ID: 952860571

View in Genome Browser
Species Human (GRCh38)
Location 3:37808994-37809016
Sequence AGACCCTGCTTCTCAATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952860569_952860571 4 Left 952860569 3:37808967-37808989 CCAGCTCAGGTTCAAGAGAGGGG 0: 1
1: 0
2: 5
3: 40
4: 270
Right 952860571 3:37808994-37809016 AGACCCTGCTTCTCAATGAGAGG 0: 1
1: 0
2: 7
3: 39
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952860571 Original CRISPR AGACCCTGCTTCTCAATGAG AGG Intronic
904306488 1:29593343-29593365 AGCCCCTGCTGCTCAATATGTGG - Intergenic
907827394 1:58032055-58032077 AAACTCTGCTTCTCAAAGTGTGG + Intronic
908338009 1:63147354-63147376 GGACCCTGCCTCTCAATGGGAGG - Intergenic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
910071703 1:83222861-83222883 ATACCCTTCTCCTCAAAGAGTGG + Intergenic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
912705138 1:111905934-111905956 GGACCCTGCATCTCTGTGAGAGG + Intronic
915004006 1:152620073-152620095 AGGCCTAACTTCTCAATGAGAGG + Intergenic
915736951 1:158091145-158091167 AGCCACTGCTTCTCCTTGAGTGG + Intronic
916217737 1:162411948-162411970 AGACCTTGCTGCTCAAGGAAGGG - Exonic
916741465 1:167650442-167650464 AGCCTCTGCTTCTGAGTGAGTGG - Intronic
917516794 1:175715023-175715045 AAACCATGCTTCTCAAAGTGTGG + Intronic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
920294873 1:204949934-204949956 AAATCATGCTTCTCAATGGGAGG - Intronic
920379581 1:205527870-205527892 AGAACCTGCTCATCAACGAGAGG + Exonic
920894566 1:210032667-210032689 ACACTCTACTTCTCAATGATGGG - Intronic
920924872 1:210331342-210331364 AGACCCTGCTTCACAAAGATAGG + Intronic
922008575 1:221557354-221557376 AGTCTTTGCTACTCAATGAGTGG - Intergenic
922053053 1:222013099-222013121 AGCCTCTGCTTCTCTATCAGTGG - Intergenic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
923465711 1:234246397-234246419 AGGCCCTGCTTCTCAGAGAAAGG - Intronic
924052237 1:240091329-240091351 AGACCCTGCTTCTCCAGGAGAGG - Intronic
924762546 1:247002219-247002241 ATAACCTGCTTCTGAATGACTGG + Intronic
1063242750 10:4188194-4188216 AGAGCCTGTTTCTCAAGGTGTGG - Intergenic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1065097704 10:22298067-22298089 AGACTCTGCCTCATAATGAGAGG - Intergenic
1067057795 10:43062374-43062396 AGACTCTGCCTCTCAATGAGTGG - Intergenic
1067201122 10:44172865-44172887 AGCCCCTGCTTCTTCATGAGGGG + Intergenic
1067728261 10:48790009-48790031 AAACCCTGCTTCCCAAATAGCGG - Intronic
1068163331 10:53296745-53296767 AGACCCTGCTTCACAAAGATAGG + Intergenic
1069095671 10:64256832-64256854 AGACACTGCTCCTCAAAGAGCGG - Intergenic
1070615233 10:77964555-77964577 AAACCCTGCTTCACAAGGATAGG - Intergenic
1071270464 10:84002065-84002087 AGACCCTACCTCTCAATGGGAGG - Intergenic
1073513774 10:104059547-104059569 AGACCTTGCTACTCAAAGTGTGG - Intronic
1073834239 10:107422709-107422731 AGACTCTACTTCTTATTGAGAGG + Intergenic
1074480910 10:113819930-113819952 AGGCCCTGCTTATCATTTAGGGG - Intergenic
1076523966 10:131099163-131099185 AAACCCTGCTCCTCAATGGGAGG + Intronic
1077755771 11:5025815-5025837 ATACCCTGCTTCCCAACAAGTGG + Intergenic
1077798124 11:5512367-5512389 AGACACTGCTTCTCCAGCAGTGG - Intronic
