ID: 952848828

View in Genome Browser
Species Human (GRCh38)
Location 3:37711323-37711345
Sequence TCTCCTGGATGGTTTCATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952848828 Original CRISPR TCTCCTGGATGGTTTCATTG GGG (reversed) Intronic
901518666 1:9766818-9766840 TCGCCCGGATTGTTTCCTTGGGG - Intronic
901802473 1:11716472-11716494 TCTCCTGGATGGGGGAATTGGGG + Intronic
903662098 1:24984502-24984524 TCTCCTGGAGGGCTGCATGGAGG + Intergenic
904958268 1:34306883-34306905 TGTCCTGGAGGGTTTGATTGTGG - Intergenic
905851696 1:41279569-41279591 TCTTCTGGATTGCCTCATTGGGG + Intergenic
910417749 1:87018540-87018562 TCTTCTGGGTGGTTTTATAGTGG + Intronic
913023055 1:114806088-114806110 ACTCCTGGATGGGTTCATAGTGG + Intergenic
913532047 1:119740487-119740509 TCACCTGGATGGTCCCTTTGGGG - Exonic
915139057 1:153755216-153755238 TCTCCTAGATAATTTGATTGAGG + Intronic
919444920 1:197691137-197691159 TCTTCAGGATGTTTTCTTTGAGG - Intronic
919892694 1:201987272-201987294 ACTCCAGGATGATTTCATAGGGG - Intronic
922231989 1:223695458-223695480 TCTCCTGCATGTTTTCATGAAGG + Intergenic
923384719 1:233454745-233454767 TCTCCAGGCTGGTCTCCTTGAGG + Intergenic
1064976065 10:21117173-21117195 TCTCCTGGTGGGTCTCATGGTGG - Intronic
1070323022 10:75368777-75368799 ACTAATGGATGGTTTCATTCAGG + Intergenic
1075423355 10:122322804-122322826 ACTCTTGGAGGGTTTCCTTGGGG - Intronic
1075876767 10:125813952-125813974 TGTCCTGGATGCTTTCCTTTGGG + Intronic
1078838193 11:15052200-15052222 TTTCCTGGAGGATTTCCTTGAGG - Intronic
1081201136 11:40216628-40216650 TCTCCTGGATCTTTTTCTTGCGG - Intronic
1083145251 11:60753268-60753290 ACTCCTGTATGGATTCATTCTGG + Intergenic
1086179328 11:83931840-83931862 CCTTCAGGATGGTTTCATAGTGG + Intronic
1086397362 11:86430943-86430965 TCTTTTGGAAGTTTTCATTGGGG - Intergenic
1090586812 11:128222014-128222036 TCTCCTGTATTGTCTCCTTGAGG + Intergenic
1090617670 11:128530636-128530658 CCTCCTGGATGGGTCCCTTGTGG - Intronic
1091850337 12:3692331-3692353 TGACCTGGAGGGTTTGATTGTGG + Intronic
1093690066 12:22100708-22100730 GCTCCTGTATAGTTTTATTGTGG + Intronic
1094120091 12:26963566-26963588 TCTCCTGGATGCTGTCTATGTGG + Intronic
1095468337 12:42511106-42511128 TCTTCTGGCTGGTTTTATTGTGG - Intronic
1096796095 12:54078436-54078458 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1097176436 12:57146061-57146083 TATCCTGGATGCTTCCATTCAGG + Intronic
1105855097 13:24365506-24365528 TCCCCTGGATGGCTCCAGTGAGG + Intergenic
1106197960 13:27510151-27510173 ACACCTGGGTGGTTTCCTTGTGG - Intergenic
1106719482 13:32423984-32424006 ACCCATGGATGCTTTCATTGAGG + Intronic
1106781366 13:33061903-33061925 TCTCTTGGACTGTTTCAGTGAGG - Intronic
1107226495 13:38055543-38055565 TCTGCTGGATGGCTCAATTGTGG - Intergenic
