ID: 952850580

View in Genome Browser
Species Human (GRCh38)
Location 3:37725172-37725194
Sequence TGTGGCTTCATTCCAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952850575_952850580 19 Left 952850575 3:37725130-37725152 CCTCTGCATCTCTGCTCAGGGAT 0: 1
1: 0
2: 4
3: 22
4: 275
Right 952850580 3:37725172-37725194 TGTGGCTTCATTCCAGTGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 210
952850574_952850580 20 Left 952850574 3:37725129-37725151 CCCTCTGCATCTCTGCTCAGGGA 0: 1
1: 1
2: 7
3: 46
4: 256
Right 952850580 3:37725172-37725194 TGTGGCTTCATTCCAGTGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952850580 Original CRISPR TGTGGCTTCATTCCAGTGGG AGG Intronic
900345861 1:2210007-2210029 TGAGGCTGCATTCCAGGGTGAGG - Intronic
900492660 1:2960184-2960206 TGAGGCTTCACTCCAGTCGCGGG - Intergenic
900875193 1:5337540-5337562 TCTGTCTTCTTTTCAGTGGGAGG - Intergenic
902404100 1:16173734-16173756 TGTTGCTGCATTCCTGTGGCAGG - Intergenic
907525138 1:55049644-55049666 TTGGGCTTCCTTCCAGTGAGAGG - Intronic
909263429 1:73525436-73525458 TGTGGATTGATTCCAGTTTGGGG - Intergenic
909477854 1:76101814-76101836 TTTGGCTTCATTGCATTGTGAGG + Intronic
915033129 1:152901288-152901310 AGAGCTTTCATTCCAGTGGGGGG - Intergenic
917751553 1:178058008-178058030 TGTCGCTTCATACCACTGTGTGG - Intergenic
919254626 1:195105347-195105369 TGTGGTTTTACTCCTGTGGGTGG - Intergenic
920551569 1:206865913-206865935 AGTGTCTTCAGTCCAGTGGAAGG - Exonic
920952777 1:210587899-210587921 TATGTGTACATTCCAGTGGGCGG + Exonic
921670247 1:217917116-217917138 TGTGCCTTCATCCCAGAGAGTGG + Intergenic
922660945 1:227429826-227429848 TGTGTCTTCTTTCCCGAGGGAGG - Intergenic
924693489 1:246375814-246375836 TGTTGCTTCAACCCAGGGGGCGG - Intronic
1063495093 10:6499890-6499912 TGTGGCTGGATTCCTGGGGGAGG - Intronic
1063519672 10:6729773-6729795 TGTCTTTTCATTCCAGTCGGAGG + Intergenic
1065500899 10:26381383-26381405 TGAGCTTTCATTCTAGTGGGAGG + Intergenic
1065741043 10:28797324-28797346 GATGGCTTGAGTCCAGTGGGCGG + Intergenic
1066303497 10:34117402-34117424 TGTGGCTGCATTCCATCGGAAGG - Intronic
1066581729 10:36889154-36889176 TTTGGCTCCATGCCAGTAGGTGG + Intergenic
1066974059 10:42348698-42348720 TGTGACTTCATTCCAGCCTGCGG - Intergenic
1067187890 10:44045495-44045517 TTGGGCTTCCTTCCAGTGTGAGG + Intergenic
1067680876 10:48439806-48439828 AGTGGCGTCATTACAGTGGCTGG - Intergenic
1068116264 10:52740557-52740579 TGGGTCTTGGTTCCAGTGGGTGG - Intergenic
1068171936 10:53404950-53404972 TCAGGCTTCATGCCAGTAGGGGG - Intergenic
1069398241 10:68013767-68013789 GATGGCTACATACCAGTGGGAGG - Intronic
1069676685 10:70253808-70253830 TGTGGCTTCTTTCCAGGAGACGG - Exonic
1073541627 10:104319873-104319895 TGTGCCTGAATTCCAGAGGGAGG - Intronic
