ID: 952844981

View in Genome Browser
Species Human (GRCh38)
Location 3:37680649-37680671
Sequence TCTCCCTGCCAAATATTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 290}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952844977_952844981 9 Left 952844977 3:37680617-37680639 CCTCCTCCATGGTCCTGGGCTCA 0: 1
1: 0
2: 2
3: 34
4: 316
Right 952844981 3:37680649-37680671 TCTCCCTGCCAAATATTCCATGG 0: 1
1: 0
2: 1
3: 23
4: 290
952844980_952844981 -4 Left 952844980 3:37680630-37680652 CCTGGGCTCATCTATACTGTCTC 0: 1
1: 0
2: 0
3: 9
4: 145
Right 952844981 3:37680649-37680671 TCTCCCTGCCAAATATTCCATGG 0: 1
1: 0
2: 1
3: 23
4: 290
952844975_952844981 11 Left 952844975 3:37680615-37680637 CCCCTCCTCCATGGTCCTGGGCT 0: 1
1: 0
2: 6
3: 47
4: 395
Right 952844981 3:37680649-37680671 TCTCCCTGCCAAATATTCCATGG 0: 1
1: 0
2: 1
3: 23
4: 290
952844979_952844981 3 Left 952844979 3:37680623-37680645 CCATGGTCCTGGGCTCATCTATA 0: 1
1: 0
2: 1
3: 17
4: 170
Right 952844981 3:37680649-37680671 TCTCCCTGCCAAATATTCCATGG 0: 1
1: 0
2: 1
3: 23
4: 290
952844978_952844981 6 Left 952844978 3:37680620-37680642 CCTCCATGGTCCTGGGCTCATCT 0: 1
1: 0
2: 3
3: 17
4: 223
Right 952844981 3:37680649-37680671 TCTCCCTGCCAAATATTCCATGG 0: 1
1: 0
2: 1
3: 23
4: 290
952844976_952844981 10 Left 952844976 3:37680616-37680638 CCCTCCTCCATGGTCCTGGGCTC 0: 1
1: 0
2: 3
3: 32
4: 384
Right 952844981 3:37680649-37680671 TCTCCCTGCCAAATATTCCATGG 0: 1
1: 0
2: 1
3: 23
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952844981 Original CRISPR TCTCCCTGCCAAATATTCCA TGG Intronic
901364170 1:8731287-8731309 TCTCCCTGCCTAAAATACGAGGG - Intronic
905535530 1:38718784-38718806 TAATCCTGCCTAATATTCCATGG + Intergenic
906377514 1:45307623-45307645 CATCCCTGCCAAATATTATAAGG + Intergenic
906378292 1:45314759-45314781 TGTCCCTGCCAAATACTATACGG - Intergenic
909036785 1:70602441-70602463 TCTTCCTCCCAAATTTTTCAGGG + Intergenic
910313452 1:85854952-85854974 TCGGCCTCCCAAATATTCCTAGG + Intronic
910833466 1:91483768-91483790 TATCCCTAACAAATATACCATGG + Intergenic
912412241 1:109487344-109487366 GCTTCCTTCCATATATTCCAGGG + Intronic
913487559 1:119346959-119346981 CATCCCTGCCAAATACTACAAGG - Intergenic
913995994 1:143652307-143652329 ACTCTCCGCCAAAGATTCCACGG + Intergenic
916285798 1:163103606-163103628 TATAGCTGCAAAATATTCCATGG + Intergenic
917092729 1:171370230-171370252 TCTGGCTGCATAATATTCCATGG - Intergenic
917154836 1:171985209-171985231 TTTCAATGCCATATATTCCATGG - Intronic
917510583 1:175666268-175666290 TCTCTCTGGCCAATAGTCCAAGG + Intronic
918325175 1:183403261-183403283 TCTCCCTCCCAAACTTTTCAAGG + Intronic
919239671 1:194896462-194896484 TATGGCTGCAAAATATTCCATGG + Intergenic
920410452 1:205755742-205755764 TCTACCTCCCAACTATTCCTAGG + Intergenic
920666781 1:207968736-207968758 CCTGCCTGCCAAATTTTCCTGGG + Intergenic
921827829 1:219693697-219693719 TCTCCATACCATGTATTCCAGGG + Intronic
923753194 1:236766005-236766027 TCTTCTTGTCAAATAATCCAGGG - Intergenic
