ID: 952867192

View in Genome Browser
Species Human (GRCh38)
Location 3:37862004-37862026
Sequence GCTCCCGCCGCCGCCGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1369
Summary {0: 2, 1: 7, 2: 123, 3: 326, 4: 911}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952867192_952867204 16 Left 952867192 3:37862004-37862026 CCAGCGGCGGCGGCGGCGGGAGC 0: 2
1: 7
2: 123
3: 326
4: 911
Right 952867204 3:37862043-37862065 GCCGCCTCTCCCAGAGCGCGGGG 0: 1
1: 0
2: 1
3: 27
4: 654
952867192_952867208 21 Left 952867192 3:37862004-37862026 CCAGCGGCGGCGGCGGCGGGAGC 0: 2
1: 7
2: 123
3: 326
4: 911
Right 952867208 3:37862048-37862070 CTCTCCCAGAGCGCGGGGCCGGG 0: 1
1: 0
2: 1
3: 21
4: 211
952867192_952867198 -7 Left 952867192 3:37862004-37862026 CCAGCGGCGGCGGCGGCGGGAGC 0: 2
1: 7
2: 123
3: 326
4: 911
Right 952867198 3:37862020-37862042 CGGGAGCTGGGGCGCGGGCCCGG 0: 1
1: 1
2: 5
3: 120
4: 1042
952867192_952867207 20 Left 952867192 3:37862004-37862026 CCAGCGGCGGCGGCGGCGGGAGC 0: 2
1: 7
2: 123
3: 326
4: 911
Right 952867207 3:37862047-37862069 CCTCTCCCAGAGCGCGGGGCCGG 0: 1
1: 1
2: 3
3: 23
4: 221
952867192_952867199 -6 Left 952867192 3:37862004-37862026 CCAGCGGCGGCGGCGGCGGGAGC 0: 2
1: 7
2: 123
3: 326
4: 911
Right 952867199 3:37862021-37862043 GGGAGCTGGGGCGCGGGCCCGGG 0: 1
1: 1
2: 13
3: 99
4: 912
952867192_952867203 15 Left 952867192 3:37862004-37862026 CCAGCGGCGGCGGCGGCGGGAGC 0: 2
1: 7
2: 123
3: 326
4: 911
Right 952867203 3:37862042-37862064 GGCCGCCTCTCCCAGAGCGCGGG 0: 1
1: 0
2: 3
3: 29
4: 213
952867192_952867212 27 Left 952867192 3:37862004-37862026 CCAGCGGCGGCGGCGGCGGGAGC 0: 2
1: 7
2: 123
3: 326
4: 911
Right 952867212 3:37862054-37862076 CAGAGCGCGGGGCCGGGCGGCGG 0: 1
1: 0
2: 8
3: 72
4: 990
952867192_952867209 24 Left 952867192 3:37862004-37862026 CCAGCGGCGGCGGCGGCGGGAGC 0: 2
1: 7
2: 123
3: 326
4: 911
Right 952867209 3:37862051-37862073 TCCCAGAGCGCGGGGCCGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 330
952867192_952867202 14 Left 952867192 3:37862004-37862026 CCAGCGGCGGCGGCGGCGGGAGC 0: 2
1: 7
2: 123
3: 326
4: 911
Right 952867202 3:37862041-37862063 GGGCCGCCTCTCCCAGAGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 187
952867192_952867213 28 Left 952867192 3:37862004-37862026 CCAGCGGCGGCGGCGGCGGGAGC 0: 2
1: 7
2: 123
3: 326
4: 911
Right 952867213 3:37862055-37862077 AGAGCGCGGGGCCGGGCGGCGGG 0: 1
1: 0
2: 9
3: 66
4: 572

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952867192 Original CRISPR GCTCCCGCCGCCGCCGCCGC TGG (reversed) Intronic
900090162 1:916748-916770 GCTCCCGGGGCCGGCGCCGAGGG + Intergenic
900100659 1:960777-960799 GCCTCCACCGCCGCAGCCGCCGG + Exonic
900109377 1:999139-999161 GCTCGCGCCGCCGCTGCTGCCGG - Exonic
900109675 1:1000234-1000256 GCTCCGGGCGCGGCCTCCGCGGG + Intergenic
900154191 1:1197558-1197580 GCTCGTGCAGCCTCCGCCGCTGG + Exonic
900181378 1:1312501-1312523 GCTCCTGCCACCTCCTCCGCAGG - Exonic
900204918 1:1427631-1427653 TCTCTCGCTGCCGCCGCTGCTGG + Exonic
900214062 1:1471853-1471875 GCCGCCGCCGCTACCGCCGCCGG - Exonic
900221611 1:1512237-1512259 GCCGCCGCCGCTACCGCCGCCGG - Exonic
900247237 1:1642416-1642438 GCTCCCGCGGCGGCCGAGGCGGG + Exonic
900249299 1:1658929-1658951 GCTGCCGCCGCCGCCGCCGCCGG + Exonic
900258461 1:1709548-1709570 GCTCCCGCGGCGGCCGAGGCGGG + Exonic
900289840 1:1919178-1919200 GCTCCTGCCGCTGCCGCAGGTGG - Exonic
900314566 1:2050464-2050486 GCTCCCGCCCCGCGCGCCGCCGG + Exonic
900408970 1:2504346-2504368 GCTCCAGCCGCTGCCACAGCGGG - Exonic