1074070870 10:110068064-110068086 TGTGGCTTATTTCAAGGGGGTGG - Intronic
1074789243 10:116869681-116869703 TGTGCCTTCATCCCAGCAGGTGG + Intronic
1075800946 10:125152924-125152946 TGTGTTTTCTTCCCAGTGGGGGG - Intronic
1075896616 10:126001721-126001743 GGTGGCTTTCTGCCAGTGGGAGG + Intronic
1076872377 10:133200320-133200342 TGTGGCCTCCTCCCAGTGGGCGG + Intronic
1077420759 11:2448876-2448898 TGTGGCTTCGTACTAGTTGGGGG + Intronic
1078904575 11:15671864-15671886 TAGGGCTTCATTCCAGGGGGAGG + Intergenic
1079884707 11:25972732-25972754 TGTGCCTGAATTCCAATGGGAGG + Intergenic
1079893706 11:26092016-26092038 TGTGTCTGAATTCCAATGGGAGG + Intergenic
1083279924 11:61620644-61620666 AGTGGCTTCATCCCAGAGTGGGG + Intergenic
1083902826 11:65651986-65652008 TGTAGCCGCAGTCCAGTGGGAGG + Intergenic
1084602697 11:70155605-70155627 GGTGGCTGGATTCCAGCGGGAGG - Intronic
1088550432 11:111007311-111007333 TGGGGCTTCCTTCCAGTGAGGGG + Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1090758292 11:129814335-129814357 TGTGGCTTCACTCCTGAGGTCGG - Intergenic
1091174482 11:133546506-133546528 TGTGGCTTCCTTCCCCTGTGTGG + Intergenic
1091610436 12:2003477-2003499 TGTCTCTACATTCGAGTGGGTGG + Intronic
1091945716 12:4539536-4539558 GGAGGTTACATTCCAGTGGGAGG + Intronic
1101405217 12:104422648-104422670 TGTGCCTAAATTCCAATGGGAGG + Intergenic
1101537024 12:105627805-105627827 TGTGACTAAATTCCAGTGAGAGG + Intergenic
1104486627 12:129156589-129156611 AGTGGATTCACTCCATTGGGAGG - Intronic
1104498187 12:129260363-129260385 GGTGGCTTCAATCAAGTGGCTGG + Intronic
1105446054 13:20458052-20458074 TGTGGCTTTCTTCCTGTGGTTGG - Intronic
1107727979 13:43319086-43319108 TCTGGCTTCATTTCAGTAGGAGG + Intronic
1108572686 13:51766867-51766889 TGTGGGTTCTGTCCAGTTGGTGG + Exonic
1109105052 13:58239911-58239933 TTGGGCTGCAGTCCAGTGGGTGG - Intergenic
1112185945 13:97127900-97127922 TGTGCCTGAATTCCAGAGGGAGG + Intergenic
1116766994 14:49084776-49084798 GGAGGTTACATTCCAGTGGGAGG - Intergenic
1119257479 14:73211007-73211029 AGTGGCTTCATTCTGGAGGGTGG - Intronic
1119380954 14:74227784-74227806 TGAGGCTTCACTCCAGAGGCTGG + Intergenic
1120404735 14:84080423-84080445 TGTGGCATCTTTCCAGTGCTGGG + Intergenic
1121645103 14:95512909-95512931 TGTTTCTTCAGTCCAGTGGTAGG - Intergenic
1122915324 14:104855658-104855680 GGTGGCTTAAATGCAGTGGGTGG + Intergenic
1125461858 15:39915039-39915061 TGTGGCTTGATTCCATGAGGTGG - Intronic
1126532408 15:49725439-49725461 TGTGGCTTCTTTCCGGGGGAGGG - Intergenic
1126968411 15:54083033-54083055 TCAGGCTGCATTCCAGTAGGTGG + Intronic
1126994319 15:54422558-54422580 TGTGGCTACATTTGAGTGAGAGG - Intronic
1128005292 15:64233905-64233927 TGTAGCTTAAGTCCAGTGTGTGG - Intronic
1131021184 15:89100392-89100414 TGTGGCTTCGGGCAAGTGGGAGG - Intronic
