ID: 952842850

View in Genome Browser
Species Human (GRCh38)
Location 3:37662821-37662843
Sequence CTGTGTAGACAGTTGGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952842850 Original CRISPR CTGTGTAGACAGTTGGTCCA TGG Intronic
902760183 1:18575809-18575831 CTGAGCTGACAGCTGGTCCAGGG + Intergenic
903309284 1:22441088-22441110 CTGTAAAGCCATTTGGTCCAGGG + Intergenic
903768184 1:25748089-25748111 CTGTGTAGACAGTGGCTCTTTGG + Intronic
903814912 1:26057850-26057872 CTGTCAAGACAGTGGGTCCTAGG - Intronic
904993173 1:34610291-34610313 CAGGGTAGACAGTTGGCCTAGGG + Intergenic
905053593 1:35074362-35074384 CTGTTAAGTCATTTGGTCCATGG + Intronic
907767603 1:57425466-57425488 TTGTGGAGCCAGTAGGTCCAGGG + Intronic
909522142 1:76581547-76581569 CTGTGTAGACTATTGGTTTAAGG - Intronic
910704706 1:90116314-90116336 CAGTGTACCCAGTTGTTCCAGGG + Intergenic
913970723 1:143413776-143413798 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
914065100 1:144239387-144239409 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
914114051 1:144726967-144726989 CTGTCTGCACAGTTGGTCCTAGG + Intergenic
916363845 1:164000999-164001021 CTGTGAATCCATTTGGTCCAGGG - Intergenic
917488089 1:175473593-175473615 CTCTGTAGACATTTGGGCCTTGG - Intronic
917924717 1:179779578-179779600 ATGAATAGACAGTTGTTCCAGGG + Intronic
920030344 1:203033973-203033995 CTGTGCTGACAGTCGTTCCAGGG - Intronic
920167337 1:204045213-204045235 AAGTGTAGACAGCTTGTCCAAGG + Intergenic
920810028 1:209275888-209275910 CTGTGAAGCTATTTGGTCCAAGG + Intergenic
922724313 1:227915349-227915371 CTGTGTAGCCAGGTGGGGCAGGG + Intergenic
923838041 1:237636325-237636347 CTGGGTAGACACTTAGTGCATGG + Intronic
924201930 1:241669252-241669274 CTGTGGAGTCAGGTGGTCCAGGG - Intronic
1064635037 10:17356809-17356831 CTGTATAGATGGCTGGTCCATGG - Intronic
1066376471 10:34861732-34861754 CTGTGTAAATATCTGGTCCAGGG + Intergenic
1069148253 10:64923276-64923298 CTGTGAAGACATCTGGTCCTGGG - Intergenic
1069368511 10:67718914-67718936 CTGTGAAGACATCTGGTCCTGGG + Intergenic
1070378547 10:75858173-75858195 CTGAGTAGACAGAGGGGCCAGGG - Intronic
1071341416 10:84652194-84652216 CTGGTTAGACAGTGGGTACAAGG - Intergenic
1073074847 10:100817448-100817470 CTGTGTAGCCTGTTGGCTCAGGG - Intronic
1073823637 10:107293901-107293923 CTGTGTAGCCATCTGGTCCTTGG + Intergenic
1074013013 10:109503787-109503809 ATGAGTAGAGAGTTGGTCCTTGG + Intergenic
1074628175 10:115217992-115218014 TTGTGGAGACAGTTTTTCCATGG + Intronic
1080233771 11:30046131-30046153 CTGTGCTGACAGTTGGCACAAGG + Intergenic
1081041936 11:38224068-38224090 ATGTGGAGACATTTAGTCCAGGG + Intergenic
1087511328 11:99098887-99098909 CTGTCTAGACAGATGGTCTCTGG - Intronic
1089656757 11:119952983-119953005 CTGTATGAAGAGTTGGTCCATGG - Intergenic
1092532868 12:9360012-9360034 CTCTGTGGACAGGGGGTCCAGGG - Intergenic
1093400092 12:18735360-18735382 CTGTGAAGTCATTTGGTCCTGGG + Intronic
1097309737 12:58105479-58105501 CTGTGTAGACAGATGATGCTGGG + Intergenic
1098705477 12:73684215-73684237 CTGTGTAGATAGTTGTTTAATGG - Intergenic
1098780070 12:74676195-74676217 CTGGTTAGACAGTGGGTGCAGGG + Intergenic
