ID: 952845020

View in Genome Browser
Species Human (GRCh38)
Location 3:37681052-37681074
Sequence CTCTTCACGGATGGGTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952845015_952845020 3 Left 952845015 3:37681026-37681048 CCAGACATGCAGGAGAGTGAGGT 0: 1
1: 0
2: 1
3: 39
4: 508
Right 952845020 3:37681052-37681074 CTCTTCACGGATGGGTAATGAGG 0: 1
1: 0
2: 0
3: 9
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952845020 Original CRISPR CTCTTCACGGATGGGTAATG AGG Intronic