1107966371 13:45601889-45601911 TCTCCTGGAAGGATGCAATGAGG + Intronic
1109572306 13:64208885-64208907 TGTCTTGAATGGCTTCATTGTGG + Intergenic
1109923700 13:69105982-69106004 TCTCCTTGATAATTCCATTGGGG - Intergenic
1112392142 13:98995351-98995373 TTTACTGGTTGATTTCATTGTGG - Intronic
1115942856 14:38628246-38628268 TCACCTTGAGGGGTTCATTGTGG - Intergenic
1118234341 14:63987443-63987465 TCTCCTGGGAGTTATCATTGAGG + Intronic
1119710666 14:76820592-76820614 TATCCTGGTTGATTTTATTGTGG - Intronic
1124244075 15:28055524-28055546 GCTCCTAGATGGTTTGTTTGGGG + Intronic
1124418941 15:29501087-29501109 TCGACCAGATGGTTTCATTGGGG + Intronic
1126266127 15:46755996-46756018 CCTCCTGACTGGTTTCATGGGGG + Intergenic
1127291844 15:57578520-57578542 TCTTCTGGATAGTTTTGTTGAGG + Intergenic
1127901172 15:63342001-63342023 TGTCCTGGCTGTTCTCATTGAGG - Exonic
1128343152 15:66836720-66836742 TCTACTGCCTGGTTTCCTTGGGG + Intergenic
1129137410 15:73566900-73566922 TCCCCTGTATGGTCTCTTTGAGG - Intronic
1135862664 16:26071226-26071248 TCTCAAGGATGTTTTCATAGTGG - Intronic
1136232574 16:28895219-28895241 GCTCCTGGATGGGTCCCTTGTGG - Intronic
1138591630 16:58002302-58002324 TCTCCAGTATTGTCTCATTGGGG - Intronic
1143344240 17:6238349-6238371 TCTCCTGGATGCTTGCTTTCTGG + Intergenic
1143417084 17:6758179-6758201 GCTCCTCCATGGTTTCCTTGGGG - Exonic
1143799978 17:9370947-9370969 TCTACTTGATGCTATCATTGGGG + Intronic
1145318434 17:21748861-21748883 TGCCCTGGATGGTTTCAGAGGGG + Intergenic
1145940711 17:28742079-28742101 TCTCCTGGATTGTGTCATCATGG + Exonic
1147371530 17:39996185-39996207 CATCCGGGATGGTGTCATTGAGG + Exonic
1148721447 17:49756369-49756391 TCTCCTGCATGTCTTCATTTAGG + Intronic
1150319090 17:64195591-64195613 TTTACTGCATGGTTTCAATGAGG - Intronic
1150655018 17:67033638-67033660 ACTTCTGGGTGGTGTCATTGAGG + Intergenic
1151124595 17:71831237-71831259 TCTCCTGGATGTTTCCAAGGTGG + Intergenic
1151489202 17:74422446-74422468 TTTTCTAGAAGGTTTCATTGTGG + Intergenic
1153082377 18:1242773-1242795 TCTCCAGGAAGATTTCATAGAGG + Intergenic
1154354166 18:13612087-13612109 TCTGCTGGAAGCTTTCAGTGTGG - Intronic
1155058304 18:22204835-22204857 GCTCCTGGATGGATTCTGTGTGG + Intergenic
1156382432 18:36576500-36576522 GCCACTGAATGGTTTCATTGCGG - Exonic
1163414735 19:17179305-17179327 TCTCCTTGTTGGCTTCATTAAGG - Intronic
1164416548 19:28050562-28050584 TCTCCTGGCTGTTTTCATTAGGG + Intergenic
1168103678 19:54154073-54154095 GCTCCAGGAAGGTTTCTTTGAGG - Intronic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
926434620 2:12825212-12825234 TTTCCTGGATGGGTCCCTTGGGG - Intergenic
926779682 2:16458324-16458346 TCTTCTGAATAGATTCATTGAGG + Intergenic
926894327 2:17668092-17668114 TCTTCTGAATAATTTCATTGGGG + Intronic