1132251336 15:100337631-100337653 GGTGGACACATTCCAGTGGGTGG + Intronic
1134002096 16:10790908-10790930 TGTGCCTGGATTCCAATGGGAGG + Intronic
1134043578 16:11085669-11085691 AGTGGCTTCATCCCACTGTGTGG + Intronic
1135314405 16:21432328-21432350 TGTGTCTGGATTCCAGAGGGAGG + Intronic
1135367327 16:21864604-21864626 TGTGTCTGGATTCCAGAGGGAGG + Intronic
1135444486 16:22506554-22506576 TGTGTCTGGATTCCAGAGGGAGG - Intronic
1136311074 16:29411023-29411045 TGTGTCTGGATTCCAGAGGGAGG + Intergenic
1136324518 16:29512814-29512836 TGTGTCTGGATTCCAGAGGGAGG + Intergenic
1136439203 16:30252795-30252817 TGTGTCTGGATTCCAGAGGGAGG + Intronic
1139179773 16:64732710-64732732 TGTGGATTCAATCCATTGTGAGG + Intergenic
1139374672 16:66489449-66489471 TGTGTCTTCATTTCAGAGGGAGG + Intronic
1141931430 16:87207072-87207094 TTTGGGTTCCTTCCAGTGTGGGG - Intronic
1143412501 17:6719188-6719210 GGTCGCTTCAGCCCAGTGGGTGG + Intergenic
1144701441 17:17343539-17343561 GGTGGCTTTCTTCCAGTTGGAGG - Intronic
1145366334 17:22269523-22269545 AGTGGCTTCTTTGCAGAGGGAGG - Intergenic
1145728915 17:27157808-27157830 AGTGGCTTCTTTGCAGGGGGAGG + Intergenic
1151276398 17:73037793-73037815 CCTGGCTTCATTCGATTGGGTGG - Intronic
1151672870 17:75581661-75581683 TGCGGCTTCATTCAAGTCAGTGG + Intergenic
1153300320 18:3586415-3586437 TGAGGCTTCACTGCAGTGAGCGG + Intronic
1153737755 18:8090110-8090132 TCTGGGTTGATTCCTGTGGGTGG + Intronic
1153981269 18:10312628-10312650 TGTGGCTTCCCTCCAGTGCTGGG + Intergenic
1154405209 18:14084476-14084498 TGTGGCTTCATTCAGCTGGAGGG - Intronic
1158597267 18:58827408-58827430 TGTTCATTCCTTCCAGTGGGTGG + Intergenic
1159556316 18:69949050-69949072 TGTGACTACAGTCTAGTGGGTGG + Intronic
1159956916 18:74525186-74525208 GGTGGCTTCATGCCTTTGGGAGG - Intergenic
1160106874 18:75986663-75986685 TGTGGCTTCTGTCCACTGGTAGG + Intergenic
1160543743 18:79639307-79639329 TGTGCCTGAATTCCAGAGGGAGG - Intergenic
1161981071 19:7630680-7630702 TGAGGGTTCATTCCAGGGGTGGG + Intronic
1163149345 19:15401784-15401806 TGTGGCTACATTCAAGTTTGGGG - Intronic
1163783871 19:19264518-19264540 GGTAGTTTCAGTCCAGTGGGTGG - Exonic
1164506827 19:28867746-28867768 AATGGCTTCATCCCAGGGGGCGG + Intergenic
1164540110 19:29115664-29115686 TGCTGCTTCTTTCCCGTGGGTGG + Intergenic
1164636098 19:29792499-29792521 TGTGCCTCCATTCCAGGAGGAGG + Intergenic
1166865321 19:45832580-45832602 TGTGGCTTCTTTCCAGTTTTTGG - Intronic
925172359 2:1758111-1758133 TGTGGCTCCAGGGCAGTGGGTGG + Intergenic
928242822 2:29601448-29601470 TGTGGCATGATTCCAGGGGAGGG + Intronic
928412990 2:31068595-31068617 TGTGGCTTCTTTGCAGGGGGAGG - Intronic
929260939 2:39865952-39865974 TGTGGCTTCCTTACATTTGGTGG + Intergenic