900435541 1:2629027-2629049 GCCTCCGCCTCCGCCTCCGCCGG - Intronic
900514165 1:3073492-3073514 GCTCCCGTCGCCGGCGCGGGAGG + Intronic
900525434 1:3126233-3126255 GCTCTCGCCGCCGCCGCACGCGG + Intronic
900578036 1:3393998-3394020 CCTGGAGCCGCCGCCGCCGCGGG - Intronic
901017937 1:6242377-6242399 GCGCCCGCCCCCGCCCCCTCGGG - Intergenic
901084641 1:6603023-6603045 GCGCCCGCCCCCGGCTCCGCAGG + Intronic
901086226 1:6613826-6613848 TCTCCCGCCTCTACCGCCGCGGG + Exonic
901109783 1:6785472-6785494 CCTCGTACCGCCGCCGCCGCCGG - Exonic
901506572 1:9689436-9689458 GCCCGCGCCGCCGCCGGCCCCGG + Intronic
901628975 1:10639030-10639052 GCCGCCTCCGCCGCCGCCTCGGG + Exonic
901629012 1:10639210-10639232 GCCGCCGCCGCCGCCGCAGCTGG - Exonic
901629026 1:10639249-10639271 CCGCCCGACGCCGCCGCCCCCGG - Exonic
902923133 1:19679152-19679174 GCTGCCGCTGCCCCTGCCGCCGG + Exonic
903115521 1:21176259-21176281 GCCGCCGCTGCTGCCGCCGCCGG + Exonic
903115634 1:21176590-21176612 GCCTCCGCCGCCGCCGCCGCCGG + Intronic
903324741 1:22563450-22563472 GCCGCCGCCGCCGCCGCCCCGGG - Intergenic
903398408 1:23020008-23020030 CCGCCCTCCCCCGCCGCCGCCGG + Intronic
903652324 1:24929785-24929807 CTTGCCGCCGCCGCCGCCGCAGG + Exonic
903832900 1:26185119-26185141 GCCCGCGCTGGCGCCGCCGCTGG + Exonic
903907486 1:26696765-26696787 GCTGCCGCCACCGCCGCCGCCGG - Exonic
904005437 1:27360937-27360959 GCGCCCTCCGCCTCCTCCGCGGG + Exonic
904039292 1:27575173-27575195 CCCGCCGCCGCCGCCGCCTCTGG + Intronic
904181396 1:28668986-28669008 GTGCGTGCCGCCGCCGCCGCCGG + Intronic
904252932 1:29237668-29237690 GGCCCCGCGGCCGCCGCCTCGGG + Intronic
904500199 1:30908782-30908804 TGCGCCGCCGCCGCCGCCGCCGG + Intergenic
904642016 1:31938144-31938166 CGCGCCGCCGCCGCCGCCGCCGG - Exonic
904642059 1:31938374-31938396 GCTCCCGCCGCCGCCCCTCAGGG + Exonic
904837745 1:33349915-33349937 GCTCCCGCGGCCGCCTCCGCCGG + Intronic
905067066 1:35192737-35192759 GCAGCCGCCGCCACCGCCGCAGG - Exonic
905137071 1:35808166-35808188 GCCGCCGCCGCCGCCGCCAACGG - Exonic
905212701 1:36385639-36385661 GATTCCACCGCCGCGGCCGCCGG + Intronic
905449006 1:38045435-38045457 GCCCCCACCGCCCCCGCCGGCGG - Exonic
905867162 1:41382612-41382634 GGCCCTGCCTCCGCCGCCGCCGG + Exonic
906204394 1:43979334-43979356 GCCGCCGCCGCCGCCGCCGCGGG - Intronic
906262530 1:44405410-44405432 GCCGCCGCCGCTGCCTCCGCCGG + Exonic
906365389 1:45205890-45205912 GCTCCGGCCGGCTCCGCCCCCGG - Exonic
906376950 1:45303771-45303793 GCTTCCGGGGCCGCCGCCTCTGG + Intronic
906480950 1:46198470-46198492 GCCGCCGCCGCCGCTGCCGCGGG + Intronic
906637014 1:47416489-47416511 GCCGCCGCCGCCGCCGCCCCGGG - Exonic
906960919 1:50419098-50419120 GCCGCCGCCGCCGCCGCCGGGGG - Exonic
906960923 1:50419101-50419123 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
907010628 1:50959889-50959911 GCCACCGCCGCCGCCGCCGCCGG + Exonic
907038334 1:51236348-51236370 GCTGCTGCCCCCGCCGACGCCGG - Exonic
907136228 1:52142062-52142084 GCTCCTGCCGCCGGCGCCGCTGG - Intergenic
907178887 1:52553014-52553036 GCCGTCGCCGCTGCCGCCGCTGG + Intronic
907430053 1:54406369-54406391 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
908131842 1:61082375-61082397 GCTCGCGCCGCCGCCGCGGGGGG - Intronic
908355808 1:63323923-63323945 GCCGCGGCCGCCGCCGCTGCCGG - Exonic
908401131 1:63774054-63774076 GCCGCCACCGCCGCCGCCGAGGG + Exonic
908527586 1:65002690-65002712 GCCCCCGCCTCCGCCGCCGCCGG - Intergenic
908751679 1:67430157-67430179 GCCCCCAACGCCGCCCCCGCCGG + Exonic
910549733 1:88462712-88462734 CCTCTCGCCGCAGCTGCCGCTGG + Intergenic