1066119392 10:32269668-32269690 TATACATGGCAAATATTCCATGG + Intronic
1066371115 10:34819128-34819150 GCCCCCTTCAAAATATTCCAGGG + Intergenic
1068617503 10:59135729-59135751 TCTCCCTGCTAAATGCTCCTTGG + Intergenic
1068789762 10:61015018-61015040 ACTCCCTGCAATAAATTCCAAGG - Intergenic
1071727952 10:88218560-88218582 TGGCCCTTTCAAATATTCCAGGG - Intergenic
1074423415 10:113329496-113329518 ACTCCCAGCCAACTATGCCAGGG - Intergenic
1076923650 10:133469393-133469415 TCTGGCTGCATAATATTCCATGG - Intergenic
1078108757 11:8374937-8374959 CTTCCCTGCCAAATATCCCTTGG - Intergenic
1078829391 11:14965051-14965073 TCTTCATGCCAAATTCTCCAAGG - Intronic
1079289368 11:19173423-19173445 TCTCCCTGCCACTTATGGCAGGG + Intronic
1080357802 11:31472014-31472036 TCTCCCTGGCCATTATTCCATGG + Intronic
1082949574 11:58797669-58797691 TATCCCTGCCAAATACTATAAGG - Intergenic
1084332965 11:68440388-68440410 TCACCCTGCCAAAAGCTCCAGGG - Intronic
1086961583 11:92984039-92984061 TGTCCCTGCCACATATTCCGAGG - Intronic
1087048040 11:93860681-93860703 TATCCCTGCCAAATACTATAAGG + Intergenic
1088531991 11:110820449-110820471 TTTGCTTGCCAAATATTGCAGGG + Intergenic
1089358780 11:117872945-117872967 TCTCCCTGCAGAAGATTTCATGG + Intronic
1090828242 11:130402887-130402909 TCTCCCAGGAACATATTCCAGGG - Intergenic
1091421841 12:348561-348583 TCTGGCTGCACAATATTCCATGG - Intronic
1093521758 12:20059119-20059141 TATGGCTGCCTAATATTCCATGG + Intergenic
1093585175 12:20827192-20827214 TATCCCTGCTAAATATTATAAGG - Intronic
1093630721 12:21405989-21406011 ACTCCATGCCAAATATTTCTAGG + Intronic
1095218862 12:39583867-39583889 TCTAGCTGCATAATATTCCATGG + Intronic
1095247063 12:39935541-39935563 TCTCCCTGGGGAATATTGCAAGG + Intronic
1095268788 12:40191824-40191846 TATCCCTGACAAGTACTCCAAGG - Intergenic
1096765953 12:53889792-53889814 TCTTCCTGCCAAATTCTCTAAGG + Intergenic
1098408488 12:70153041-70153063 TATCCCTGCCAAATACTATAAGG + Intergenic
1098831264 12:75365970-75365992 TATCCCTGGCAAATATTATAAGG - Intronic
1099518471 12:83628828-83628850 TCTCTCATCCAAATGTTCCACGG + Intergenic
1099766730 12:86997256-86997278 TGTCCCTGCCAAATACTATAAGG + Intergenic
1100721692 12:97365867-97365889 TCTCCTTCCCAAAGAGTCCATGG + Intergenic
1101969454 12:109302708-109302730 TCTGCCTGACAAATATTGCCGGG + Intronic
1103149435 12:118624143-118624165 ACTCCCTGCCACCTATGCCATGG + Intergenic
1104213800 12:126715796-126715818 TCTCCCTGCAAAATGTTCACAGG - Intergenic
1104764904 12:131323050-131323072 TATCCCTGCCAAATACTATAAGG - Intergenic
1107007991 13:35636689-35636711 CATCCCTGCCAAATTTTCCCTGG - Intronic
1108509438 13:51141991-51142013 TATCCCTGCCAAATACTATAAGG + Intergenic
1109382251 13:61578329-61578351 TGTGCCTGCGTAATATTCCATGG - Intergenic
1109958251 13:69597475-69597497 TCTCCCTGCCAAAAATAAGATGG - Intergenic
1111267968 13:85844095-85844117 TCTGACTGCATAATATTCCATGG - Intergenic
1111348834 13:86999459-86999481 TCTCACTGCATAGTATTCCATGG - Intergenic
1111855212 13:93628403-93628425 TCTCCCTGCCCACTTTACCAAGG - Intronic