929990292 2:46780973-46780995 TGTGGCTTCACTCCTGCGGCAGG + Intergenic
933181745 2:79235315-79235337 TTGGGCTTCAATCCAGTAGGTGG + Intronic
934522947 2:95031321-95031343 TGTCCCTTCATTCCTGTTGGGGG - Intronic
934885243 2:98018640-98018662 TGTGGGTTGATTCCAGTTTGGGG + Intergenic
936958448 2:118047578-118047600 TGTGGCTTCCTTCCAGAGCAAGG - Intergenic
937115570 2:119402757-119402779 CATGGCTTCTTTCCACTGGGTGG - Intergenic
938605762 2:132891175-132891197 TGGGGCTTCAGGCCAGTGGTTGG + Intronic
938930019 2:136078534-136078556 TGTGCCTTAATTCCTTTGGGTGG + Intergenic
939423107 2:141999194-141999216 TGTGGCTGAATTCCAATGGGAGG + Intronic
944053939 2:195503472-195503494 AGTGGATTCAGTCAAGTGGGTGG + Intergenic
944082481 2:195804011-195804033 TGTGGCTTCTTACCACTGAGTGG + Intronic
944660174 2:201915098-201915120 TTTGGTTTCATTCCAGTGATAGG - Intergenic
945111336 2:206362932-206362954 TGTGCCTGAATTCCAGAGGGAGG - Intergenic
945920967 2:215754185-215754207 TGAGACTCCAGTCCAGTGGGTGG - Intergenic
1168867360 20:1099094-1099116 TTAGGGTTCACTCCAGTGGGAGG - Intergenic
1169654246 20:7904848-7904870 TGTGGCTGCATTCAACTGTGGGG - Intronic
1169812963 20:9627555-9627577 TGTGGGTGCATTCAAGTGTGAGG - Intronic
1170034695 20:11978075-11978097 TTTGGGTTGTTTCCAGTGGGGGG + Intergenic
1173196616 20:40919334-40919356 TAGGGCTAGATTCCAGTGGGGGG + Intergenic
1174132691 20:48357276-48357298 TCTGGGTTCCATCCAGTGGGTGG - Intergenic
1175489032 20:59366119-59366141 TCTGGCCTCATGCCACTGGGTGG - Intergenic
1175757889 20:61541222-61541244 AGTGGATTGATGCCAGTGGGAGG - Intronic
1177031814 21:15989715-15989737 TGTGGCTTCATGACAGTGGTGGG + Intergenic
1178128177 21:29539111-29539133 TGTGGCTTCAGTGAATTGGGAGG + Intronic
1179215943 21:39367053-39367075 TGAGGCTTCAGTCCAGGAGGTGG - Intergenic
1180790538 22:18573349-18573371 TTCGGCTTCATTCCACCGGGTGG - Intergenic
1181054762 22:20255654-20255676 TGGGGCTTCATCACAGTGTGAGG - Intronic
1181104885 22:20568297-20568319 TGTGGAGACATCCCAGTGGGAGG + Intronic
1181231200 22:21421966-21421988 TTCGGCTTCATTCCACCGGGTGG + Intronic
1181247451 22:21512902-21512924 TTCGGCTTCATTCCACCGGGTGG - Intergenic
1182443378 22:30376789-30376811 TGGGGCTTTATTACAGTGGGTGG - Exonic
1183722598 22:39571218-39571240 TGTGGGGTCAGTCCAGTGGCTGG + Intronic
1183832038 22:40423457-40423479 TGTGACTTCATTCCAGCTGTGGG - Intronic
1184149244 22:42628912-42628934 TGTGGCTTCAGCACAGAGGGTGG + Intronic
949851092 3:8421189-8421211 TGTGGCTACAGTCCACTGTGTGG - Intergenic
950954414 3:17036169-17036191 TGTGGCTGCAGTCCACTGTGGGG - Intronic
951183837 3:19688975-19688997 TTTGGCTTCCTACCAGTAGGTGG - Intergenic
951662685 3:25087174-25087196 TGTGGCTGAATTCCAAAGGGAGG + Intergenic
952849329 3:37714586-37714608 GGTGGCTTCCTTCCCTTGGGAGG - Intronic