910676414 1:89821084-89821106 GCTGCCGCTGCCGCCGCCCGTGG + Exonic
910759000 1:90717596-90717618 GCCGCCGCCGCCGCCGCTGCCGG + Intergenic
912486660 1:110034694-110034716 GCCCCCGCCACCTCCGCCGCCGG + Exonic
913615719 1:120558170-120558192 GCCGCCGCCGCCGCCGCCTCGGG - Intergenic
913632521 1:120723955-120723977 GCCGCCGCCTCAGCCGCCGCCGG - Intergenic
913681090 1:121187223-121187245 GCACCAGCCGCCGCCGCACCCGG + Exonic
914032920 1:143974863-143974885 GCACCAGCCGCCGCCGCACCCGG + Intergenic
914156526 1:145093103-145093125 GCACCAGCCGCCGCCGCACCCGG - Exonic
914213962 1:145607893-145607915 GCTCCCGCCGCGGAGGCCCCAGG - Intergenic
914428599 1:147600194-147600216 GCCGCCGCCGCTGCCGCCGCCGG + Intronic
914428603 1:147600197-147600219 GCCGCCGCTGCCGCCGCCGGGGG + Intronic
914574557 1:148952732-148952754 GCCGCCGCCGCCGCCGCCTCGGG + Intronic
914730392 1:150364664-150364686 GCCGCCGCCGCCGCCGCCAGAGG + Intronic
914730409 1:150364722-150364744 ACTGCTGCCTCCGCCGCCGCCGG - Exonic
914919538 1:151838216-151838238 GCAGCCGCCGCCGCCGCTCCCGG + Exonic
915070346 1:153261152-153261174 GCCCCCGCCCCCGCCGCCGGAGG - Exonic
915070348 1:153261155-153261177 GCCGCCCCCGCCCCCGCCGCCGG - Exonic
915070480 1:153261638-153261660 TCCGCCGCTGCCGCCGCCGCCGG - Exonic
915070490 1:153261674-153261696 GCTCCCGCCGCCCCCGCCGCTGG - Exonic
915248401 1:154571909-154571931 GCTCACGCTGGCGTCGCCGCAGG - Exonic
915326077 1:155081934-155081956 GCCGCCGCCGCCGCTGTCGCAGG + Intronic
915463192 1:156081740-156081762 GGCCCCGCCGCCGCCGCCCGCGG - Exonic
915495964 1:156282762-156282784 GCCGCAGCCGCCGCCGCCACCGG + Exonic
916065509 1:161132648-161132670 GCCGCCGCCGCCGCGGCCGTGGG + Exonic
917974719 1:180231148-180231170 GCGCCCGCCGCGTGCGCCGCGGG + Intronic
919712284 1:200739615-200739637 GCCGCCGCCGCCGCCGCTCCCGG - Exonic
919742636 1:200990098-200990120 TCTCCCGCCTCCGCCCCAGCAGG + Intronic
919847042 1:201648817-201648839 GGCCATGCCGCCGCCGCCGCCGG - Exonic
920394167 1:205631815-205631837 TCTCCCGCCGCCGCGGCTCCTGG + Exonic
920468402 1:206205747-206205769 GCACCAGCCGCCGCCGCACCCGG + Intronic
920705008 1:208244297-208244319 GCCGCCGCCGCCGCCACCGCGGG - Exonic
921089643 1:211830634-211830656 TCTTCCGCCGGCCCCGCCGCCGG - Exonic
921604757 1:217139698-217139720 CCGCGCACCGCCGCCGCCGCCGG - Intergenic
922200239 1:223394597-223394619 GCTCCCGCAGGCGCCGCACCTGG - Exonic
922740223 1:228010328-228010350 CCTCCCGCCACCGCCTCCCCAGG + Intronic
922753738 1:228082873-228082895 CCTGTCGCCGCCGCCGCCGCGGG - Intronic
922766244 1:228158093-228158115 GCGCCCTCCGCCGCCGCCCGGGG + Exonic
922775808 1:228213790-228213812 GCTCCCCCCTCCCCCGCCCCCGG - Intronic
922832259 1:228609822-228609844 ACCCCCGCCGCAGCCGCAGCCGG - Intergenic
922832819 1:228612063-228612085 ACCCCCGCCGCAGCCGCAGCCGG - Intergenic
922833380 1:228614304-228614326 ACCCCCGCCGCAGCCGCAGCCGG - Intergenic
922833940 1:228616545-228616567 ACCCCCGCCGCAGCCGCAGCCGG - Intergenic
922834497 1:228618786-228618808 ACCCCCGCCGCAGCCGCAGCCGG - Intergenic
922835051 1:228621001-228621023 ACCCCCGCCGCAGCCGCAGCCGG - Intergenic
922835608 1:228623221-228623243 ACCCCCGCCGCAGCCGCAGCCGG - Intergenic
922836166 1:228625463-228625485 ACCCCCGCCGCAGCCGCAGCCGG - Intergenic
922836724 1:228627702-228627724 ACCCCCGCCGCAGCCGCAGCCGG - Intergenic
922837283 1:228629944-228629966 ACCCCCGCCGCAGCCGCAGCCGG - Intergenic
922837844 1:228632185-228632207 ACCCCCGCCGCAGCCGCAGCCGG - Intergenic
922838402 1:228634425-228634447 ACCCCCGCCGCAGCCGCAGCCGG - Intergenic