1112821595 13:103344135-103344157 TTTCCAGGCCAAATATTCCTAGG + Intergenic
1112898397 13:104330228-104330250 TATGGCTGCCTAATATTCCATGG + Intergenic
1114347714 14:21814290-21814312 TATGGCTGCAAAATATTCCATGG - Intergenic
1115337453 14:32255848-32255870 TTTCCCTGTCAAATTCTCCATGG + Intergenic
1115913478 14:38283092-38283114 TCTGAATGCCAAATATTCCTGGG + Intergenic
1116263085 14:42656028-42656050 TATCCCTGCCAAATACTATATGG + Intergenic
1117114994 14:52502057-52502079 TCACTCTGCCAAGTATTCCTAGG + Intronic
1117961863 14:61171315-61171337 TCACCCTGCTAAAGATTGCAGGG + Intergenic
1119365455 14:74087612-74087634 TCTCATTCCAAAATATTCCACGG + Intronic
1119884464 14:78128895-78128917 TCTTCCTGCCAAAAATTCCTGGG - Intergenic
1120009048 14:79392335-79392357 TATGGCTGCAAAATATTCCATGG + Intronic
1120680940 14:87479848-87479870 TCTTCCTCCCAAATATGACATGG + Intergenic
1121547656 14:94773662-94773684 TCTCCCTGACAAAAATACCTTGG - Intergenic
1122434237 14:101682295-101682317 TATCCCTGCCAAATACTATAAGG - Intergenic
1122949740 14:105035828-105035850 TATCCCTGCCAAATAATAAATGG + Intergenic
1126478157 15:49088977-49088999 TAGCACTGCCAATTATTCCAAGG - Intergenic
1126708093 15:51426102-51426124 TATCCTTGCCAAATATTATAAGG - Intergenic
1126976608 15:54189242-54189264 TCTCCCAGATAAATATTCCCTGG + Intronic
1128289665 15:66467932-66467954 TATCCCTGCCAAATATTATAAGG - Intronic
1128694632 15:69751510-69751532 TCTCCCCCTAAAATATTCCAGGG + Intergenic
1129311779 15:74717821-74717843 TCTCCCTGCCCCACATTCCCTGG + Intergenic
1130234522 15:82121737-82121759 TCCCACTCCCAAATATTTCAGGG - Intergenic
1130741592 15:86606314-86606336 TGTCCTTGCCAAATTTACCAGGG - Intronic
1133137775 16:3723963-3723985 TCTCCATGCCACATTATCCAGGG + Intergenic
1133535851 16:6701751-6701773 TCTGGCTGCATAATATTCCATGG - Intronic
1138011542 16:53385475-53385497 ACTCCCTTCTAAATAATCCATGG - Intergenic
1138239901 16:55418957-55418979 CCTACCTGCAAAATATTCTAGGG + Intronic
1139488108 16:67270806-67270828 TCCCCCTGCCCACTCTTCCAGGG - Exonic
1140322877 16:73970721-73970743 TCTTCTTGTTAAATATTCCATGG - Intergenic
1140458823 16:75121932-75121954 TATCCCTGCCAAATACTATAAGG + Intergenic
1141970827 16:87481499-87481521 TCTCCCTGCCACACTTGCCATGG - Intronic
1144720432 17:17465667-17465689 TCTCCCTTTAAAAAATTCCAGGG + Intergenic
1145393507 17:22475733-22475755 TCTGCCAGCCATATCTTCCAGGG + Intergenic
1146942318 17:36851854-36851876 GCTCCCACCCAAATAATCCAAGG + Intergenic
1148048515 17:44758408-44758430 TCTCCCCGCCAAAGATGCCCCGG - Intergenic
1148950886 17:51311298-51311320 TATCCCTGCCAAATACTATAAGG + Intergenic
1149026907 17:52037228-52037250 TCTCCCTACATAATATTGCAGGG - Intronic
1149472431 17:56928394-56928416 TATCCCTGCCAAATACTACAAGG + Intergenic
1149819573 17:59761968-59761990 CATGCCTGCCAAAAATTCCATGG - Intronic
1150476340 17:65478754-65478776 TCTCATTGCCATATATGCCAAGG - Intergenic
1152842401 17:82578671-82578693 TCTCCCTGACAACAACTCCAAGG - Intronic