1078056953 11:8016890-8016912 AGAACTTGTTTCTCAACGAGAGG + Intergenic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1079880872 11:25924476-25924498 AGACCTTACTTCTTAATGAGAGG - Intergenic
1081779230 11:45698600-45698622 AGACCCTGCTTCCCAGTGGCAGG - Intergenic
1081816016 11:45942522-45942544 AGACCCTGCTGCTCATTAACAGG + Intronic
1081848879 11:46260999-46261021 AGAGGCTTCTTCTCAATCAGTGG - Intergenic
1082998470 11:59271175-59271197 ACACCATGCTTATCAGTGAGTGG - Intergenic
1084324446 11:68391559-68391581 AGACCCTGCTTCTGAGCGGGAGG + Intronic
1087498564 11:98920639-98920661 AGACCCTAATTCTCAATGGGAGG - Intergenic
1089678301 11:120105358-120105380 AGACCCTGCTACTTCAGGAGCGG + Intergenic
1090174906 11:124640083-124640105 AGACCCCGCTGCTTGATGAGAGG - Intronic
1092271705 12:7029076-7029098 AGTCCCAGCTCCTCAATGGGGGG - Intronic
1092274459 12:7048620-7048642 AGACCCCACCTCTCAATGGGAGG + Intronic
1092298123 12:7218419-7218441 AGACACTGCTTCTGAATGAACGG + Intronic
1092914375 12:13176516-13176538 AGATCCTGCATCTCCAAGAGCGG - Intergenic
1093896881 12:24583992-24584014 AGAGCCGGCTCCTCAATGACTGG - Intergenic
1094638127 12:32246885-32246907 CAACCCAGCTTCTCAATGAGAGG - Intronic
1095527680 12:43147262-43147284 AGACCCTACTTCTCAGTAAGGGG + Intergenic
1097045920 12:56188071-56188093 AGACAGTGCCTCTCAGTGAGAGG + Intronic
1100383894 12:94087776-94087798 AGAGCCTGCTTCCCAAAGAAAGG - Intergenic
1100411413 12:94322921-94322943 AGACCCTGCTTTTCAATGGGTGG - Intronic
1100585402 12:95975139-95975161 TGACCCTGCTACTCAAAGCGTGG + Intronic
1101810343 12:108102422-108102444 AGACTCCACTTTTCAATGAGAGG - Intergenic
1103347124 12:120258567-120258589 AAACCCTGCTTTTCCATGATGGG - Intronic
1110043767 13:70801128-70801150 AATCCCTACTTCTCAATGGGTGG + Intergenic
1111729612 13:92057022-92057044 GGACCCCACCTCTCAATGAGAGG - Intronic
1112760695 13:102690698-102690720 ATATCCTGCTTCTCAATTTGAGG - Intronic
1114321900 14:21553938-21553960 AGGCCCTGCTTCTCCCTGGGAGG + Intergenic
1114694827 14:24616866-24616888 AGACTTTGCCTCTCAGTGAGAGG + Intergenic
1115290636 14:31768133-31768155 AGACCCATCTTTTCAATGGGTGG + Intronic
1118121887 14:62854870-62854892 AGACCTTGCCTCTCAATGGAAGG + Intronic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1119436480 14:74600818-74600840 AGGCCCTGCTACTCAAAGTGTGG + Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1121034325 14:90687638-90687660 CAAACCTGCTTCACAATGAGGGG + Intronic
1121551776 14:94808283-94808305 AGACTCTGCTTATCAATGTGAGG + Intergenic
1121930028 14:97963938-97963960 AGACCCTCCTTGTCTATGGGTGG + Intronic
1122396397 14:101435683-101435705 AGACCCTGGGTCTCAACCAGTGG - Intergenic
1123901338 15:24880274-24880296 AGACCTTGCCTCTAAAAGAGGGG + Intronic
1125046460 15:35246710-35246732 AGCCCCTTCTTCTTAATTAGTGG + Intronic
1126322741 15:47443209-47443231 AGACTCTACCTCTCAATGAGAGG - Intronic
1128705275 15:69833692-69833714 AGACCCCACCTCTCAATGGGAGG + Intergenic
1130861359 15:87893699-87893721 GAAGCCTGCTTCTCACTGAGAGG + Intronic
1131198648 15:90377941-90377963 ATACCCTGCTTCTCTCTGATAGG - Intergenic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1132066864 15:98738346-98738368 AGATCTTTCTTCTAAATGAGCGG + Intronic