931485594 2:62687780-62687802 TCTCCTTGATCTTTTCATAGCGG - Intronic
932943452 2:76197536-76197558 TCTCTTGGATCGTTTGCTTGAGG + Intergenic
938220729 2:129565066-129565088 TGTCCTGGATTGTATCATGGAGG - Intergenic
942367994 2:175249373-175249395 TCTCATGGAAGGTTTTATAGAGG + Intergenic
943395292 2:187325886-187325908 TCTCATGAATGGATTAATTGTGG + Intergenic
943455714 2:188103958-188103980 TGTCCTTGAAGGTTTGATTGTGG - Intergenic
946410839 2:219514466-219514488 TCTCCTCGATCGTCTCCTTGTGG - Exonic
947563093 2:231175260-231175282 ACTCCCAGATGGTGTCATTGTGG + Intergenic
948964385 2:241365637-241365659 TCTCCTGTAGGATTTCTTTGTGG + Intronic
1169905785 20:10602157-10602179 TCCACTGGAGGCTTTCATTGGGG + Intronic
1170817911 20:19730237-19730259 CCTCCTGGAAGAATTCATTGGGG + Intergenic
1171847599 20:30286474-30286496 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1172822164 20:37746489-37746511 TCTCCTGAATGATGTCATTTAGG - Exonic
1172998769 20:39090750-39090772 TCTCCTGGATGGCTTCTTCTGGG + Intergenic
1174015279 20:47482937-47482959 TCTCCTGAATGGTAACATAGAGG - Intergenic
1174288263 20:49487527-49487549 GCTCGTGGATGCATTCATTGTGG - Intergenic
1177959440 21:27644195-27644217 TGACATGGATGTTTTCATTGAGG - Intergenic
1179292675 21:40032225-40032247 TCTCATGGATCGTTCCATAGTGG + Intronic
1183301770 22:37062280-37062302 GCTCCTGGATGGGTTAGTTGGGG + Intronic
1183718888 22:39550662-39550684 TCTCCTTGATGGCGACATTGAGG + Intergenic
950874445 3:16257350-16257372 TCACCTGGTTTGTTTCCTTGGGG + Intergenic
950887231 3:16372983-16373005 TCTCTTGGCTGGTTTCCATGTGG - Intronic
951513380 3:23529358-23529380 TATACAGGATGTTTTCATTGGGG + Intronic
952275871 3:31876121-31876143 TCTAGTGGATGATTTCATTGTGG - Intronic
952848828 3:37711323-37711345 TCTCCTGGATGGTTTCATTGGGG - Intronic
954161827 3:48728293-48728315 TCTGCCTGATAGTTTCATTGGGG + Intronic
954566746 3:51606454-51606476 TTTCCTTGATGGTGACATTGTGG + Intronic
954711066 3:52505360-52505382 CCTCCAGGATGGTTTCAAAGCGG - Exonic
955228974 3:57082464-57082486 ACTGCTGGATGGTGTGATTGTGG - Intergenic
955642857 3:61105264-61105286 TGACCTTGAGGGTTTCATTGTGG + Intronic
960231924 3:115238468-115238490 TCTCAGGGATGGCTTCCTTGAGG - Intergenic
960325099 3:116285899-116285921 ACTCCAGGGTAGTTTCATTGGGG + Intronic
960818326 3:121697813-121697835 TCTCCTCGATGGTTTGTTGGAGG + Exonic
962854540 3:139331955-139331977 ACTCCTTAATGGTATCATTGAGG + Intronic
965183172 3:165430646-165430668 TCTGATGGATGTTTTCCTTGAGG + Intergenic
965523491 3:169692223-169692245 TGTCATGGAGGGTTTCACTGAGG + Intergenic
966331101 3:178814669-178814691 CATCCTGCATGGTCTCATTGTGG + Intronic
967399006 3:189040176-189040198 TCTCTTGAATGGCCTCATTGTGG + Intronic
967585809 3:191213896-191213918 TCTCCTGTAGGGTTTCTTTCTGG + Intronic