1154105256 18:11517325-11517347 TCTCTCTTGCAAATATTCTATGG + Intergenic
1156220959 18:35051430-35051452 TCTGCCTGTCAAAAATTTCAGGG - Intronic
1156581967 18:38387797-38387819 TCTACCTGCCACATAGCCCAAGG + Intergenic
1156727701 18:40148999-40149021 TCTTCTTGCCAAATCCTCCAGGG + Intergenic
1157912631 18:51632262-51632284 TATCCCTGCGAAATACTACAAGG + Intergenic
1158613928 18:58968607-58968629 TCTACCTGCCATGGATTCCAGGG - Intronic
1162993576 19:14319275-14319297 TCTGCATGACAAAAATTCCAGGG + Intergenic
1167051944 19:47084753-47084775 TCTCCCTGCAAAACCTTCCAGGG + Intronic
1168438680 19:56344432-56344454 TATCCCTGCCAAATACTATAAGG - Intronic
925553570 2:5103525-5103547 TATGCCTGCATAATATTCCATGG + Intergenic
926087587 2:10029672-10029694 TGTCCCTGCCAAGCTTTCCAGGG + Intergenic
927478142 2:23429643-23429665 TCTCCCTGCCTTAGCTTCCAGGG - Intronic
929842985 2:45490268-45490290 TCTTCCTGCCCAATAGTCCAAGG - Intronic
930494945 2:52129307-52129329 TATCCCTGCTAAATATTATAAGG + Intergenic
931548667 2:63417147-63417169 TCTTCTTGCCAAATAATCCAGGG - Intronic
935153011 2:100455696-100455718 TATCCCTGCCAAATACTATAAGG + Intergenic
935337171 2:102027147-102027169 CCACCCTGTCAAATATTCCTAGG + Intronic
937420407 2:121749752-121749774 TCTTCCTTCCGAATGTTCCAAGG - Intronic
937508712 2:122568792-122568814 TATGCCTGCATAATATTCCATGG - Intergenic
938779601 2:134573412-134573434 TCTCACTGCCAAATACCCCCTGG - Intronic
939254584 2:139726103-139726125 TATCCCTGCTAAATATTATAAGG + Intergenic
939339302 2:140873187-140873209 TATCCCTGCCGAATATTATAAGG + Intronic
940739404 2:157490068-157490090 TCTCCCTCTTAAATACTCCATGG - Intergenic
942419665 2:175795025-175795047 CAACCCTGGCAAATATTCCAAGG + Intergenic
945192509 2:207204373-207204395 TCAGCCTTCCAAGTATTCCAGGG - Intergenic
946615596 2:221506070-221506092 TCTCTTTGCCAAATATTGTATGG - Intronic
947400772 2:229729597-229729619 TATGGCTGCAAAATATTCCATGG - Intergenic
948208081 2:236173297-236173319 TCTCCCTCCCCAACACTCCAAGG - Intergenic
1169597384 20:7215831-7215853 TCTCCCTGCCTCATTTTGCAAGG + Intergenic
1171034916 20:21706715-21706737 TCTCCCAGGCAAAGATGCCAGGG - Exonic
1172624697 20:36340438-36340460 ACTCCCTGCCACATGTGCCACGG - Intronic
1173251219 20:41365177-41365199 TCGCTCAGCCAGATATTCCAGGG - Intronic
1173339430 20:42140440-42140462 TGTCACTGCCAAATATTCGTAGG - Intronic
1173591180 20:44226118-44226140 TATGGCTGCCTAATATTCCACGG + Intergenic
1173914890 20:46699911-46699933 TCGCATTGCCAAATATTCCCTGG - Intergenic
1174327868 20:49793776-49793798 TCTCCTTGCCCACTATCCCATGG + Intergenic
1175572214 20:60032347-60032369 TCTCCCTGGCAAATAGATCATGG - Intronic
1175721820 20:61292282-61292304 ACTGGCTGCCTAATATTCCATGG - Intronic
1177006996 21:15685897-15685919 TCTCCCTTCCCCACATTCCATGG - Intergenic
1177505244 21:22011762-22011784 TCTGCCTGCCTTATATTCCCTGG + Intergenic
1178175524 21:30093610-30093632 TGTCCCTGCATAGTATTCCATGG - Intergenic
1178457213 21:32766579-32766601 TCTCTCTGCCAAACTTCCCAAGG + Intronic
1178956011 21:37022549-37022571 TATGGCTGCGAAATATTCCATGG + Intergenic