922838960 1:228636650-228636672 ACCCCCGCCGCAGCCGCAGCCGG - Intergenic
922839520 1:228638891-228638913 ACCCCCGCCGCAGCCGCAGCCGG - Intergenic
922840081 1:228641122-228641144 ACCCCCGCCGCAGCCGCAGCCGG - Intergenic
922840641 1:228643363-228643385 ACCCCCGCCGCAGCCGCAGCCGG - Intergenic
922841204 1:228645594-228645616 ACCCCCGCCGCAGCCGCAGCCGG - Intergenic
922958587 1:229625909-229625931 CCCCCCGCCGCCGCCGCCTCCGG + Exonic
923141347 1:231163196-231163218 ACTCCCGCCTGCACCGCCGCAGG - Exonic
923191771 1:231626892-231626914 GCCCCAGCCGCCGCCGGCGGCGG + Exonic
923191777 1:231626902-231626924 GCTCACGCCGCCGCCGCCGGCGG - Exonic
923506403 1:234609608-234609630 GCGGCCGCCGCCGCCGCTGGTGG - Intergenic
923506404 1:234609611-234609633 TTTGCGGCCGCCGCCGCCGCTGG - Intergenic
923684194 1:236142592-236142614 ACGGCCGCCGCCGCCCCCGCGGG - Exonic
923744307 1:236686413-236686435 GCCCCCGCCGCCACCGCCCCCGG - Intergenic
924289722 1:242524714-242524736 CCCGCCGCCGCCGCCGCCCCGGG - Intergenic
924383418 1:243483197-243483219 GCGCCCGCCGCCTCCTCCCCGGG - Intronic
924384263 1:243487800-243487822 GCTCCCGCCTCCCCCGGCACAGG + Intronic
924436681 1:244048904-244048926 CCGGCCGCCGCCGCCGCCGCCGG - Intergenic
924502858 1:244653171-244653193 GCTTCCGCCCCGGCTGCCGCGGG + Exonic
924754787 1:246931493-246931515 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
924853998 1:247857676-247857698 GCGCCCGCAGCCCCCGCCGGGGG - Intronic
1062774791 10:135762-135784 GGCCCCGCCGCCGCCCTCGCAGG - Intronic
1063418241 10:5890306-5890328 GACCCCGCTGCCGCCGCCGCCGG - Intronic
1063429621 10:5977405-5977427 GCTCCGGCCGCCGGCGACGCGGG - Exonic
1063443148 10:6089394-6089416 CCTCCGCCCGCCGCCGCCTCTGG + Exonic
1063664100 10:8051507-8051529 GATGCCGCCGCCGCCGCCGCAGG - Intergenic
1064209078 10:13348112-13348134 CCCGCCGCCGCCGCCGCCGCCGG - Exonic
1064230945 10:13528946-13528968 GCCGCCGCCGCCGCGACCGCAGG - Intronic
1064274199 10:13891772-13891794 CCCGCCGCCGCCCCCGCCGCGGG + Intronic
1064553116 10:16521722-16521744 GTGCCCGCCGCCGCCGCCGCTGG - Exonic
1064645442 10:17454593-17454615 GCTGCCGCCGCCGCCGCGCGGGG + Intergenic
1064662062 10:17616933-17616955 GCTGTCGCCGCGGCCACCGCCGG - Intronic
1064712434 10:18140767-18140789 GCCACCGCCGCCGCCGCTGTGGG - Exonic
1064981872 10:21173845-21173867 GCCGCCGCCGCCGCCGCCCCCGG - Intronic
1064982007 10:21174338-21174360 CCTCGCGCCACCGCCGCTGCAGG + Intergenic
1065214940 10:23439716-23439738 GCGCCCGCCTCCGCCGCCGCCGG + Exonic
1065589782 10:27252571-27252593 GCCCCCGCCGCCGCCGCCAGGGG + Intergenic
1065712734 10:28533158-28533180 CCCGCCGCCGCCGCCGCCGCTGG - Intronic
1065925999 10:30434243-30434265 GCTTCTGCCGCTGCCGCCGCCGG + Exonic
1066180468 10:32957550-32957572 GCTCCCGCCGCCCCCGCCCGCGG + Intronic
1066370456 10:34814990-34815012 TTTCATGCCGCCGCCGCCGCGGG + Exonic
1066429268 10:35336652-35336674 GCCGCCGTCGCCGCAGCCGCCGG + Intronic
1066429329 10:35336849-35336871 GCCGCCGCCGCCGCCGCCCATGG + Intronic
1066464802 10:35641985-35642007 CAAGCCGCCGCCGCCGCCGCCGG + Exonic
1067091329 10:43267005-43267027 GCTCCCTCCGCAGCCGGCGCCGG + Intergenic
1067362416 10:45594709-45594731 CCGCGCGCAGCCGCCGCCGCTGG - Intronic
1068910524 10:62374420-62374442 GCTGCTGCAGCCGCCGCCTCCGG - Exonic
1069019186 10:63466135-63466157 GCCGCCGCCGCCGCCGCCTCTGG - Intergenic
1069386076 10:67884630-67884652 TCTCCCGCAGCCGGAGCCGCGGG + Intergenic
1069544540 10:69319015-69319037 GCCCCCGCCCGCGCCGCCGCTGG + Intronic
1069976287 10:72216008-72216030 GCGCACGCCGCCTTCGCCGCTGG + Exonic