968231866 3:197009119-197009141 TCTCCTGGAGGATCTCAGTGCGG + Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
974338019 4:60576633-60576655 TCAACTGGTTGATTTCATTGTGG - Intergenic
974663092 4:64920281-64920303 TGACCTGGAGGGTTTGATTGTGG - Intergenic
974884241 4:67796868-67796890 TCTCTTGCATGATTTCATTGTGG + Intergenic
977546257 4:98383138-98383160 TCTCATGGAAGGTGTAATTGAGG + Intronic
978054604 4:104248614-104248636 TGTCCTTTATGGCTTCATTGTGG + Intergenic
981332867 4:143532795-143532817 TTGACTGGATGGTTTCTTTGTGG + Intronic
983420093 4:167506414-167506436 TGACCTGGAGGGTTTGATTGGGG + Intergenic
983994849 4:174169358-174169380 TCTGCTGGATTGTTAGATTGTGG - Intergenic
984254113 4:177369951-177369973 TCTCCTGGAATGTTTCAGAGAGG + Intergenic
984767637 4:183411711-183411733 ATTCCTGGGTGGTTTTATTGCGG + Intergenic
985818618 5:2145151-2145173 TCTGCTGGATGATTTCATCTTGG - Intergenic
989693504 5:44171913-44171935 TTACCTTGAGGGTTTCATTGTGG - Intergenic
990530933 5:56672884-56672906 TCTCCTAGTTGATTTCCTTGAGG - Intergenic
992445959 5:76833731-76833753 TTTCCTGGAGTGTTTCTTTGAGG - Exonic
995125229 5:108572396-108572418 TCTGCCTGATAGTTTCATTGGGG + Intergenic
995889039 5:116929817-116929839 TCTCTTGTATTCTTTCATTGTGG + Intergenic
999827804 5:155290821-155290843 TTTCTTCCATGGTTTCATTGGGG + Intergenic
1004266904 6:14156595-14156617 TTTCCTGAATGTTTTCAATGAGG - Intergenic
1006754072 6:36399496-36399518 TCTCCAGGATGTTTTATTTGAGG + Intronic
1007892070 6:45304401-45304423 TTTTTTGGATGGTTTCATTGAGG - Intronic
1008051809 6:46907957-46907979 CCTTCTGGATGGTTGCATTCTGG - Intronic
1012339647 6:98104361-98104383 TGTCCTCGAGGGTTTGATTGTGG + Intergenic
1018560893 6:165099896-165099918 TCTCTTGGGTGGTTTCTTTGAGG - Intergenic
1020963020 7:14829600-14829622 TCTCCAAGATGGATTCTTTGAGG + Intronic
1022792302 7:33701291-33701313 GCTCCTGGATGGATTCATCTGGG - Intergenic
1023604325 7:41914874-41914896 TCTCCTCGAGGGTTACTTTGGGG + Intergenic
1024190504 7:47002338-47002360 TCTCCTGGATGCTTTTCTTAGGG - Intergenic
1027737359 7:81950663-81950685 TCTCCTAGATTTTATCATTGAGG + Intronic
1035621539 8:1039102-1039124 TCACCTGGTTGGTTGCGTTGAGG + Intergenic
1035733275 8:1867847-1867869 CCTCCTGGAAGTTTTCATTCTGG + Intronic
1035917384 8:3639558-3639580 TCTTCTGGATGGTCTGGTTGAGG - Intronic
1036586031 8:10124369-10124391 TCCCCTGTATGATTTCTTTGGGG + Intronic
1036784346 8:11676023-11676045 TCTCCTGCCTGGTTTTATTTTGG - Intergenic
1037526022 8:19724988-19725010 TCTCCTCCCTGGCTTCATTGTGG + Intronic
1040856509 8:51954027-51954049 TCTCCAAGGTGGTTTCATTGGGG - Intergenic
1042108508 8:65354973-65354995 GCTCCTGTATTGTTTTATTGTGG + Intergenic
1043302223 8:78747899-78747921 TCTCCGGGAAGTATTCATTGAGG - Intronic
1043758809 8:84038259-84038281 TCTGCTGGATGTTTTCTTTTTGG + Intergenic