952850580 3:37725172-37725194 TGTGGCTTCATTCCAGTGGGAGG + Intronic
954508750 3:51103015-51103037 TGTGGCTTTCCTGCAGTGGGAGG - Intronic
956519443 3:70087507-70087529 TGTGGATTCCTTCCACAGGGAGG + Intergenic
958575776 3:95948837-95948859 TGTGGCTTCACTCCTGAGGTCGG - Intergenic
958669892 3:97190309-97190331 TGTGGCTGGATTCCAGTTTGTGG + Intronic
959279812 3:104323648-104323670 GTTGGCTTCATTCCAGAAGGTGG - Intergenic
960005936 3:112781197-112781219 TGTCCCTTCAGTCCTGTGGGTGG + Intronic
960394420 3:117118811-117118833 GGTGGCTGCATTCCAATGGTGGG + Intronic
965558303 3:170038744-170038766 TGGGGCTTAATCCCAGTGGCGGG - Intronic
966891428 3:184410144-184410166 TGTGGCTGGAGTGCAGTGGGAGG - Intronic
968245102 3:197137220-197137242 TGTGGCTTCATGGAAGAGGGAGG - Intronic
971804325 4:31335952-31335974 TGTGCCTGCATTCCAAAGGGAGG + Intergenic
971994978 4:33954444-33954466 TCCGGCTGCATTCCAGTAGGTGG + Intergenic
972281552 4:37606566-37606588 TGTGTCTTCTTTCCTGTGTGAGG - Intronic
976111392 4:81677609-81677631 TGTGGATTCAGTACAGTAGGTGG + Intronic
976273384 4:83252125-83252147 TGTGGCTGCAGTCCACTGGAGGG + Intergenic
981703841 4:147638631-147638653 TGCAGCTTGTTTCCAGTGGGAGG + Exonic
981714309 4:147737688-147737710 TGGGGCTTTATTACAGTGGCTGG + Intronic
982752249 4:159176217-159176239 TTGGGTTTCATTCCAGTGTGGGG + Intronic
982773152 4:159416487-159416509 TGTGCCTGGATTCCAGTGAGAGG - Intergenic
983150063 4:164267420-164267442 GTTGGCTTCATTCAAGTGAGAGG - Intronic
984747638 4:183238547-183238569 TGTGGCTGGATTACAGAGGGTGG - Intronic
985969191 5:3361946-3361968 GGAGGCTGCATTCTAGTGGGTGG + Intergenic
993429466 5:87814126-87814148 GGTGGGTGCATGCCAGTGGGGGG - Intergenic
994096704 5:95853733-95853755 GCAGGCTCCATTCCAGTGGGTGG - Intronic
995260801 5:110102320-110102342 TGAGGCTTCATTCAACTGAGGGG + Intergenic
996708172 5:126518122-126518144 TGTGCCTGAATTCCAGTGGGAGG - Intergenic
997356256 5:133265006-133265028 TGTGGCTTCAGAGGAGTGGGAGG - Intronic
1000481802 5:161785908-161785930 TGTGCCTGAATTCCAATGGGAGG + Intergenic
1001294513 5:170489535-170489557 TGTGGGTGCACACCAGTGGGAGG - Intronic
1001975244 5:175993494-175993516 TGTGGCTTGAGTGGAGTGGGAGG - Intronic
1002242187 5:177850276-177850298 TGTGGCTTGAGTGGAGTGGGAGG + Intergenic
1004681711 6:17902081-17902103 TGTGGCTTCATTACAGAAAGAGG + Intronic
1004942627 6:20576752-20576774 GGTGGCTACAGTCAAGTGGGAGG - Intronic
1009559379 6:65220355-65220377 TATGGCTTGAACCCAGTGGGTGG + Intronic
1010050549 6:71499020-71499042 TATGGCATCTTCCCAGTGGGAGG + Intergenic
1011955245 6:93017438-93017460 TCAGGCTTCAGTCCAGTTGGTGG - Intergenic
1012008887 6:93754523-93754545 TGTCGCTTCATACCTGTGGTAGG + Intergenic
1014242707 6:119035317-119035339 TGTCCCTGAATTCCAGTGGGAGG - Intronic