1099512694 12:83556548-83556570 CTGATTGGACAGTGGGTCCACGG - Intergenic
1102485715 12:113254382-113254404 CCGTGTAGAATGTTGGTCCGAGG - Intronic
1102606300 12:114070188-114070210 ATAGGTAGACACTTGGTCCATGG - Intergenic
1104589484 12:130072889-130072911 CAGTGTAGACAGCTGGGCCCTGG - Intergenic
1104743407 12:131195022-131195044 CTGTGTAGACGGTTGTTTCTGGG - Intergenic
1104790926 12:131481662-131481684 CTGTGTAGACGGTTGTTTCTGGG + Intergenic
1107892602 13:44927399-44927421 CTGTGTACACAGATGGGCAATGG - Intergenic
1108935311 13:55874726-55874748 ATTGGTAGACATTTGGTCCAAGG + Intergenic
1109275423 13:60298734-60298756 CTGGGTAGACAGGTGAGCCAAGG + Intergenic
1110359929 13:74613087-74613109 CTGGGTCTACAGTTGGTGCACGG + Intergenic
1110818490 13:79887148-79887170 CTGGTTGGACAGTGGGTCCACGG + Intergenic
1110966822 13:81710186-81710208 CTGTGAATCCATTTGGTCCAGGG + Intergenic
1111546949 13:89750818-89750840 CTGTGTAGACAGTTATTAAATGG + Intergenic
1112339883 13:98544297-98544319 CTGTGTCTGCAGTTGGGCCACGG - Intronic
1116692376 14:48125832-48125854 CTGTGTGGACAGCTGGTTCAGGG + Intergenic
1118823164 14:69358211-69358233 CTCTGGAGACAGTTGCTCTAGGG + Intergenic
1127261706 15:57331428-57331450 CTGTGAAGACTGGGGGTCCATGG + Intergenic
1129998537 15:80027440-80027462 ATATCTAGAAAGTTGGTCCATGG - Intergenic
1130451982 15:84064490-84064512 TTGTGAACACATTTGGTCCAGGG + Intergenic
1131049482 15:89337063-89337085 CCCTGTGGACAGTTGGGCCAGGG - Intergenic
1133928837 16:10215749-10215771 CTATGTAGCAAGTTGGTACAGGG + Intergenic
1133956033 16:10444633-10444655 ATGGGGAGACACTTGGTCCAAGG + Intronic
1140663698 16:77211008-77211030 CTGTGTAGAAAGTGGGAACAGGG + Intronic
1140873197 16:79125675-79125697 CATTGTTGACACTTGGTCCATGG - Intronic
1144163008 17:12580306-12580328 CTGTGTAGACAGTTACACCCCGG + Intergenic
1146466889 17:33093484-33093506 CTATGTAGACAGTATGTACATGG + Intronic
1147584106 17:41643179-41643201 CTGAGGTGACAGTTGGTCCAAGG + Intergenic
1149235339 17:54583591-54583613 CTGTGAATACATTTGGTCCTGGG - Intergenic
1149623231 17:58061552-58061574 CTGTGAAGACAGTTTCTACAGGG - Intergenic
1149940716 17:60862419-60862441 CTGTGAATTCATTTGGTCCAGGG + Intronic
1151104236 17:71594004-71594026 CTGTATACACTGTTGGTCCATGG + Intergenic
1151325971 17:73379945-73379967 CTGTGTAAAGAGTTGGTGGATGG - Intronic
1153715932 18:7847956-7847978 CTGTGTAGAGAGCTGTTTCAGGG + Intronic
1154367394 18:13723931-13723953 CTGTGAAGAGAGGTGGTTCATGG - Intronic
1158074146 18:53509127-53509149 CTTTGCAGAGAGTTGGTGCAGGG - Intronic
1160154248 18:76421367-76421389 CTGTGCTGGCAGTTGCTCCAGGG + Intronic
1162143215 19:8596933-8596955 CTGAGAAAACAGATGGTCCAGGG - Intronic
1164097967 19:22028897-22028919 TTGTGTAGAAAATTGGTCCAGGG + Intergenic
1165213675 19:34254562-34254584 CGGTGTACACAGCCGGTCCAAGG + Exonic
1165407046 19:35637419-35637441 CTGTGGAGACAGAGGGTTCAAGG - Intronic
1165778282 19:38417717-38417739 CTGTGGAGAGAGTGGGGCCAGGG + Intronic
1166309682 19:41955977-41955999 CTGGGTGCACAGTTGGTCCTTGG + Intergenic
1166497045 19:43310990-43311012 ATGGGAAGACATTTGGTCCATGG + Intergenic
926547432 2:14259327-14259349 CTGTGAATCCATTTGGTCCAGGG - Intergenic