1070768402 10:79069216-79069238 GGACGCGCCGCCGCCACCGCCGG - Exonic
1070768407 10:79069240-79069262 GCGAGCGCCGCTGCCGCCGCTGG - Exonic
1070800833 10:79243558-79243580 CCCCGCGCCGCCGCCGCCGCCGG + Intronic
1070800860 10:79243659-79243681 TCGCTCGCCGCGGCCGCCGCCGG + Intronic
1070895846 10:79982374-79982396 GCTCCCCACGGCCCCGCCGCGGG - Intronic
1071695294 10:87863516-87863538 GCCCCCTCCGCCGCCGCGCCGGG - Exonic
1071695356 10:87863795-87863817 GCCGCCGCTGCCGCCGCCGCAGG - Exonic
1071966591 10:90858106-90858128 GTCCCCGCCGCCGCCGCCTCCGG + Intergenic
1071997520 10:91162878-91162900 AGCGCCGCCGCCGCCGCCGCGGG + Intergenic
1072409071 10:95183876-95183898 CCTGCCGCCGCCGCCGCCCCGGG + Intergenic
1073063521 10:100745672-100745694 GCGCACGCCGCCGCGGCCGAAGG - Intronic
1073137375 10:101227438-101227460 GCCGCAGCCGCCGCCACCGCCGG + Exonic
1073196437 10:101695146-101695168 GCCGCCACCGCCGCCGCCCCGGG + Exonic
1073325978 10:102644170-102644192 GCCGCCGCTGCCGCCGCCGCCGG + Intergenic
1074121689 10:110498105-110498127 CTTCATGCCGCCGCCGCCGCCGG - Exonic
1074169721 10:110919955-110919977 CCGCCCGCCGCCGCCGCCGCAGG - Intronic
1074503105 10:114043913-114043935 GCCGCCGCCGCCGCTGCTGCTGG - Intergenic
1074722120 10:116272606-116272628 GCTGCCGCCGCCGCCACCGAGGG - Intronic
1074814503 10:117134309-117134331 GCAGCCGCCGCCGCCGCCCCGGG - Exonic
1074865721 10:117543424-117543446 TCGGCCGCCGCCGCCGCCGCCGG + Exonic
1075129492 10:119726067-119726089 GCCGCTGCCGCCGCCGCTGCCGG + Intergenic
1075629408 10:123991961-123991983 GTTCCCGAGGCCGCCGTCGCCGG - Intergenic
1075802168 10:125160404-125160426 GCCGCCACCGCCACCGCCGCCGG - Intronic
1076035673 10:127196690-127196712 CCTCCCGCCGCCGCCAGAGCTGG + Intronic
1076116944 10:127907387-127907409 GCTGCCTCGGCCGCTGCCGCGGG + Intronic
1076146484 10:128126287-128126309 GCTCCCGCCGCCGCCTCTGACGG + Exonic
1076554208 10:131311518-131311540 GCCGCCGCCGCCGCCGCCCTGGG - Exonic
1076554221 10:131311593-131311615 GCAGCTGCCGCCGCCGCCGCTGG + Exonic
1076554275 10:131311787-131311809 GCCCGCGCCGCCGCCGCCCCCGG + Intergenic
1076638915 10:131901020-131901042 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1076722087 10:132397163-132397185 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1076998508 11:310903-310925 GCTCCCACCGCGGCCGCCCATGG - Intronic
1077000235 11:318856-318878 GCTCCCACCGCGGCCGCCCATGG + Intergenic
1077065141 11:637696-637718 GCCCCTGCCGCCGCCCCAGCTGG - Intronic
1077204943 11:1337502-1337524 GCGCCCCCCGCCCCCGCCTCGGG - Intergenic
1077298101 11:1835371-1835393 GCTGCTGCTGCCGCCGCCACAGG + Exonic
1077637747 11:3855324-3855346 GCTGCTGTCGCCGCCGCCGCAGG + Intronic
1077898785 11:6473906-6473928 CCCCGCGCCGGCGCCGCCGCCGG + Intronic
1078216186 11:9314192-9314214 GCTCCCGCCGCGGCGCCAGCAGG + Intronic
1078527230 11:12110462-12110484 GCTGTCACCGCCGCTGCCGCCGG - Intronic
1078659825 11:13277858-13277880 CTCACCGCCGCCGCCGCCGCGGG + Exonic
1079689406 11:23403535-23403557 CGCGCCGCCGCCGCCGCCGCGGG + Intergenic
1080609716 11:33893256-33893278 TCTCCCGGCGCAGCCGCGGCAGG - Intergenic
1081700078 11:45147105-45147127 GCTGCCGCCGCCGCGGGAGCCGG + Intronic
1081773923 11:45665259-45665281 GCTGCCGCCGCCGCCACCCGCGG - Exonic
1082787517 11:57324917-57324939 GCCGCCGCCGCCGTCACCGCGGG + Intronic
1082824536 11:57567985-57568007 GCTCCCGGTGCGGCCGCCGGCGG - Intronic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1083207495 11:61161402-61161424 GCCGTCGCCGCCGCCACCGCGGG + Exonic
1083246221 11:61429982-61430004 GGTCCCGCCCCCCCCGCCGCCGG + Intronic
