ID: 952854283

View in Genome Browser
Species Human (GRCh38)
Location 3:37755080-37755102
Sequence TACCATTTATTGCTGTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952854281_952854283 -9 Left 952854281 3:37755066-37755088 CCCAAAAAAATGAATACCATTTA 0: 1
1: 0
2: 5
3: 77
4: 916
Right 952854283 3:37755080-37755102 TACCATTTATTGCTGTCCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 112
952854282_952854283 -10 Left 952854282 3:37755067-37755089 CCAAAAAAATGAATACCATTTAT 0: 1
1: 0
2: 4
3: 57
4: 690
Right 952854283 3:37755080-37755102 TACCATTTATTGCTGTCCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 112
952854277_952854283 -5 Left 952854277 3:37755062-37755084 CCCCCCCAAAAAAATGAATACCA 0: 1
1: 0
2: 6
3: 80
4: 841
Right 952854283 3:37755080-37755102 TACCATTTATTGCTGTCCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 112
952854276_952854283 8 Left 952854276 3:37755049-37755071 CCTGAATAACTGACCCCCCCAAA 0: 1
1: 0
2: 2
3: 7
4: 113
Right 952854283 3:37755080-37755102 TACCATTTATTGCTGTCCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 112
952854278_952854283 -6 Left 952854278 3:37755063-37755085 CCCCCCAAAAAAATGAATACCAT 0: 1
1: 0
2: 5
3: 37
4: 509
Right 952854283 3:37755080-37755102 TACCATTTATTGCTGTCCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 112
952854279_952854283 -7 Left 952854279 3:37755064-37755086 CCCCCAAAAAAATGAATACCATT 0: 1
1: 1
2: 6
3: 49
4: 492
Right 952854283 3:37755080-37755102 TACCATTTATTGCTGTCCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 112
952854280_952854283 -8 Left 952854280 3:37755065-37755087 CCCCAAAAAAATGAATACCATTT 0: 1
1: 0
2: 10
3: 86
4: 920
Right 952854283 3:37755080-37755102 TACCATTTATTGCTGTCCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952854283 Original CRISPR TACCATTTATTGCTGTCCCA AGG Intronic
904843202 1:33387546-33387568 TGCCATTTATTGCTTGCTCAGGG + Intronic
904903889 1:33879375-33879397 TCCCATTTCTTGCTCCCCCATGG + Intronic
905501623 1:38444104-38444126 TACCACATATTGCTAGCCCAGGG - Intergenic
912068955 1:105782828-105782850 TACCCTTTATTCCAGTCCCTTGG - Intergenic
917958679 1:180125637-180125659 CACCAATTATTGCTGTGCCTCGG - Intergenic
920764818 1:208821982-208822004 TCCCATATATTGCAGTTCCAGGG + Intergenic
1064505134 10:16020729-16020751 TACCATTTTCTTCTGTACCATGG - Intergenic
1065850184 10:29781336-29781358 AAACACTGATTGCTGTCCCAAGG - Intergenic
1071861332 10:89675854-89675876 TACCATTGATTATTGTCCTATGG + Intergenic
1072169619 10:92847231-92847253 TGCCTCATATTGCTGTCCCATGG - Intronic
1074420621 10:113305679-113305701 TACCATTTAGGGTTGTCCCAAGG + Intergenic
1078556177 11:12328085-12328107 TACCACTTATTGCTTTACCTTGG - Intronic
1079064634 11:17278516-17278538 TACCTTTCTTTGCTCTCCCAAGG + Intronic
1080068035 11:28042960-28042982 TACCCTTCAGTGCTATCCCAAGG + Intronic
1081936777 11:46909979-46910001 TTCTACTTATTTCTGTCCCATGG + Intronic
1082203594 11:49404075-49404097 TACCACTTATTATTGTCCAAAGG + Intergenic
1086632715 11:89042644-89042666 TACCATTTATTATTTTTCCAAGG + Intronic
1087395614 11:97593170-97593192 TACCCTTTATTTCTTTCCCTTGG - Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1090139460 11:124239281-124239303 TAGCATTTATGGCTCTCACATGG + Intergenic
1090305704 11:125689247-125689269 TACAATGTTTTTCTGTCCCAAGG - Intergenic
1094141755 12:27188787-27188809 CACCATTTAATCCTCTCCCATGG + Intergenic