1179522080 21:41952359-41952381 TCAACCTTCAAAATATTCCATGG - Intronic
1179770123 21:43609071-43609093 TCTGGCTGCGAAGTATTCCATGG - Intronic
1180305675 22:11121596-11121618 ACTCTCTGCCAAATAATCTATGG - Intergenic
1180544194 22:16483779-16483801 ACTCTCTGCCAAATAATCTATGG - Intergenic
1181106282 22:20577612-20577634 TCTCCATGGCATTTATTCCAAGG - Intronic
1183527947 22:38335171-38335193 TCTCCCTTCATAATCTTCCATGG + Intronic
1185405652 22:50647714-50647736 TATCCCTGCCAAATACTATAAGG + Intergenic
950249218 3:11450016-11450038 GCTCCCTTCCAAATCTTACAGGG + Intronic
950946106 3:16948163-16948185 TCTTATTGCCAAATATTCCATGG - Intronic
951965057 3:28372963-28372985 TCTGGCTGCATAATATTCCATGG + Intronic
952844981 3:37680649-37680671 TCTCCCTGCCAAATATTCCATGG + Intronic
955416122 3:58693075-58693097 TATCCCTGCCAAATACTATAAGG - Intergenic
955689687 3:61578858-61578880 CCACCCTGCCAAACATTCCCTGG - Intronic
956740117 3:72269161-72269183 TCTGGCTGCCGAATGTTCCAGGG - Intergenic
957375122 3:79345746-79345768 TTACCCTGCCATACATTCCAGGG + Intronic
957839104 3:85642989-85643011 TCTCCTTGCAAAATTTGCCAAGG - Intronic
958624762 3:96609804-96609826 TACCCCTGCCAAATGTTCCTTGG + Intergenic
958743833 3:98109605-98109627 TCTGCAAGCCAAATATTTCATGG + Intergenic
958954098 3:100448515-100448537 TATCCCTGCCAAATACTATAAGG - Intronic
961412610 3:126733591-126733613 CCTCCCTGTCATATATTACATGG - Intronic
961865822 3:129952906-129952928 TCACCCTGCCACACATCCCAAGG - Intergenic
962927485 3:140008339-140008361 TCTCTTTGCCCAGTATTCCAAGG + Intronic
963216795 3:142757454-142757476 TCTACATGCCTAGTATTCCAGGG - Intronic
964023108 3:152038976-152038998 TATCCCTGCCAAATACTATAAGG - Intergenic
967244578 3:187472761-187472783 TATCCCTTCCAAATACTACAAGG + Intergenic
967475996 3:189919859-189919881 TCTTCTTGGCGAATATTCCATGG - Intergenic
969727432 4:8929739-8929761 TATCCCTGCCAAATACTATAAGG + Intergenic
971111006 4:23586057-23586079 TCACCCTGCCTTATATTCCTTGG - Intergenic
971692908 4:29860598-29860620 TATCCCTGCCAAATAATATAAGG + Intergenic
971955485 4:33412364-33412386 TATCCCTGCCAAATACTATAAGG + Intergenic
973245681 4:48009044-48009066 TATCCCTGCCAAATACTATAAGG - Intronic
974509560 4:62820804-62820826 CCTTACTGACAAATATTCCACGG - Intergenic
974596431 4:64018903-64018925 TATGGCTGCCAAGTATTCCATGG + Intergenic
974974088 4:68868116-68868138 TTTTCCTGCCAAATATTGTAAGG + Intergenic
976778969 4:88737671-88737693 CCTCCCTGCCAAACACTCCCAGG + Intronic
977720461 4:100234313-100234335 TATCCCTGCCAAATACTGTAAGG - Intergenic
978352813 4:107838075-107838097 TCTGCCTACAAAATATTCCCTGG - Intronic
978357177 4:107889316-107889338 TATCCCTGCCAAATACTATAAGG - Intronic
979286609 4:118932818-118932840 TGTCCCTTACAAATCTTCCAAGG + Intronic
980336287 4:131477828-131477850 TCTCACTGCCAAAAATTTCCTGG - Intergenic
980796458 4:137690546-137690568 TGTTCCTTCCAAATCTTCCAGGG + Intergenic
981047601 4:140279809-140279831 TCTCCCAGGCCAGTATTCCAGGG + Intronic