1083448511 11:62726998-62727020 GGGCCCGGCCCCGCCGCCGCCGG + Exonic
1083562180 11:63681704-63681726 GCTCCCGCCGCCGCCGGGCGCGG - Exonic
1083593682 11:63909245-63909267 GCCCCCGCCGCCCCCGCTCCTGG - Exonic
1083595549 11:63916967-63916989 GTCGCCGCCGCCGCCGCCGCCGG - Intergenic
1083617984 11:64035844-64035866 GCTCGCGCGGGCACCGCCGCTGG + Intronic
1083618446 11:64037326-64037348 GCTGCCTCCCCCGCGGCCGCCGG - Intronic
1083751863 11:64765488-64765510 GCTCGGGCCATCGCCGCCGCGGG + Exonic
1083807497 11:65083836-65083858 CCTCCCGCTGCCGCCGCCGGAGG - Intronic
1083886562 11:65576139-65576161 GCGCTCTCCGCTGCCGCCGCTGG - Exonic
1083970303 11:66070404-66070426 GCCCCCGCCGCCGCCGCCGCGGG + Intronic
1083970350 11:66070518-66070540 GCTGCCGCCCCCGGCGCCTCCGG - Exonic
1083970555 11:66071161-66071183 GCTCCCGGCGCCGGCGAGGCAGG - Intronic
1084085207 11:66851884-66851906 GCTCCTGCAGCCGCCGCCAGGGG + Exonic
1084128701 11:67118228-67118250 GCGCCGGCCGCCACCGCCCCCGG + Intergenic
1084128768 11:67118441-67118463 GGCCCCGGCGCCGCCGCCACGGG - Intergenic
1084129037 11:67119341-67119363 GCCGCCGCCGCCGCCGCTGCCGG - Intronic
1084192200 11:67504364-67504386 GCTCCCGGCCCCGGCGGCGCGGG - Intronic
1084193280 11:67508597-67508619 GCTGCCGTCGCCGCTGCCACCGG + Exonic
1084546849 11:69818951-69818973 CCTGCAGCCGCCGCCGCCGCGGG - Exonic
1084973123 11:72781943-72781965 GCGCCCGCCCCCGCCGGCCCTGG + Intronic
1085208066 11:74749048-74749070 GCCGCCGCTGCCGCCGCGGCCGG + Exonic
1085284629 11:75351733-75351755 GCCGCCGCCGCCCCCGCCCCCGG + Intergenic
1085332955 11:75668213-75668235 GCCACCGCCGCCGCAGCAGCAGG - Exonic
1085353391 11:75815231-75815253 GCTGCCGCCGTTGCCGCCGCTGG - Exonic
1085399051 11:76224642-76224664 GCTCCCGGCCACCCCGCCGCAGG - Intergenic
1085423206 11:76381063-76381085 TTTACCGCCGCCGCCGCCGCTGG + Intergenic
1085561271 11:77474210-77474232 GCAGCCGCCGCCGCCGCGCCGGG - Intronic
1086887837 11:92224977-92224999 GCCGCCGCCGCCGCCGCCGGGGG - Intergenic
1086887840 11:92224980-92225002 GACGCCGCCGCCGCCGCCGCCGG - Intergenic
1086888257 11:92226825-92226847 CCTCCCGCCGCGGCTGCTGCAGG - Intergenic
1087076225 11:94129108-94129130 GCGCTCGCTGCCTCCGCCGCCGG - Exonic
1088677252 11:112206301-112206323 GCTGCCGCCCCTGCCGCCCCAGG - Intronic
1088868982 11:113875531-113875553 TCTCCCGCCGCAGCCGCCGCCGG + Exonic
1088893162 11:114060034-114060056 GCTGCAGCCGTCGCCGCCACCGG + Intronic
1089078855 11:115760098-115760120 GCGCCCAGCGCCCCCGCCGCGGG + Intergenic
1089432653 11:118436559-118436581 CCCCCCGCCGCCGCCGCCCCCGG - Exonic
1089494867 11:118902806-118902828 ACTGCCGCCGCCGCCACCCCCGG - Exonic
1089543668 11:119206289-119206311 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1089700247 11:120240224-120240246 GCTCCCGCGGCGGCGGCGGCCGG + Intronic
1089700249 11:120240227-120240249 TTCCCGGCCGCCGCCGCCGCGGG - Intronic
1089729460 11:120511526-120511548 GCCCCCGCCGCCCCCGCGCCTGG + Intergenic
1090780385 11:130002208-130002230 GCCCGCGCAACCGCCGCCGCCGG + Intronic
1091286771 11:134412303-134412325 GGTCCCGCCGGCGCTGGCGCGGG - Intergenic
1091474043 12:753974-753996 CCTCCAGCCGCTGCCGCCCCTGG + Exonic
1091558583 12:1594166-1594188 GCCGCCGCCGCCGCCGCCTCGGG + Intronic
1091759458 12:3077383-3077405 GCCGCCGCCGCCGCCGCCAGCGG - Exonic
1092659472 12:10722951-10722973 GCGCCCGCCGCCCACGTCGCAGG - Exonic
1092860736 12:12717302-12717324 GCTCCCGCCGCCGCAACCAATGG + Exonic
1093435340 12:19129743-19129765 GCTGCCGCCGCGGCTGCCGAGGG - Intronic
1093931129 12:24956087-24956109 GCCCCCTCCGCCCCCGCCCCGGG + Intergenic
