ID: 952845020

View in Genome Browser
Species Human (GRCh38)
Location 3:37681052-37681074
Sequence CTCTTCACGGATGGGTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952845015_952845020 3 Left 952845015 3:37681026-37681048 CCAGACATGCAGGAGAGTGAGGT 0: 1
1: 0
2: 1
3: 39
4: 508
Right 952845020 3:37681052-37681074 CTCTTCACGGATGGGTAATGAGG 0: 1
1: 0
2: 0
3: 9
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952845020 Original CRISPR CTCTTCACGGATGGGTAATG AGG Intronic
904473712 1:30751272-30751294 CGCTTCACGGAGGGGTGAGGAGG - Intronic
908251865 1:62272209-62272231 CTCTTCACTGTCGGGTAAAGTGG - Intronic
911250036 1:95564955-95564977 CTCTTCAAGGCTGGGTATGGTGG - Intergenic
912649259 1:111423669-111423691 CTTTTCACGGTTGGCAAATGTGG + Exonic
917037776 1:170768059-170768081 CTTTTCTCAGATGGGTAATGTGG + Intergenic
922135791 1:222825131-222825153 CTCCCCAGGGATGGGGAATGTGG + Intergenic
922863536 1:228839471-228839493 CTCTTCACAGAGGGCTTATGGGG + Intergenic
923538087 1:234868497-234868519 CCCTTCACAGATGGGGAATCTGG + Intergenic
923898724 1:238302572-238302594 CCCTTGACAGATGGTTAATGAGG - Intergenic
1065963889 10:30755122-30755144 CCCTTCAAGGAGGGGTGATGAGG + Intergenic
1071295361 10:84215426-84215448 CTCTTCAAGGATGGCTGGTGGGG - Exonic
1073751975 10:106539283-106539305 CTCTTCACAGATGGGGGATCTGG - Intergenic
1076037682 10:127214582-127214604 CTCTTCATGGATGGGTACCTGGG + Intronic
1076089963 10:127676044-127676066 CTCTTCAACAATGGCTAATGTGG - Intergenic
1081812009 11:45919404-45919426 CTGTTCACAGATGGGAAATTAGG + Intergenic
1083714095 11:64565773-64565795 CACTTCACTGATGGGGAAAGAGG + Intronic
1087439249 11:98161688-98161710 CTTTTCACGGATGGTGAAAGCGG - Intergenic
1089676040 11:120090396-120090418 GTATCCAAGGATGGGTAATGGGG + Intergenic
1091449062 12:561520-561542 CTGTTCAGGGATGGGGAGTGGGG + Exonic
1092227007 12:6753846-6753868 CCCTTCACAGATGGGTAACGGGG - Intronic
1092972293 12:13708200-13708222 CTCTTTGAGGCTGGGTAATGAGG + Intronic
1100560735 12:95746959-95746981 CTCATCCAGGATGGGTAATAAGG - Intronic
1102616170 12:114156219-114156241 CACTTCAGGGATGTGTAAAGAGG + Intergenic
1114659476 14:24335236-24335258 CCCTTCAGGGAAGGGCAATGTGG + Intronic
1122855902 14:104559946-104559968 CTCTTGACAGATGGGGAAGGGGG + Intronic
1125062124 15:35437335-35437357 TTCTTCACAGATGAGTAATTGGG + Intronic
1153005616 18:496444-496466 CCCTTCACTGATTGGTAATAGGG - Intronic
1156825096 18:41421131-41421153 ATCTGCACGGATGGCTAAGGTGG + Intergenic
1156974505 18:43202105-43202127 CTCTACACGCATGGGTCATATGG + Intergenic
1166878638 19:45913697-45913719 CTCCTGACGGATGGGTACTGAGG + Exonic
926352715 2:12011431-12011453 CCCTTCAGGGATGAGTAATCTGG - Intergenic
939223118 2:139328898-139328920 GTCTTCACGGTTGGGGAAGGTGG - Intergenic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
