG + Intronic
1170654454 20:18273114-18273136 TGTTTGCCAGAGGAAGAACGTGG + Intergenic
1172022343 20:31923764-31923786 TAATTGCCAGAGGACGTGGGAGG - Intronic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1175441232 20:58993562-58993584 GGCTTGCCAGAGGGCTGAGGAGG + Intronic
1175453378 20:59089874-59089896 TGTTTGCCTGAGGACTCATAAGG - Intergenic
1175774949 20:61647255-61647277 TGTCTGCAAGGGGACTTTGGTGG - Intronic
1176907008 21:14513680-14513702 TGTATGGCAGAGGTCTTTGGAGG - Intronic
1179973419 21:44849113-44849135 TGTGTCCCAGAGGACTGAAGTGG + Intergenic
1180746864 22:18095372-18095394 TGGTTACCAGTGGACTTAGCTGG + Exonic
1183120685 22:35728066-35728088 TGATGGGCCGAGGACTTAGGAGG + Intronic
1184874339 22:47263653-47263675 GGTTAGCCAGGGGACTTTGGTGG + Intergenic
949541549 3:5036249-5036271 TGGTTGCCAGGGGACTGAGAGGG - Intergenic
951138042 3:19127036-19127058 TGTTTGCCTGAGGACTTTTTTGG - Intergenic
951805911 3:26643181-26643203 TGGTTGTAAGAGGACTTGGGAGG + Intronic
952246686 3:31601577-31601599 TGGTTGCCTGGGGATTTAGGAGG + Intronic
952841171 3:37646749-37646771 TGTTTGCCAGAGGACTTAGGAGG + Intronic
954302431 3:49706986-49707008 TGTGTGCCAGAGGCCTGAGAGGG - Intronic
958190878 3:90182896-90182918 TATTTACCAGAGGACCCAGGCGG + Intergenic
959699130 3:109281909-109281931 TGTTTACCAGAAGACTAATGTGG - Intergenic
962057683 3:131889464-131889486 AGTTTGCTAAATGACTTAGGAGG - Intronic
962329820 3:134467709-134467731 TGTCTGCCAGTGGAGTTAGTAGG + Intergenic
966427112 3:179791673-179791695 TGCTTGGCAGAGGAATTAGCTGG + Intergenic
966911319 3:184561942-184561964 TGGGTGCCTGAGGACTTGGGGGG - Exonic
970529837 4:16970358-16970380 TGTTTGCCTGAGGCCCGAGGAGG + Intergenic
970667866 4:18358535-18358557 TGTCTGCTAAAGGACCTAGGAGG - Intergenic
972907403 4:43768101-43768123 GGGTTTCCTGAGGACTTAGGGGG - Intergenic
972937123 4:44150406-44150428 TGTTTGTAAGAGGAGTTATGTGG + Intergenic
974869611 4:67623867-67623889 TGTCTGCCAGATGAATTAGAAGG - Intronic
976382691 4:84418239-84418261 TGTTTGCCAGAGGTCTTAAGGGG + Intergenic
976471311 4:85432058-85432080 TGTGTGACAGAGGAGTTAAGTGG + Intergenic
982674431 4:158359495-158359517 TTTTTGGCAGAGCATTTAGGAGG + Intronic
984524084 4:180836046-180836068 AGTTTGCCAGAGGACAAATGTGG + Intergenic
988499543 5:31772994-31773016 TGTGAGACAGAGGACTTTGGAGG + Intronic
989276245 5:39593042-39593064 TTTTTGCTAGAGAACATAGGTGG - Intergenic
995326641 5:110897289-110897311 TGTTTTCCTGAGCACTGAGGAGG + Intergenic
995837932 5:116416596-116416618 GCATTGCCAGAGGACTGAGGAGG + Intergenic
996066257 5:119082874-119082896 TGGTTACCAGAGGGCTAAGGAGG - Intronic
998007250 5:138665253-138665275 TGTTTGGCAGAGCCCTTAAGAGG - Intronic
