ID: 952860571

View in Genome Browser
Species Human (GRCh38)
Location 3:37808994-37809016
Sequence AGACCCTGCTTCTCAATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952860569_952860571 4 Left 952860569 3:37808967-37808989 CCAGCTCAGGTTCAAGAGAGGGG 0: 1
1: 0
2: 5
3: 40
4: 270
Right 952860571 3:37808994-37809016 AGACCCTGCTTCTCAATGAGAGG 0: 1
1: 0
2: 7
3: 39
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952860571 Original CRISPR AGACCCTGCTTCTCAATGAG AGG Intronic