1168765142 20:377090-377112 CACTTCAAGTATGGCTAATGTGG + Intronic
1169945347 20:10982457-10982479 CTCTTTAGAGATGTGTAATGTGG - Intergenic
1170929441 20:20755548-20755570 CTCTTCTTGGATGTCTAATGGGG + Intergenic
1173428265 20:42961664-42961686 CTCTCCAGGGAGGGGTACTGTGG + Intronic
1173893438 20:46531258-46531280 CTCTTCATGGCTGGGTATGGTGG - Intergenic
1181022987 22:20113220-20113242 CTCTTCAGAGTTGAGTAATGTGG - Exonic
1181495326 22:23284356-23284378 CGCTTCCCGGATGGGTCCTGAGG - Intronic
1185231924 22:49688451-49688473 CTCTGCACGGATGGGTCCTGGGG - Intergenic
951797451 3:26556324-26556346 CTATTCACGGATGGGCACTTAGG - Intergenic
952845020 3:37681052-37681074 CTCTTCACGGATGGGTAATGAGG + Intronic
961098923 3:124181815-124181837 CTCTTCTCTGATGGGGAAGGAGG + Intronic
967408128 3:189139899-189139921 CTCTGCACGGATTGACAATGTGG - Intronic
969624151 4:8293868-8293890 CTCTCCAGGGATGGGGAAGGGGG + Intronic
969881149 4:10175128-10175150 CTCGTCTGAGATGGGTAATGTGG + Intergenic
976772403 4:88667720-88667742 CTTTTCATGGATGTGTACTGAGG + Intronic
978002352 4:103572079-103572101 CTCTTCAGGGATGAGTCATGTGG + Intergenic
979549235 4:121971877-121971899 CTCTTCATGGCTGGGCACTGTGG - Intergenic
980016931 4:127660522-127660544 CTCTTCACAGATGGGACCTGGGG - Intronic
988997340 5:36727064-36727086 CTCTTGAAGGATCAGTAATGTGG + Intergenic
991503159 5:67297715-67297737 AACATCACTGATGGGTAATGGGG - Intergenic
1013502640 6:110767641-110767663 CTCTTCATGGCTGGGTGCTGTGG - Intronic
1024477604 7:49830315-49830337 CTCTTCACTGGGGGGTGATGAGG + Intronic
1028851835 7:95546514-95546536 CTCTTCAGGGATGGCAAAAGTGG + Intergenic
1032183658 7:129704321-129704343 TTTTTCAAGGATGGGTAAAGTGG - Intronic
1033096721 7:138438703-138438725 TTCTTCAGGGATGGGGAATGGGG + Intergenic
1037656250 8:20886804-20886826 CTCTTCAGGGCTGGGACATGGGG - Intergenic
1038660801 8:29494990-29495012 CACCTCACAGATGGGTAAGGAGG - Intergenic
1038920676 8:32080597-32080619 CTCTTCACAGATGGTTAAGTTGG - Intronic
1039266247 8:35827145-35827167 AGCTTCACGGTTGGGTAATAAGG - Intergenic
1041277555 8:56178632-56178654 CTCTTCACTGATGGCAGATGGGG - Intronic
1046777482 8:118179475-118179497 GTCTTCAGGGATGCTTAATGTGG + Intergenic
1186087060 X:6002280-6002302 CTCTTTGCGGTTGGGTCATGAGG - Intronic
1188784356 X:34326258-34326280 CTCTTCTAGGAAGGGGAATGAGG + Intergenic
1189473835 X:41334243-41334265 CTCTTCAGGGATGAGTCATGTGG + Exonic
1192763566 X:74121002-74121024 CTCTTCAGGGATGAGTCATGTGG + Intergenic
1195004886 X:100676162-100676184 CTCCTCAGGGATCAGTAATGGGG - Exonic
1195687610 X:107600789-107600811 CTCTTCACTGAGGGATGATGTGG - Exonic
1200898573 Y:8403672-8403694 CTCTTTACAGATAGGTAATCAGG + Intergenic
1201338417 Y:12904927-12904949 CTCTTCAGGGATGAGTCATGTGG + Exonic