928508302 2:31977275-31977297 CTGTGTAGACAGACAGTCAATGG + Intronic
928592712 2:32833930-32833952 CTATGGGGACAGTTGGCCCAAGG - Intergenic
929255498 2:39806941-39806963 CTGTGAACCCATTTGGTCCAGGG + Intergenic
931906334 2:66847358-66847380 CTGTGCATTCAGTTGGTCCAAGG - Intergenic
932408007 2:71526773-71526795 CTGTGAAGACAGTGGGGCCCAGG - Intronic
934175418 2:89574701-89574723 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
934285734 2:91649064-91649086 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
937250044 2:120517911-120517933 CTGTGCACACAGGTGGTCTAAGG + Intergenic
937369285 2:121286421-121286443 CAGTGTAGACAGTGGGTCATGGG + Intergenic
941806541 2:169716371-169716393 CTGTGTGGACAGTTAGCACAAGG - Intronic
942309826 2:174645713-174645735 CTTTGAAGACAGCTGGTCAAAGG - Intronic
942539181 2:176997524-176997546 CTGTGTTGACAGTGGGGACAAGG + Intergenic
1170394574 20:15912081-15912103 CTGTTTTGACAGTGGGTCAAAGG + Intronic
1170457692 20:16548676-16548698 TTGTGAAGACAGTTTTTCCATGG - Intronic
1174992394 20:55525431-55525453 CTGTGAATCCATTTGGTCCAGGG + Intergenic
1175455160 20:59107007-59107029 GTGTGCAGACACCTGGTCCAAGG + Intergenic
1177761971 21:25412281-25412303 CTGTGTGGACAGATGGCTCAAGG + Intergenic
1179878544 21:44283882-44283904 CTGTGCAGCCAGTGGGCCCAAGG + Intergenic
1180593234 22:16957917-16957939 CTGTGGTGACAGCTGGTCCTGGG - Intergenic
1181632303 22:24157592-24157614 CTGTGAAGACGGTTGGCCCCAGG + Intronic
1185236630 22:49717314-49717336 CTGTGTAAACAGTTGTTACACGG + Intergenic
949134994 3:553944-553966 CTGGGTATCCTGTTGGTCCAAGG - Intergenic
949509895 3:4758624-4758646 CTGTGTAAACAAGTGGTCCTGGG - Intronic
951549832 3:23865979-23866001 GTGTGTAGACAGCAGGACCAAGG + Intronic
952842850 3:37662821-37662843 CTGTGTAGACAGTTGGTCCATGG + Intronic
952855554 3:37767722-37767744 CTGTGTAGCTAGTGGTTCCAAGG - Intronic
953580907 3:44155539-44155561 CTTGGTAGACAGTTGGTCCTTGG - Intergenic
953754724 3:45636333-45636355 TTCTGGAGACGGTTGGTCCATGG + Intronic
954154765 3:48679292-48679314 CTGTGTAGTCAGCAGGTCCCAGG + Intronic
956496128 3:69828049-69828071 CTTTCTATACAGTTGGCCCAAGG + Intronic
956617337 3:71185582-71185604 CTGGGTAGACAGATAGTCCCAGG + Intronic
956819270 3:72938366-72938388 CTGAGTAGACACTGGGTTCAGGG - Intronic
959497173 3:107065162-107065184 CGGTGTAGCCAGTAGGTCTAAGG - Intergenic
959840313 3:110967445-110967467 ATGGGAAGACATTTGGTCCATGG + Intergenic
964928045 3:161981112-161981134 CAGTGAAGACATTTGGTCCTGGG + Intergenic
966580014 3:181550512-181550534 CTGTGTACAGAGGTGGCCCAGGG + Intergenic
966608812 3:181848045-181848067 CTGGGGAGAGGGTTGGTCCATGG + Intergenic
968395723 4:234824-234846 CTGTGAAGACAGTATGCCCACGG + Intergenic
968414577 4:419100-419122 CTGTGAAGACAGTATGCCCAAGG + Intergenic
976648776 4:87413045-87413067 CTGTGAAGACAGATGTTACATGG + Intergenic
978843932 4:113249486-113249508 CTGTGTGGACAGAGGGTCAATGG - Intronic
980454826 4:133025562-133025584 CTATGAATACATTTGGTCCAGGG - Intergenic
982605930 4:157515761-157515783 CTGTGGAAACCGTAGGTCCAGGG + Intergenic
987669978 5:20994149-20994171 CTGTGAATACATCTGGTCCAGGG - Intergenic