1096759945 12:53832858-53832880 TTCCATTTCTTCTTGTCCCACGG + Intergenic
1100592268 12:96040459-96040481 TACCATTAAGTTCTGTCCAATGG + Intronic
1106418092 13:29562731-29562753 TACATTTTATTGCTGCCTCAGGG - Intronic
1109689626 13:65868730-65868752 TACCATTTCTTAATGTGCCAGGG + Intergenic
1113000053 13:105624796-105624818 TACCTTTAATTGCTCTGCCAGGG - Intergenic
1118488629 14:66237527-66237549 TCCCTTTTATTTCTGTTCCATGG - Intergenic
1121850102 14:97213774-97213796 TCCCAGTTCTTTCTGTCCCATGG - Intergenic
1122401554 14:101470334-101470356 GACCAATTATTTCTGTACCATGG - Intergenic
1135654886 16:24239295-24239317 TATCATTTCTGGCTGTTCCATGG + Intergenic
1139210304 16:65070578-65070600 TAAAATTTATTGCTCACCCATGG - Intronic
1139789612 16:69423119-69423141 TACCCTCAATTGCTGTCCCAAGG - Intergenic
1144959571 17:19037531-19037553 CACCTTTTACTGCTGTCACATGG - Intronic
1144975588 17:19136993-19137015 CACCTTTTACTGCTGTCACATGG + Intronic
1147543415 17:41379893-41379915 TCACATCAATTGCTGTCCCATGG + Intronic
1150240857 17:63631394-63631416 TACCCTTTATCACTGTCCCTTGG - Intronic
1156153769 18:34276507-34276529 TAATATTTATTGCTTTGCCAAGG + Intergenic
1156796935 18:41057448-41057470 TATCATTTCTTGCAGTTCCAAGG - Intergenic
929643637 2:43606507-43606529 TTCCATCTCTTCCTGTCCCAGGG - Intergenic
936791622 2:116159463-116159485 TAGCATGTATTGCTTTGCCAGGG + Intergenic
938585397 2:132685615-132685637 TACCATTAATTGTAGTTCCAGGG - Intronic
946147068 2:217739053-217739075 AACCATTTATTGGTGGCCAATGG - Intronic
1169602003 20:7272132-7272154 TACCTTTTATTGCTGACCAAAGG - Intergenic
1170113330 20:12829194-12829216 TGCCATTTTTAGCTGTCCAAAGG + Intergenic
1172998307 20:39087361-39087383 TACCATATATAGTTGTCCCTTGG + Intergenic
1173001355 20:39108222-39108244 TACAATTTACTTCTGTTCCAGGG + Intergenic
1173064824 20:39700303-39700325 TATCATTTATTACACTCCCAAGG - Intergenic
1175532128 20:59681027-59681049 TGCCAGTTATTGTTTTCCCAGGG + Intronic
1176291915 21:5050339-5050361 TACCACTCCTTGCTCTCCCATGG + Intergenic
1179865342 21:44213302-44213324 TACCACTCCTTGCTCTCCCATGG - Intergenic
1181471134 22:23140807-23140829 TACTACTTATTGCTGGCACAAGG - Intronic
1183080175 22:35451140-35451162 TCCCATCTATTGTTGGCCCAAGG - Intergenic
1184638144 22:45852193-45852215 TACCATTTATTAGTTTGCCAGGG - Intergenic
951685391 3:25338261-25338283 TACTATCTCTTGCTCTCCCATGG - Intronic
952691467 3:36211381-36211403 TGCCATTTATAGATCTCCCAGGG - Intergenic
952854283 3:37755080-37755102 TACCATTTATTGCTGTCCCAAGG + Intronic
955049927 3:55400593-55400615 TACCATTCATTCATGTCCAAGGG + Intergenic
957641424 3:82858501-82858523 TAGCAGGTATTGCTCTCCCATGG + Intergenic
958116503 3:89226001-89226023 AAACATTTATTGATGTCTCAAGG - Intronic
960951872 3:123004450-123004472 AACCTTTTCTTGGTGTCCCAAGG - Intronic
962113276 3:132472771-132472793 TTGCATTTATTGTTGTCCCAAGG + Intronic
963168299 3:142226784-142226806 TACCTTTTGTTGCTGCCCAAGGG + Intergenic
963435690 3:145262572-145262594 TAACATTTATTACTATCACATGG - Intergenic
964170151 3:153760123-153760145 TCCCAAGTGTTGCTGTCCCATGG - Intergenic
967620372 3:191626637-191626659 TACTATTAATAGCTGTCCAAAGG - Intergenic
968792167 4:2673175-2673197 TACCAGTTATTCTTGTCCAAAGG + Intronic
970981970 4:22109427-22109449 GACCATAGAATGCTGTCCCATGG - Intergenic
975203047 4:71614524-71614546 CACCATTTTTTGGTGTCTCAGGG - Intergenic
977627472 4:99203102-99203124 TTCCATTTTTTGGTCTCCCAAGG + Exonic