1094025763 12:25958680-25958702 GCTCCCGCGGCCGGTGCCTCTGG - Intergenic
1094041122 12:26122642-26122664 GCCGCCGCTGCCGCCGCCGCGGG + Exonic
1094653433 12:32399394-32399416 GCCGCCGCCGCCGCCTCCTCCGG - Intergenic
1094841702 12:34345066-34345088 GTTCCCGCCGCCGGAGCTGCTGG - Intergenic
1095584554 12:43836016-43836038 ACACCCGCCGCCGCCTACGCCGG - Intronic
1095752803 12:45729688-45729710 GCCGCCGCCGCCGCCACCGCCGG + Exonic
1095953925 12:47795983-47796005 TCTCCTGCAGCCGCAGCCGCTGG + Exonic
1096241182 12:49961305-49961327 CCGCCCGCCCCCGCCGCCGGCGG + Intergenic
1096491363 12:52014902-52014924 GCTGCCGCCCCCGCCGCCCCCGG + Exonic
1096495421 12:52037063-52037085 GCTGCGTCGGCCGCCGCCGCCGG + Intronic
1096983739 12:55743398-55743420 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1097057428 12:56258302-56258324 GGAGCCGCCGCCGCCGCCGCCGG - Exonic
1097107674 12:56634961-56634983 GCCGCCGCCGCCGCCGCCTGCGG - Intronic
1097232825 12:57522735-57522757 GCTGCCGCAGCCGCCGCCGCAGG - Exonic
1097264419 12:57737513-57737535 GCCACCGCCGCCGCCGCCGGGGG - Exonic
1097264423 12:57737516-57737538 GCCGCCACCGCCGCCGCCGCCGG - Exonic
1097264608 12:57738119-57738141 GCGGCCGCGGCCGGCGCCGCCGG - Exonic
1097267565 12:57755076-57755098 GTCTCCGCCGCCGCCGCCGCCGG + Exonic
1097648138 12:62260606-62260628 GCTGCCCCGGCGGCCGCCGCCGG - Intronic
1097929629 12:65169837-65169859 CCCGCGGCCGCCGCCGCCGCTGG - Exonic
1097929671 12:65169969-65169991 GCCTCCGCCGCCCCCGCGGCTGG + Exonic
1097990091 12:65825008-65825030 CCCACCGCCGCCGCCGCCACCGG + Exonic
1098123824 12:67269639-67269661 GCCGCCGCCGCCGCCGCCACTGG - Exonic
1098161045 12:67648661-67648683 CCGCCCTCCTCCGCCGCCGCAGG - Intronic
1098255489 12:68611257-68611279 GGAGCAGCCGCCGCCGCCGCGGG + Intronic
1098426059 12:70366535-70366557 GGCGCTGCCGCCGCCGCCGCCGG + Exonic
1098426062 12:70366538-70366560 GCTGCCGCCGCCGCCGCCGGGGG + Exonic
1098550373 12:71755140-71755162 CGCCCCGCCGCCGCCGCCGCCGG - Exonic
1099133521 12:78864792-78864814 GCTGCCGCTGCCGCTGCTGCAGG - Exonic
1099202160 12:79690200-79690222 GCTGCCGCCGAGGCCGCTGCTGG + Exonic
1100444816 12:94650580-94650602 CCCTGCGCCGCCGCCGCCGCGGG + Intergenic
1100632292 12:96400594-96400616 GCCCCCGCCTCCGCCGCCGCCGG - Intergenic
1101466797 12:104957967-104957989 GCTCCCCGCGCCCCCGCCGCCGG + Intronic
1101935359 12:109052621-109052643 GCTACCGCCGCCGCCGCCGCCGG - Exonic
1102136861 12:110582933-110582955 GTCGCCGCCGCCGCCGCCGCCGG + Exonic
1102136863 12:110582939-110582961 GCCGCCGCCGCCGCCGGCCCTGG + Exonic
1102197154 12:111033966-111033988 GCCGCCGCCGCCGCCGCCAACGG - Intergenic
1102248343 12:111368991-111369013 GCCGCCGCCGTCGCCGCCACCGG - Exonic
1102254047 12:111405993-111406015 GCGGCCGCCGTCGCCACCGCGGG - Exonic
1102346375 12:112163682-112163704 GCTCCCGCAGCCGCAGGCTCCGG + Exonic
1102853861 12:116277232-116277254 GGCCGGGCCGCCGCCGCCGCCGG + Exonic
1103074155 12:117968901-117968923 GCTGCTGCTGCTGCCGCCGCCGG + Intronic
1103308947 12:119989454-119989476 GCTGCTGCTGCTGCCGCCGCCGG - Intergenic
1103433025 12:120904103-120904125 GGAGCCGCCGCCGCCGCCGCGGG - Exonic
1103521248 12:121537911-121537933 GCCGCCGCCGCCGCCGCCGAGGG - Intronic
1103572948 12:121857014-121857036 GCTCCCACCGACCCCTCCGCTGG - Intronic
1103595358 12:122021826-122021848 AGCCGCGCCGCCGCCGCCGCCGG - Exonic
1103649636 12:122422629-122422651 TGACGCGCCGCCGCCGCCGCGGG + Intronic
1103828734 12:123762225-123762247 GCTCGCCCCGCCGACGGCGCCGG - Intergenic
1103954196 12:124567435-124567457 CCTCCCGCCGCCGCCTCCTAGGG + Intronic