981202500 4:141997218-141997240 TCTGGCTGCATAATATTCCATGG + Intergenic
981292550 4:143092820-143092842 TATCCCTGCCAAATACTACAAGG + Intergenic
981924186 4:150119732-150119754 TCTCCCTGCTAAATATTTTCAGG - Intronic
984031396 4:174608586-174608608 TATCCCTGCCAAATACTATAAGG + Intergenic
984414906 4:179446007-179446029 TCTGCATGCCTAATATTTCATGG - Intergenic
985222477 4:187722583-187722605 TGTCCCTGCGTAGTATTCCATGG - Intergenic
986414626 5:7516191-7516213 ACTAGCTGCAAAATATTCCATGG - Intronic
986612358 5:9582123-9582145 TCTCCCTGACAAAGCTTCCCAGG + Intergenic
987460587 5:18204567-18204589 TATGGCTGCCTAATATTCCATGG + Intergenic
987538890 5:19227814-19227836 CCTCCACGCCAAATAATCCAAGG - Intergenic
987656318 5:20811886-20811908 TTGCCCTGCCAAATATCACAGGG + Intergenic
988767239 5:34392052-34392074 TTGCCCTGCCAAATATCACAGGG - Intergenic
988769456 5:34417108-34417130 TATCCCTGCCAAATACTATAAGG + Intergenic
989316688 5:40088602-40088624 TATCCCTGCCAAATACTATAAGG + Intergenic
990215379 5:53526003-53526025 TCTGGCTGCCTAGTATTCCATGG + Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
990747729 5:58978037-58978059 TCTCCCTGCCTAAAATTCACAGG - Intronic
991100646 5:62788828-62788850 TCTCCCTCCCAAAGATTCCAGGG - Intergenic
991306930 5:65186830-65186852 AATTCCTGCCAAAGATTCCATGG + Intronic
991360245 5:65812273-65812295 TCCCCCTGCCAAATGTCCAAAGG - Exonic
991423947 5:66471083-66471105 TATCCCTGCCAAATACTGTAAGG - Intergenic
991503452 5:67300659-67300681 TCTCTCTTCTAAGTATTCCATGG - Intergenic
991563715 5:67982801-67982823 TCCCCCTCCCAAATCCTCCAAGG + Intergenic
992527245 5:77623911-77623933 TCTCCCTGTAAAATCTTGCAGGG + Intergenic
992539955 5:77754761-77754783 TATCTCTGCCAAATACTCTAAGG - Intronic
995064046 5:107840528-107840550 TCTCACTGCCAAGTGTTGCAAGG + Intergenic
995180232 5:109224167-109224189 TCTCCATGCTAAATATGCCCAGG + Intergenic
995494560 5:112726804-112726826 TTTCCCTCCCAAGTACTCCAAGG - Intronic
995947919 5:117672170-117672192 GCTACCTGTGAAATATTCCATGG - Intergenic
997438179 5:133890145-133890167 AGTCCTTACCAAATATTCCAGGG - Intergenic
999921264 5:156323678-156323700 TCTCCCTATCACATATTCTATGG - Intronic
1001058516 5:168468737-168468759 GCTCATTGCCAAATGTTCCAGGG - Intronic
1002442475 5:179271560-179271582 CTTCCCTGCAAAATAGTCCAAGG + Intronic
1002670881 5:180865685-180865707 TCTTCTTGTCAATTATTCCAAGG - Intergenic
1003026043 6:2556694-2556716 TCTCCCTGGCAAATATACAGAGG + Intergenic
1003654938 6:7998435-7998457 TCTGGCTCCAAAATATTCCACGG + Intronic
1004646494 6:17566835-17566857 TATCCCTGCCAAATACTGTAAGG - Intergenic
1005370919 6:25131836-25131858 TATCCCTGCCAAATACTATAAGG + Intergenic
1007070932 6:39037712-39037734 TCCCACAGCCAAATGTTCCATGG - Intergenic
1008142854 6:47852103-47852125 GCAACTTGCCAAATATTCCATGG + Intergenic
1008650668 6:53558367-53558389 TATCCCTGCCAAATACTGTAAGG + Intronic
1009038069 6:58142255-58142277 TTTTTCTGCCAAATGTTCCAGGG + Intergenic
1009213861 6:60895891-60895913 TTTTTCTGCCAAATGTTCCAGGG + Intergenic