1014787072 6:125631345-125631367 TGTGGCTTGGGGCCAGTGGGAGG - Intergenic
1016681078 6:146830000-146830022 TGTGCCTGAATTCCAATGGGAGG - Intergenic
1018456842 6:163960898-163960920 TGTGGCCTCATTCTTGGGGGTGG + Intergenic
1018656843 6:166045045-166045067 TTGGGCTTCCCTCCAGTGGGAGG + Intergenic
1018759368 6:166877911-166877933 TGTGCCTGAATTCCACTGGGAGG + Intronic
1019603275 7:1895870-1895892 TGTCCCTTCTTTCCAGTGGCAGG - Intronic
1019729478 7:2622430-2622452 TGTGGCTCCATTCCAGGGGGAGG - Intergenic
1019950074 7:4364978-4365000 TATGCCTGAATTCCAGTGGGAGG - Intergenic
1023843757 7:44110020-44110042 TGTGACTCCATCCCAATGGGGGG - Exonic
1024305483 7:47925639-47925661 TGTGCCTCAATTCCAATGGGAGG - Intronic
1028958503 7:96721717-96721739 TCTGACTTCATTCCACTGGAGGG - Intergenic
1031845624 7:126802762-126802784 TGTGGTTTTATTCCAGTTTGTGG - Intronic
1033832783 7:145273295-145273317 TGTGGCCTCATACCAGTCTGTGG + Intergenic
1034386346 7:150744213-150744235 AGTAGCTTCCTTCCAGTGTGGGG - Intronic
1035089446 7:156294794-156294816 TGTGGCAGAATTTCAGTGGGTGG - Intergenic
1035413244 7:158663091-158663113 TGTGGCTGCATGCCAGTAAGCGG + Intronic
1036221446 8:6924168-6924190 TGTGCCTGAATTCCAATGGGAGG - Intergenic
1036223495 8:6940028-6940050 TGTGGTTTCCTTGCAGTAGGCGG + Intergenic
1038788548 8:30645317-30645339 AGTGGTTTCATTCCAGTGGCTGG - Exonic
1039136142 8:34324891-34324913 GGTGGCTTGATTAAAGTGGGAGG - Intergenic
1040598262 8:48860839-48860861 TGTGGCTTGATAGCAGTGAGTGG + Intergenic
1040876611 8:52158937-52158959 TGTGGCTTCCCTGCAGCGGGTGG + Exonic
1044026436 8:87178170-87178192 TCTGTGTTTATTCCAGTGGGAGG + Intronic
1046994626 8:120503891-120503913 TCTGGCTTCAGTCGAGTGAGTGG + Intronic
1047700452 8:127444344-127444366 TGTGCCCTCATTGCAGTGGAAGG - Intergenic
1056183434 9:84107910-84107932 TGAGGCTTCAATCCATTTGGTGG + Intergenic
1056652293 9:88476524-88476546 TGTGGATTCATTCCATTCAGTGG + Exonic
1060514261 9:124256133-124256155 TGGGGCTTCAGTCAAGGGGGAGG - Intergenic
1062647339 9:137555402-137555424 AGTGGCTTCATTCCACTCTGGGG + Exonic
1062689069 9:137832221-137832243 TGTGCCTTCATTCCAGTCCTAGG + Intronic
1189785301 X:44554073-44554095 TGTGCCTGAATTCCAGAGGGAGG + Intergenic
1189844044 X:45115248-45115270 TTTGGCTTAAATCCAGTGGCTGG - Intergenic
1190866947 X:54392668-54392690 TGTGTCTGAATTCCAATGGGAGG - Intergenic
1196373126 X:115001011-115001033 TCAGGCTTCATTCCAGTACGTGG + Intergenic
1196490856 X:116264452-116264474 TTTGGCTTCTTTCCAATGTGGGG - Intergenic
1200094782 X:153652285-153652307 TGGGGCTGCGTTCCAGTGGAGGG - Intergenic
1200930732 Y:8694668-8694690 AGTGGCTTTTTTGCAGTGGGAGG + Intergenic
1201145146 Y:11060457-11060479 TGTGACTTCTTCCCAGTGTGAGG - Intergenic
1201972059 Y:19809173-19809195 TATAGCTTCAGTACAGTGGGAGG + Intergenic