988342468 5:29991050-29991072 CTGTGGAGACAGATCATCCATGG - Intergenic
989495249 5:42104174-42104196 CTGTGAATCCATTTGGTCCAGGG + Intergenic
990195570 5:53311271-53311293 CTTTGGAGACAGATGGTCAAGGG - Intergenic
991489460 5:67167816-67167838 CCTTTTAGACAGTTGGACCAGGG - Exonic
999305990 5:150519950-150519972 CTGGGTGGACAGAAGGTCCAGGG + Intronic
999477797 5:151917175-151917197 CTGTGCAAACCTTTGGTCCAAGG + Intronic
1007504807 6:42327366-42327388 CTGTGTAGGCAATTTGTCCGGGG + Intronic
1008293277 6:49745568-49745590 TTGTGTAGAAGGTTGTTCCATGG - Intergenic
1013308366 6:108871076-108871098 CCATGTGGACACTTGGTCCATGG - Intronic
1016570868 6:145511146-145511168 CTGTGAAACCATTTGGTCCAGGG - Intronic
1023853812 7:44167997-44168019 CAGTGTAGACATCTGGTCCTGGG - Intronic
1024155221 7:46615060-46615082 CTTTGATGACAGTTGATCCATGG - Intergenic
1028889388 7:95970107-95970129 CTGTATCCAAAGTTGGTCCAAGG + Intronic
1030513476 7:110514209-110514231 CTGTGAATCCATTTGGTCCAGGG + Intergenic
1032283032 7:130521177-130521199 CTGTGTAGGCAGTTCTTCAAGGG + Intronic
1033850740 7:145491607-145491629 CTGTGAATCCATTTGGTCCAAGG - Intergenic
1034604577 7:152300257-152300279 CTGTTTGCACAGTTGGTCCTAGG + Intronic
1038199033 8:25394727-25394749 TTCTGTAGACATTTTGTCCAAGG + Intronic
1039946994 8:42138778-42138800 CTGTGTAGAAAGATCATCCATGG + Intergenic
1041327874 8:56688496-56688518 CTGTGTAAACAGTTGGTTATGGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043559397 8:81472996-81473018 CTGTGAAGACAGGAGGTCAAGGG + Intergenic
1043949808 8:86295853-86295875 ATGTGTTGACATTTGGTCTATGG + Intronic
1050986388 9:12088567-12088589 CTGTGAACCCATTTGGTCCAGGG + Intergenic
1052811287 9:33062978-33063000 CTTTGGAGACAGATGGTCCTAGG + Intronic
1056130248 9:83578209-83578231 CTGTGAAGCCATTTGGTCCTGGG - Intergenic
1058634573 9:107024023-107024045 TTGTGTAGACAGATGGTCCATGG - Intergenic
1058773541 9:108262511-108262533 CTGGGTATAGAGTTGGACCAGGG - Intergenic
1186127608 X:6431122-6431144 ATGTGGAAACATTTGGTCCATGG - Intergenic
1187349106 X:18495592-18495614 CTCTGTAAACAGTTTGTCCCTGG - Intronic
1189847485 X:45150501-45150523 GTGTGGAGAGAGCTGGTCCAGGG + Exonic
1191017284 X:55822623-55822645 CTGTGAATTCATTTGGTCCAGGG + Intergenic
1193083326 X:77426485-77426507 CTGTGTCTACAACTGGTCCATGG + Intergenic
1193935411 X:87613059-87613081 CTTTTAAGACAGTTGGTCCAAGG - Intronic
1193989783 X:88292088-88292110 CAGTGAAGACATTGGGTCCAAGG - Intergenic
1194245265 X:91503311-91503333 CTGTGAATACATCTGGTCCAGGG - Intergenic
1194320910 X:92445169-92445191 CTGTGAATCCATTTGGTCCAGGG + Intronic
1195268182 X:103204197-103204219 CAGTGAAGACATTTGGTTCAGGG + Intergenic
1196021834 X:110999010-110999032 CTCTGTAGTCACTTGTTCCAGGG + Intronic
1198506869 X:137309647-137309669 CTGTGTAGGCACTTAGTGCAGGG - Intergenic
1198623076 X:138535029-138535051 CTGTCTAGACAGTTTGTCTAAGG - Intergenic
1199455578 X:148024365-148024387 TTGTGTGGACAGTTGGTAAAGGG - Intronic
1200380437 X:155831759-155831781 CTGTGAATCCATTTGGTCCAGGG - Intergenic
1200564237 Y:4744622-4744644 CTGTGAATACATCTGGTCCAGGG - Intergenic
1201979983 Y:19896270-19896292 CTGTGAACACATTTGGTCCTGGG - Intergenic