1132662812 16:1069140-1069162 ACACCCTGCTTTTCAGTGAGTGG - Intergenic
1133737968 16:8630055-8630077 GGACCCTGGATCTCAATGAACGG - Intronic
1133942854 16:10324874-10324896 AGCCACTTCTTCTCAATCAGTGG + Intergenic
1134315196 16:13112599-13112621 AACTCATGCTTCTCAATGAGAGG - Intronic
1135844388 16:25905446-25905468 ATACCTTGTTTCTCAAAGAGTGG + Intronic
1137780895 16:51097057-51097079 AGACCATGATTCTCAACCAGGGG + Intergenic
1139615273 16:68085045-68085067 AGACCCTTCTCCTCATTGGGCGG - Intronic
1140995837 16:80258875-80258897 TGCCCCAGCTTCTCAATTAGAGG + Intergenic
1144765863 17:17732105-17732127 AGACCCTCCTTGCCAATGAAAGG + Intronic
1145283378 17:21485212-21485234 AAAACCTGATTCTCAATGTGAGG + Intergenic
1146211251 17:30945409-30945431 GGACCCTGCTTCTCAACATGTGG + Intronic
1148548302 17:48533252-48533274 AGACCCTGCTTCAAGCTGAGGGG + Intergenic
1149178781 17:53908164-53908186 AGATCCTTCTTCTCACTGACTGG + Intergenic
1149334770 17:55624296-55624318 AGACTCTACCTCTCAATGAGAGG + Intergenic
1150712701 17:67545300-67545322 AGACCCTGCTTCTAAAATATGGG + Intronic
1150808078 17:68334946-68334968 AGACCCCACCTCTCAATGGGAGG + Intronic
1151422537 17:74007877-74007899 AGACCCAGCTACTCAAAGAGTGG + Intergenic
1151874937 17:76862498-76862520 AGACGCTGCCTTTCAATCAGAGG + Intergenic
1152207260 17:78980817-78980839 AGAGCCAGCTTCTGACTGAGAGG + Intergenic
1152343858 17:79739838-79739860 AGCCCCGCCTTCTCAGTGAGTGG - Intronic
1152354986 17:79802633-79802655 TGTCCCTTCTTCTCCATGAGGGG + Intergenic
1154468042 18:14668941-14668963 AGACCCTGGTTCTAACTGATTGG - Intergenic
1155237747 18:23838372-23838394 AGAGCCTGCTTTTCAAAGTGAGG - Intronic
1157558443 18:48628994-48629016 AGACCCAACTTCTCAAAGACAGG - Intronic
1157971129 18:52270301-52270323 ATACCCTGCTTTTCAATTAAAGG + Intergenic
1158347907 18:56534379-56534401 AGACCCTGCCTCTCAATGGGAGG - Intergenic
1158862131 18:61603015-61603037 AGATCCTGCCTCTCAGTGAGAGG + Intergenic
1159200560 18:65178620-65178642 AGACTCAACTTCTCAATGGGAGG + Intergenic
1159596434 18:70386905-70386927 AGACCCTGCCACTCTATGGGAGG + Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1160165447 18:76507291-76507313 ATACCCTTCTCCTCAGTGAGAGG - Intergenic
1163609806 19:18294976-18294998 AGACGCTGCTTCTCATGGAGCGG + Intergenic
1165023721 19:32944237-32944259 AGACTCTTCTTCTGACTGAGGGG + Intronic
1166259389 19:41627224-41627246 CAACCCTGCTTCTCAAAGTGTGG - Intronic
1167527175 19:49991775-49991797 AGAGCCGGCTTCCCAATGACAGG + Intronic
1168504735 19:56923757-56923779 AGACCCCACTTCTCAATGGGAGG + Intergenic
928228130 2:29472279-29472301 TGCCCCTGCTTCACAATGACTGG - Intronic
928584290 2:32742768-32742790 AGAGGCTGTTTCTCAATGACAGG - Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929887976 2:45895379-45895401 AGACTCTGCTATACAATGAGGGG + Intronic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
933889482 2:86754041-86754063 AGACAATTCTTATCAATGAGAGG - Intronic
933968440 2:87450360-87450382 AGAACCTACTGCTCAAAGAGAGG - Intergenic
935282673 2:101532700-101532722 CGCCCCTGCTACTCAAAGAGTGG - Intergenic
936325352 2:111500144-111500166 AGAACCTACTGCTCAAAGAGAGG + Intergenic
938574370 2:132590459-132590481 AGCCCCTGTTTCTACATGAGTGG + Intronic