1010655447 6:78506314-78506336 TGTCCCTTCCAAATAGACCATGG - Intergenic
1011397831 6:86928777-86928799 TCACCCTGCCAAATACTCCCAGG + Intergenic
1012751803 6:103173701-103173723 TCTCCTTGCCACATATTTCTTGG + Intergenic
1014110457 6:117615069-117615091 TATCCCTGCCAAATACTACAAGG + Intergenic
1014138650 6:117916630-117916652 TTTCCCTGCCTCACATTCCAGGG - Intronic
1017460864 6:154648764-154648786 TCTTGCTGCCAACGATTCCATGG - Intergenic
1018067253 6:160132871-160132893 TTTCCCTTTCAAATATTCTAAGG + Intronic
1018179670 6:161210743-161210765 TATCCCTGCCAAATACTATAAGG + Intronic
1020706912 7:11556568-11556590 TCTCCTTTCCTGATATTCCAAGG + Intronic
1021147708 7:17109095-17109117 TATCCCTGCCAAATACTATAAGG + Intergenic
1021496462 7:21280151-21280173 TCTGGCTGCATAATATTCCATGG + Intergenic
1022695087 7:32697315-32697337 TATGACTGCAAAATATTCCATGG + Intergenic
1024358719 7:48445346-48445368 TCTCACTCCCAAATATTTAATGG + Intronic
1024906766 7:54391806-54391828 TATCCCTGCCAAATACTATAAGG - Intergenic
1028064217 7:86361578-86361600 TCTGCCTGCAACATATTCCCTGG - Intergenic
1028858704 7:95622340-95622362 TCTGCCTGCCTGATGTTCCATGG - Intergenic
1030203593 7:106930273-106930295 TCTGAATTCCAAATATTCCATGG - Intergenic
1030674526 7:112370627-112370649 GCTCCCTGCCAAATTGGCCAAGG - Intergenic
1035123103 7:156585393-156585415 TCTCCCTGCCTAAAATACAAGGG - Intergenic
1037955234 8:23051383-23051405 TATCTCTGCCAAATATTATAAGG + Intronic
1039749707 8:40466145-40466167 TCTCCCTCCCAGATACTCCCAGG + Intergenic
1039805425 8:40993664-40993686 TCTCCCTGCCACATCCTCCCCGG + Intergenic
1040067051 8:43154535-43154557 TATCGCTGCCTAGTATTCCATGG + Intronic
1040483435 8:47848285-47848307 TATGGCTGCCTAATATTCCATGG - Intronic
1040764329 8:50888688-50888710 TATGCCTGCATAATATTCCATGG + Intergenic
1041276488 8:56164989-56165011 TCTCCATCCAAAATATTGCAAGG + Exonic
1041635609 8:60139169-60139191 TCTCCCTGCCCAACTCTCCAAGG + Intergenic
1041933838 8:63315270-63315292 TCTCCCAGGCAGATATTTCATGG - Intergenic
1043560117 8:81483392-81483414 TCTCCCTGGCAAATAGTCACTGG + Intergenic
1045114299 8:98966295-98966317 TCTCTCATCCAAATATGCCAAGG + Intergenic
1045847902 8:106658447-106658469 TTTCCCCGCCAAGTATTTCAAGG + Intronic
1045984001 8:108226601-108226623 TCTTCCTTCCAAATATCCAATGG + Intronic
1046129039 8:109944749-109944771 TCTCCCTGCTTTATATTCCCTGG + Intergenic
1046222168 8:111230536-111230558 TATCCCTGCCAAATACTATAAGG + Intergenic
1046247910 8:111590876-111590898 TATGTCTGCCTAATATTCCATGG - Intergenic
1046327733 8:112672114-112672136 TGTCCCTGCCCTATATTTCAAGG - Intronic
1046581860 8:116103030-116103052 TCTTCCTTCCAAATGTACCAAGG - Intergenic
1047363960 8:124195403-124195425 GCTCCCTGCCAAAAATGCCTTGG + Intergenic
1048294482 8:133204438-133204460 TATCCCTGCCCAATGTTCTAAGG + Intronic
1049448738 8:142646542-142646564 TCTCCCTGCCAAATACTGTAAGG - Intergenic
1049954287 9:677874-677896 TAGCCCTGCCCAATATTTCACGG - Intronic
1051762190 9:20479819-20479841 TTTCCCTGCAAAATATTTCATGG - Intronic