1003133757 6:3417270-3417292 TGCTTTCCAGAGGTCTGAGGAGG + Intronic
1003594608 6:7463174-7463196 TGGTTGCCAGGGGACTGGGGAGG + Intergenic
1005265515 6:24108370-24108392 TGTTGGCCAGACGACTCAGAAGG - Intergenic
1005661087 6:28000465-28000487 GTGTTGCCAGAGGGCTTAGGTGG + Intergenic
1008966494 6:57317876-57317898 GGTTTGCCAGTGGAGTGAGGAGG + Intronic
1009814156 6:68709500-68709522 AATTTGCCAGAGGAATCAGGGGG + Intronic
1012038907 6:94178423-94178445 TGTTTGCAAGGGGACTTCAGGGG + Intergenic
1016870447 6:148811092-148811114 TGTATGCCAGTGGGCTTTGGTGG - Intronic
1018661263 6:166089291-166089313 TGTTTGCCAGAGAAAGAAGGAGG + Intergenic
1018939217 6:168297282-168297304 AGTTTGCCAAGGGAATTAGGTGG + Intronic
1019104021 6:169654535-169654557 TGGTTGCCAGACGGCTCAGGAGG + Intronic
1023674590 7:42616708-42616730 AGTTTTAGAGAGGACTTAGGAGG + Intergenic
1026181927 7:68049242-68049264 TGGTTGCCAGGGGACTCTGGTGG + Intergenic
1029298018 7:99557089-99557111 AGTTTGCCAGATGACAGAGGTGG - Intronic
1031068742 7:117138480-117138502 TGTGTGCCAGAAGACTCGGGAGG + Exonic
1031177625 7:118372498-118372520 TGATTTCCAGATAACTTAGGGGG - Intergenic
1033037342 7:137887105-137887127 TGTTTTCCAGTGAACTTATGTGG - Intronic
1034131659 7:148723967-148723989 TGTTTGCTAGAAGACTTCAGAGG - Intronic
1039427842 8:37501448-37501470 AGTTTGCCAAAGGACTCAGAGGG - Intergenic
1041887512 8:62828232-62828254 TGTTTGCCAGAGGTTATAGGTGG + Intronic
1042716080 8:71774154-71774176 TGTTTGCCAGTGGACTGGGGTGG + Intergenic
1046912757 8:119646856-119646878 TATTTGCCAGGGAAATTAGGTGG - Intronic
1051603245 9:18895307-18895329 TGTTTTCCAGAGCACTTATAAGG - Intronic
1052470642 9:28890558-28890580 TGTATGGCAGAGGAGTTTGGAGG + Intergenic
1056929088 9:90859823-90859845 TGTTTGCCAGATGCCTAATGAGG + Intronic
1057710774 9:97441531-97441553 TGGTAGCCAAAGGACTTAGAAGG - Intronic
1059942973 9:119375994-119376016 TGTTAGAAAGAGGAGTTAGGAGG - Intergenic
1060005183 9:119993335-119993357 TGTGTGCCATAGGAATTATGTGG + Intergenic
1060515978 9:124266078-124266100 GGTTTGCCAGAGGGCTGAGAGGG + Intronic
1190248511 X:48706059-48706081 TGCTAGCCAGAGGCCTGAGGCGG + Intronic
1191750161 X:64533867-64533889 AGTTTTCCAGAGGATTAAGGGGG - Intergenic
1192190690 X:68989651-68989673 TTGGTTCCAGAGGACTTAGGAGG + Intergenic
1192880855 X:75282432-75282454 TGTATGCCAGAGGTTTTGGGAGG + Intronic
1195805957 X:108765591-108765613 TGGTTGCCAGAGGCTGTAGGTGG - Intergenic
1197122152 X:122905918-122905940 TGTTTGCCAGAGAACACTGGTGG - Intergenic
1197248115 X:124187531-124187553 AGTTTGCCAGATGAATGAGGTGG - Intronic
1199846810 X:151697488-151697510 TGTTTGCCAAAAGGATTAGGTGG + Intronic