940382283 2:153029291-153029313 ATACCTTGGTACTCAATGAGTGG + Intergenic
940564170 2:155339475-155339497 AAACCCTGCTTCTCAGAGGGAGG + Intergenic
941647640 2:168058353-168058375 AGCCTCTCCTTCTCAATCAGTGG + Intronic
942082804 2:172417202-172417224 AGACCCCACTTCTTAATGAGAGG + Intergenic
942226056 2:173816945-173816967 AGACCCCGCTTCTCAATGGAAGG + Intergenic
943745680 2:191460646-191460668 AGACCCTGCCTGACAAAGAGGGG - Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
944470022 2:200043105-200043127 AGACCCTGCTTCTTGGTGACTGG + Intergenic
944700235 2:202239487-202239509 AGAGCCTGCTTCCCCATGCGAGG - Intergenic
945220514 2:207478837-207478859 AGACAGTGGTTCTCAATGGGAGG + Intergenic
947962932 2:234254763-234254785 AGCCCATGCTTTTGAATGAGAGG + Intergenic
948176897 2:235950513-235950535 GGACCCTGATTCTGGATGAGAGG + Intronic
948875606 2:240825750-240825772 AAAGCCTGCTTCTCAACAAGAGG - Intergenic
1170031101 20:11944993-11945015 AGACCCTGCTTCATGGTGAGAGG + Intergenic
1170119130 20:12893208-12893230 AGACGCTGCATCACAATGTGAGG - Intergenic
1171341021 20:24429779-24429801 AGACCTAGTTTCTCAAAGAGAGG + Intergenic
1172170068 20:32924894-32924916 GGACCCTGCTCCTCAAGGAGTGG - Intronic
1172620743 20:36316735-36316757 TGACCCAGCTTCTCTGTGAGGGG - Intronic
1172841594 20:37905384-37905406 AGACCCTGCTTTTCTATGGGGGG - Intronic
1173513873 20:43651153-43651175 AGACCCCACCTCTCAATGGGAGG - Intergenic
1174098759 20:48110430-48110452 AGACCCTGCTTCTAAAAAAGTGG - Intergenic
1174312116 20:49665401-49665423 AGACCCTGTCTCTCAAAAAGGGG + Intronic
1174866014 20:54136276-54136298 AGATCCTGCTTCTATATGATGGG - Intergenic
1176350497 21:5791014-5791036 AGACCCTCCTTCTCAATTTTTGG + Intergenic
1176357311 21:5911598-5911620 AGACCCTCCTTCTCAATTTTTGG + Intergenic
1176544818 21:8189084-8189106 AGACCCTCCTTCTCAATTTTTGG + Intergenic
1176563769 21:8372129-8372151 AGACCCTCCTTCTCAATTTTTGG + Intergenic
1176806472 21:13488715-13488737 AGACCCTGGTTCTAACTGATTGG + Intergenic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1179980463 21:44893084-44893106 AGAGGGTGCTTCTCAGTGAGAGG - Intronic
1180664944 22:17503399-17503421 ATAACCAGCTTCTCAAAGAGAGG + Intronic
1181802369 22:25355978-25356000 AGACCCTGCTTCTGAGCGGGAGG - Intronic
1183519806 22:38290374-38290396 GGGCCTTGCTTCTCAAAGAGGGG + Intergenic
1184731931 22:46375308-46375330 AGACCCTGCCTCTCAATGGGTGG + Intronic
1185317053 22:50183792-50183814 AGCCCCTCCTTCTCCATGAGAGG - Intergenic
1203249688 22_KI270733v1_random:105322-105344 AGACCCTCCTTCTCAATTTTTGG + Intergenic
949153486 3:799403-799425 ACACCCTGGTTCTGAATGGGAGG + Intergenic
950902425 3:16510118-16510140 AGGCCATGTTTCTCACTGAGAGG + Intronic
951587367 3:24229339-24229361 AGATCTTGCTTCTCAAGGTGTGG + Intronic
951919127 3:27834195-27834217 AGACCTTACTTCACAATGAAAGG + Intergenic
952860571 3:37808994-37809016 AGACCCTGCTTCTCAATGAGAGG + Intronic
954013556 3:47664681-47664703 GGACCATGGTTCTCAATGAAGGG + Intronic
954258936 3:49425049-49425071 AGACCCTGCTCCAGAAGGAGGGG + Exonic
954307331 3:49735582-49735604 AGACCCTGCTTACCAAGAAGTGG + Intronic
956588625 3:70889605-70889627 AGCCAGTGCTTCTCAATTAGGGG - Intergenic