1052206702 9:25850185-25850207 TATCCCTGCCAAATACTTCAAGG + Intergenic
1053077974 9:35151168-35151190 TATCCCTGCCAAATACTGTAAGG - Intergenic
1053433249 9:38058060-38058082 TATCCCTGGCAAATATACCATGG + Intronic
1054938029 9:70710111-70710133 TCTGACGGCAAAATATTCCAGGG - Intronic
1054939720 9:70728104-70728126 TCTGACGGCAAAATATTCCAGGG - Intronic
1057235805 9:93358886-93358908 TATCCCTGCCAAATACTAAAAGG + Intergenic
1057467480 9:95328666-95328688 TATCCCTGCCAAATACTATAGGG - Intergenic
1057909961 9:99012058-99012080 TATCCCTGCCAAATACTATAAGG - Intronic
1058064750 9:100536435-100536457 CCTCCCTGCTCAATTTTCCAAGG - Intronic
1058816241 9:108685023-108685045 ACTCCCTGCCCAGTAATCCATGG + Intergenic
1060633565 9:125181643-125181665 TGTCCCTGCAAAGTATTCCATGG + Intronic
1060795764 9:126511657-126511679 TCTCCCTGCCCAATGTTCCCAGG - Intergenic
1186209695 X:7236541-7236563 TATCCCTGCCAAATACTATAAGG - Intronic
1186826938 X:13349825-13349847 TCTGGCTGCCAAAGAATCCAGGG + Intergenic
1188167822 X:26884173-26884195 TATCTCTGCCAAATACTACAAGG - Intergenic
1191069202 X:56381715-56381737 TATCCCTGCCAAATACTATAAGG - Intergenic
1192537407 X:71940006-71940028 TCTCCCTGCACAGTCTTCCAAGG - Intergenic
1193973236 X:88084165-88084187 TCTGGCTGCATAATATTCCATGG + Intergenic
1194003869 X:88466356-88466378 TATCCCTGCCAAATACTATAAGG + Intergenic
1194501613 X:94689089-94689111 TATCCCTGCCAAATACTATAAGG - Intergenic
1194886834 X:99326107-99326129 TATCCCTGCCAAATATCATAAGG + Intergenic
1195150419 X:102062801-102062823 TATCCCTACCAAATACTACAAGG + Intergenic
1196363889 X:114900629-114900651 TCTCCATGCAAAATAACCCATGG + Intronic
1196772843 X:119312288-119312310 TATCCCTGCCAAATACTACAAGG + Intergenic
1196884535 X:120230610-120230632 TATCCCTGCCAAATATTATAAGG + Intergenic
1197295765 X:124717202-124717224 TCTGACTGCATAATATTCCATGG - Intronic
1197490584 X:127111946-127111968 TATGCCTGCATAATATTCCATGG - Intergenic
1197568532 X:128119066-128119088 TATCCCTGCCAAATAATAAAAGG - Intergenic
1197993425 X:132343964-132343986 TCTCCCTCCCAAACAGTACACGG - Intergenic
1198644239 X:138788744-138788766 TCTCCCTGTCAAAGATTCCTTGG + Intronic
1199160589 X:144606417-144606439 TATCCCTGCCAAATACTATAAGG - Intergenic
1199186191 X:144918402-144918424 TATCCCTGCCAAATACTATAAGG - Intergenic
1199468009 X:148161527-148161549 TCCCCCAGCAAAAGATTCCAAGG - Intergenic
1199498536 X:148483215-148483237 TATGCCTGCATAATATTCCATGG - Intergenic
1199887724 X:152038262-152038284 TATTCCTGCCAAATATTATAAGG - Intergenic
1200285521 X:154818574-154818596 TATCCCTGCCAAATATTATAAGG - Intronic
1200384497 X:155876315-155876337 TATGACTGCCTAATATTCCATGG - Intergenic
1200696359 Y:6364509-6364531 TTTCACTGCCAAAGATTTCAAGG - Intergenic
1201037755 Y:9800191-9800213 TTTCACTGCCAAAGATTTCAAGG + Intergenic
1201319532 Y:12683035-12683057 TATCCCTGGCAAATATTATAAGG + Intergenic
1201679040 Y:16621986-16622008 TATCCCTGCAAAGTATTCCATGG + Intergenic
1201683464 Y:16675231-16675253 TCACTTTGCCAAATATTTCAAGG - Intergenic