1044773840 8:95666952-95666974 TCTCCAGACTGGTTCCATTGAGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045586635 8:103544841-103544863 TGCCCTTGATGGTTTGATTGTGG - Intronic
1047092436 8:121588871-121588893 CCTGCTGGGTGGTTTCATAGTGG + Intergenic
1048665185 8:136653150-136653172 TCTCCAGAATTGTTTCATTATGG + Intergenic
1050563403 9:6857535-6857557 TATCCTGGATGGTTCCTTTAGGG - Intronic
1050813648 9:9781089-9781111 TCTGCTTGATGCTTTCATGGTGG + Intronic
1050966566 9:11811444-11811466 TTTCCTTGAGGGTTTGATTGTGG + Intergenic
1052400265 9:27991324-27991346 TCTCCCGGATGATTTGCTTGTGG + Intronic
1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1054159330 9:61663067-61663089 TCTCCTAGCTGGTTTCCTAGAGG - Intergenic
1054449275 9:65394123-65394145 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1054479104 9:65594072-65594094 TCTCCTAGCTGGTTTCCTAGAGG - Intergenic
1054851631 9:69852564-69852586 TTCCCTGGGTGGTATCATTGAGG - Intronic
1054902075 9:70379576-70379598 TCTCATGGATGGTTACAGTAGGG - Intergenic
1059510478 9:114840232-114840254 TGTCCTTAAGGGTTTCATTGTGG - Intergenic
1059527249 9:115003681-115003703 TCTCCTGTACAGTGTCATTGCGG + Intergenic
1061393579 9:130331307-130331329 TCTCCTGGGTCGGTTCCTTGCGG + Intronic
1061739071 9:132686246-132686268 TCTCCTAGATGGGTTCTTTCAGG + Intronic
1186410513 X:9341905-9341927 GCTCTTGGAAGGCTTCATTGAGG - Intergenic
1187210530 X:17226740-17226762 TATGCTGGATGGTTTTATTTTGG + Intergenic
1188852808 X:35151735-35151757 TGTCCTTGAGGGTTTGATTGTGG - Intergenic
1189341064 X:40205006-40205028 TCTCTTGGATGGCTTCGGTGTGG - Intergenic
1189867556 X:45346851-45346873 TCTCCCGGATAGTTTTATTTTGG + Intergenic
1190218520 X:48495947-48495969 TCTCCTGGATGGCAACATGGGGG - Intergenic
1192011583 X:67278511-67278533 TGTCCTTGAGGGTTTGATTGTGG - Intergenic
1192191194 X:68992166-68992188 TCACCTGGATTGTTTCCTTTGGG + Intergenic
1192690019 X:73353182-73353204 TGTCCTTGGTGGTTTGATTGTGG + Intergenic
1192926644 X:75760603-75760625 TGACCTTGATGGTTTGATTGAGG - Intergenic
1193531539 X:82660407-82660429 TCTTCTGGATGCTCCCATTGTGG + Intergenic
1193923849 X:87462377-87462399 TCATCGTGATGGTTTCATTGGGG - Intergenic
1194519447 X:94901072-94901094 TGTCCTTGTGGGTTTCATTGTGG + Intergenic
1194558760 X:95394697-95394719 TCTCCAGGATTGTTCCCTTGTGG - Intergenic
1196203940 X:112917684-112917706 ACTCCTGGAGGGTTGCATGGCGG + Intergenic
1196241217 X:113345358-113345380 GCTCCTGTATCGTTTTATTGTGG + Intergenic
1196564632 X:117190158-117190180 TCTCCAGGATTGTTCCCTTGTGG - Intergenic
1200072297 X:153535254-153535276 TGGCCTGGATGCTTTCAGTGTGG + Intronic
1200812784 Y:7502487-7502509 TCTGCCTGATGGTTCCATTGGGG - Intergenic
1202071098 Y:20992282-20992304 TCTCCTGGTTGGTCTCCTAGAGG - Intergenic