956619665 3:71208801-71208823 CGACCTTGATTCTCAAAGAGTGG - Intronic
960134657 3:114093038-114093060 ACACCCTGTTTCTCAATTATTGG - Intergenic
961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG + Intergenic
962217867 3:133538407-133538429 ATACTCTACTTCTCAATGGGAGG - Intergenic
962932631 3:140051981-140052003 AGGCCATGCTTCTCAAAGTGGGG - Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
964311583 3:155399502-155399524 AGACCCTACTTCTTGATTAGAGG + Intronic
966203587 3:177382881-177382903 AGACCCCACTTCTCAATAGGAGG - Intergenic
967218057 3:187226863-187226885 AGGCCTTGCTTCTCAAAGTGTGG + Intronic
967314485 3:188138274-188138296 AGGCCTTGCTTCTCAAAGTGTGG - Intergenic
970809556 4:20076197-20076219 GGACCCTGCTTCTCATTTATAGG + Intergenic
971150957 4:24031080-24031102 AGTCTCTGCTTGTCAATGTGAGG - Intergenic
972199753 4:36700790-36700812 AGATCTTGCTTCTCAAAGTGTGG + Intergenic
972572539 4:40323945-40323967 AAACCTTGCTACTCAATGTGTGG + Intergenic
972604225 4:40599446-40599468 GGATCCCACTTCTCAATGAGAGG - Intronic
975430136 4:74280164-74280186 AGACTCCACTTCTCAATGGGAGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
979861105 4:125695132-125695154 AGCCACTGGTTCTCAATGAGGGG + Intergenic
980701431 4:136437103-136437125 AGACACTGCCTCTCAATGATAGG + Intergenic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
983641458 4:169947337-169947359 AGACTCCACTTCTCAATGGGAGG + Intergenic
986267320 5:6201792-6201814 AAACCCTGCAGCTCAAAGAGAGG + Intergenic
987381925 5:17293538-17293560 AAACCTTGCTACTCAATGTGTGG - Intergenic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
993567175 5:89490105-89490127 TGACCCTGCTTCCCAATTTGGGG + Intergenic
994081481 5:95712305-95712327 AGACCCCATTTCTTAATGAGAGG - Intergenic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
997393961 5:133541521-133541543 AGACCCTGCCTCTCAACAAGAGG + Intronic
998533621 5:142908685-142908707 AGACCCTGCCTCTCCATGGGAGG + Intronic
999022934 5:148190397-148190419 AGACCTCACTTCTCAATGAAAGG + Intergenic
999893289 5:156001954-156001976 TGACCCTGGCTCTCAATGTGAGG - Intronic
1000096742 5:157977988-157978010 ACACCCTGCTTCTGTTTGAGAGG + Intergenic
1001698270 5:173688774-173688796 AAGCCCTCCTTCTCAATGAGTGG + Intergenic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1004919629 6:20364309-20364331 AGACCCTGGTTCTCCATGAGAGG - Intergenic
1006640969 6:35489679-35489701 AGGCCCTACTCCTCAACGAGAGG + Intronic
1007075103 6:39061164-39061186 AGACCCAAGTTCTCAATTAGAGG - Intronic
1010172198 6:72987183-72987205 AGAGCCGGCTCCTCAATGATTGG - Intronic
1011661593 6:89599361-89599383 AGACCCTGTCTCAAAATGAGTGG + Intronic
1012732806 6:102903212-102903234 AAAACCTACCTCTCAATGAGAGG - Intergenic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1014685563 6:124495583-124495605 AGACCTTGCTCCTCAAAGTGTGG - Intronic
1015598750 6:134892029-134892051 ACACCCTCCTTCTCTATGATTGG - Intergenic
1016565321 6:145445817-145445839 AGACCCCGCCTCTCAATGAGAGG - Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1018157234 6:160996933-160996955 CACCCCTGCTTCTGAATGAGAGG + Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1018873894 6:167803599-167803621 AGACCATACTTCTGAATCAGAGG + Intergenic
