ID: 952845020 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:37681052-37681074 |
Sequence | CTCTTCACGGATGGGTAATG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 72 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 62} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
952845015_952845020 | 3 | Left | 952845015 | 3:37681026-37681048 | CCAGACATGCAGGAGAGTGAGGT | 0: 1 1: 0 2: 1 3: 39 4: 508 |
||
Right | 952845020 | 3:37681052-37681074 | CTCTTCACGGATGGGTAATGAGG | 0: 1 1: 0 2: 0 3: 9 4: 62 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
952845020 | Original CRISPR | CTCTTCACGGATGGGTAATG AGG | Intronic | ||