979050733 4:115928415-115928437 TACAATTTTTTGCTTTACCATGG - Intergenic
981131017 4:141158527-141158549 TAACATTTACTGATTTCCCAAGG + Intronic
990395961 5:55378902-55378924 TTCCTGTTATTGCTGTCCTAGGG + Intronic
992214675 5:74514435-74514457 TTCAATTTATAACTGTCCCAAGG + Intergenic
992272127 5:75075874-75075896 TAGTAATTATTACTGTCCCATGG + Intronic
993099769 5:83523172-83523194 TACGATTTATTGCTGTCTAAAGG + Intronic
993616762 5:90122571-90122593 TACCTTCTATTCCTGCCCCACGG - Intergenic
994177495 5:96727600-96727622 TACCATTCACAGCTGTGCCAAGG - Intronic
998050989 5:139035358-139035380 TTCCATTTCTTTCTGTCCCTTGG + Intronic
1000904683 5:166950551-166950573 TAACATTTAAAGTTGTCCCAGGG - Intergenic
1003989049 6:11467670-11467692 TACAATGAGTTGCTGTCCCAGGG - Intergenic
1005334437 6:24779702-24779724 CACCATTGTTTGCTATCCCATGG + Intronic
1007738328 6:43995608-43995630 TACCACACATGGCTGTCCCAGGG + Intergenic
1009446674 6:63750628-63750650 TACTGTTTATTTCTGTCCCAAGG + Intronic
1012327475 6:97940202-97940224 TGCCATTTTTTGCTGGTCCATGG + Intergenic
1012526009 6:100178505-100178527 TACCATTTTTTGATATACCAAGG - Intergenic
1014863654 6:126502561-126502583 AATCATTTATGTCTGTCCCAAGG - Intergenic
1017903071 6:158734832-158734854 TACCATTTATTGAAAGCCCAAGG + Intronic
1019870272 7:3754599-3754621 TCCCATCTCTTCCTGTCCCAGGG + Intronic
1021171616 7:17404523-17404545 TACCCTTTATTTCTTTCCCTTGG + Intergenic
1024153320 7:46595052-46595074 TACTATTTATTGCTTTCTCTGGG - Intergenic
1025748856 7:64272949-64272971 TCCCATTTATTTCTGTGCTATGG + Intergenic
1027481404 7:78702028-78702050 CACCATTTATTCCTTTCTCAAGG - Intronic
1037592192 8:20322369-20322391 TAATACTTAGTGCTGTCCCAGGG + Intergenic
1039708786 8:40034542-40034564 TACCATTTATTTTTGAACCAGGG - Intergenic
1041441960 8:57906746-57906768 TACAAATAATTTCTGTCCCATGG - Intergenic
1042339637 8:67665687-67665709 AACAAATCATTGCTGTCCCATGG - Intronic
1042375444 8:68046129-68046151 TTCCATTTTTGGCTTTCCCATGG + Intronic
1042967119 8:74365465-74365487 AACCATTTGTTGCAGTTCCAAGG - Exonic
1043280150 8:78453852-78453874 TACCCTCCATTGATGTCCCATGG + Intergenic
1044270788 8:90240746-90240768 CATCATTTTTTGCTTTCCCAAGG - Intergenic
1044486279 8:92758051-92758073 TACCACATATTGCTAGCCCAGGG + Intergenic
1047079569 8:121444546-121444568 GACCATTGAATGCTTTCCCATGG + Intergenic
1048655588 8:136532088-136532110 TAGCATTAATTGCAGTTCCATGG - Intergenic
1048794345 8:138135395-138135417 TAGCATATAATGATGTCCCATGG + Intronic
1048920818 8:139228488-139228510 CACCATTGCTTGCTGCCCCACGG - Intergenic
1049393925 8:142388941-142388963 TCCCTTTTATTGTTGTTCCAAGG - Intronic
1050093406 9:2038974-2038996 TACCATTCAGTACTGTCCCTTGG + Intronic
1051610473 9:18957079-18957101 TACTATTTATTGCTGCCCTTAGG - Intronic
1055837192 9:80457272-80457294 ACCCATTTAATCCTGTCCCATGG + Intergenic
1055871559 9:80886614-80886636 TAACATTTGATGATGTCCCAGGG - Intergenic
1061673800 9:132204067-132204089 TACCATTTATTGGGAACCCATGG + Intronic
1192424032 X:71060048-71060070 TCCCATTTAGTGCTGCCACAGGG - Exonic
1194402711 X:93458413-93458435 TACCTTTTAAAGCAGTCCCAGGG + Intergenic
1194797079 X:98225244-98225266 TACCCATTTTTGCTGTCTCAGGG - Intergenic
1195377601 X:104243074-104243096 TACCATTTAGAGAAGTCCCAGGG - Intergenic
1195890627 X:109689559-109689581 TCCCATTTGTTCCTGCCCCATGG + Intronic
1195905212 X:109837686-109837708 TACCACTTAATGCTGCCCGAGGG + Intergenic
1200856484 Y:7944152-7944174 TACTCTTTGATGCTGTCCCAAGG - Intergenic