1019668229 7:2263480-2263502 GGACCCTGCTGCTCAAAGAGTGG + Intronic
1020319053 7:6926965-6926987 AGCCCCTGCTTCTAGGTGAGAGG + Intergenic
1023317648 7:38956814-38956836 AGCTCCAACTTCTCAATGAGGGG + Intergenic
1023487972 7:40707161-40707183 AGAACCTGCCTTTAAATGAGGGG + Intronic
1027289415 7:76687811-76687833 ATACCCTTCTCCTCAAAGAGTGG + Intergenic
1029965673 7:104737371-104737393 AGACCCAACTTCTCAGAGAGAGG + Intronic
1030213311 7:107018014-107018036 AGAGCCTGCTTGACAATGAATGG - Intergenic
1034401874 7:150867298-150867320 AGACCCCACATCTCAATGGGAGG + Intergenic
1040535059 8:48301854-48301876 AGACTCTGCCTCTCGATGGGAGG + Intergenic
1041159595 8:55025971-55025993 ATACCCTGCTTCTCCATCTGTGG - Intergenic
1041494673 8:58472145-58472167 GGACTCCACTTCTCAATGAGAGG + Intergenic
1042961763 8:74310934-74310956 AGTCCCTGCCTCTGAATGTGAGG + Intronic
1043050992 8:75385339-75385361 AAACCCTGCTTCACAAGGATAGG - Intergenic
1043209743 8:77496819-77496841 AGGCACTACTTCTTAATGAGAGG + Intergenic
1044559507 8:93598541-93598563 AGACCCCTCCTCTCAATGGGTGG + Intergenic
1045828612 8:106430894-106430916 AGACCTTACATCTCAATGAGAGG - Intronic
1045901930 8:107292132-107292154 AGAGCCTGCTTCTCAAAATGTGG - Intronic
1046780851 8:118213191-118213213 AGACCCCATCTCTCAATGAGAGG - Intronic
1047474020 8:125207996-125208018 AGACTCTGCTTCTTGATGGGAGG + Intronic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1051714824 9:19971544-19971566 AGACACTGCTTTTCCCTGAGTGG - Intergenic
1055751547 9:79512161-79512183 GGTACCTGCTTCTCAATTAGTGG + Intergenic
1056112201 9:83407046-83407068 AGATCCTGCTTCTGCATGAGAGG + Intronic
1059077240 9:111206425-111206447 TGACCCTGCCTCTCAATGGGAGG + Intergenic
1059146825 9:111907265-111907287 AGACTCTACTTCTGAATGAGAGG + Intronic
1059524471 9:114977669-114977691 AGACCCTGTCTCTAAAAGAGGGG - Intergenic
1060235057 9:121856977-121856999 AGCCCCTGATTCTCAAGGAGAGG - Intronic
1060446382 9:123692053-123692075 GGAGCCTGCTTGTCAATGGGAGG - Intronic
1060898033 9:127231639-127231661 AGACATTGCTTCTCAAAGTGTGG + Intronic
1061238545 9:129356099-129356121 AGACCCTACCTCTTAATGATGGG + Intergenic
1061944139 9:133899122-133899144 AGACCCTTCCTCTTGATGAGAGG + Intronic
1061944525 9:133901403-133901425 AGACCCTGCCTCTTGATGGGAGG - Intronic
1062080722 9:134622007-134622029 AGCCCCTGCTCCTCAATGTGGGG - Intergenic
1203466083 Un_GL000220v1:88584-88606 AGACCCTCCTTCTCAATTTTTGG + Intergenic
1188065688 X:25656668-25656690 AAACCCTGCTTCACAATGATAGG + Intergenic
1188680518 X:32997878-32997900 GGACCCTGAGTCTCTATGAGTGG - Intronic
1189368169 X:40406091-40406113 AGGCCCCACTCCTCAATGAGAGG - Intergenic
1189571190 X:42299413-42299435 AGAGCCTGCCTCTCAGTCAGTGG + Intergenic
1190063696 X:47226355-47226377 AGAACCTGCTCATCAACGAGAGG + Exonic
1194217650 X:91150260-91150282 TGACTCTGCTTCTTAATGTGTGG + Intergenic
1195368461 X:104149730-104149752 TGACCCTACTTCTCAATGGAAGG + Intronic
1197608861 X:128616220-128616242 AGACCTTGACTCTCCATGAGAGG + Intergenic
1199450882 X:147977882-147977904 AGTCCCAGCTTCTAATTGAGGGG - Intergenic
1200554161 Y:4614055-4614077 TGACTCTGCTTCTTAATGTGTGG + Intergenic
1201569118 Y:15395601-15395623 ACACCCTGATTCTCAAAGTGAGG + Intergenic