1103954253 12:124567590-124567612 GCCACCGCCGCCGCGGCCGCCGG - Intergenic
1104980279 12:132570485-132570507 GCCCCCGCCCCCGGCGCTGCCGG + Exonic
1104983383 12:132583608-132583630 CCGCCCGCCGCCGCCGCCCTCGG + Exonic
1105011855 12:132761617-132761639 GCGGCCGCCGCCCCCGCCTCAGG - Exonic
1106322965 13:28659274-28659296 GCTGCCGCCGCCGCCGCCACCGG - Intronic
1106517089 13:30465194-30465216 GCCGCCGCCGCCGCCGCGACCGG + Intronic
1106539085 13:30674195-30674217 TCTCCCCCCGCGGCGGCCGCTGG - Intergenic
1106735833 13:32586910-32586932 GCCGCCGCCGCCGCCCCGGCCGG - Intronic
1106776848 13:33016965-33016987 GCTCCCGCAGCCGCTCCAGCAGG - Exonic
1106956405 13:34942891-34942913 GCCCCCGCCGCCTCCGCCAGCGG - Exonic
1107133329 13:36919687-36919709 CCGACCGCCGCCCCCGCCGCGGG + Intronic
1107467835 13:40665902-40665924 GCGGCCGCCGCGGCCGCCACCGG - Exonic
1107534076 13:41311277-41311299 GGAACCGCCGCCGCCGCCGCTGG + Exonic
1108373416 13:49792536-49792558 GCCGCCGCCGCCGCAGCCGCAGG - Exonic
1108541494 13:51451731-51451753 GCCGCCGCCGCCGCCGCTGCCGG + Intronic
1110119758 13:71866530-71866552 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1110219625 13:73059372-73059394 GCCCCAGCCGCCGGCGCCGCAGG + Exonic
1110558468 13:76886095-76886117 GCCCCCGCCGCCGCCCCCGTTGG + Exonic
1110596582 13:77326729-77326751 TCCCCCGCCGCCGCCTCCTCGGG - Intronic
1110596659 13:77327051-77327073 GCTACCACCGCCACCACCGCCGG + Intergenic
1111396083 13:87671885-87671907 GCTGCAGCCGCCGCCTTCGCTGG + Intergenic
1111951275 13:94711388-94711410 GCGGCGGCCGCCGCCGCCGGGGG - Exonic
1111951278 13:94711391-94711413 GCAGCGGCGGCCGCCGCCGCCGG - Exonic
1111951317 13:94711550-94711572 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1112050621 13:95641776-95641798 GCTGTGGCCGCCGCCGCCGCGGG - Exonic
1112271905 13:97976486-97976508 TCTCACCCCGCCGCGGCCGCCGG - Intronic
1112290892 13:98143361-98143383 GCCCGCGCCGCCGCCGCCCGCGG + Intronic
1112505033 13:99970403-99970425 GCCGCCGCCGCCACCGCCCCCGG - Exonic
1112505081 13:99970583-99970605 CCCGGCGCCGCCGCCGCCGCCGG - Exonic
1112505231 13:99971112-99971134 GCTGCCGCCGCCGCCACTGTTGG + Exonic
1112507813 13:99985446-99985468 GCCGCCGCTGCCGCCGCCGCTGG - Exonic
1113200987 13:107867317-107867339 GCCGCCGCCGCCGCTGCCGCAGG + Intergenic
1113200997 13:107867341-107867363 CCGCCCGCGGGCGCCGCCGCCGG + Intergenic
1113378132 13:109782945-109782967 GCAGCCGCCGCCACCGCCGCCGG - Exonic
1113655915 13:112067735-112067757 GCCCCCGCCGCCGCCCGCCCCGG - Exonic
1113656100 13:112068502-112068524 GCCGCCGCCGCCGCCGCTGCGGG + Exonic
1113656163 13:112068724-112068746 GCGGCCGCTGCTGCCGCCGCCGG - Exonic
1113942610 13:114026256-114026278 GCTCCCCCCGCCTCGGCTGCTGG - Intronic
1113976962 13:114234970-114234992 GCAGCCGCCGCCGCCGCCCCAGG - Exonic
1114866200 14:26598002-26598024 GCTGCCGCCGCCGCCGCTGCCGG + Intergenic
1115028399 14:28767498-28767520 GCCGCCGCCGCCGCCGCCCCCGG + Exonic
1115203022 14:30874274-30874296 GCTGCCGCCGTCGGGGCCGCCGG + Intergenic
1115235871 14:31207914-31207936 GCTCTCGCCCCCGCCGCCTCGGG + Intergenic
1115399157 14:32938861-32938883 TCCTCCTCCGCCGCCGCCGCCGG + Intronic
1115399318 14:32939416-32939438 GCCGCCGCCTCCGCCGCCGAGGG + Intronic
1116657928 14:47674746-47674768 GCTCCGCTCGCCGCCGCCGCCGG - Exonic
1117251862 14:53946869-53946891 GCCCCCGCCGCCGCCGGGCCTGG + Intergenic
1117675609 14:58152152-58152174 GCTACCGCCGCCGCCGCCGCAGG - Exonic
1118220810 14:63853244-63853266 TCTCCCGCCGCCCCCGCCCCCGG - Intronic
1118339099 14:64879826-64879848 GCCGCCGCCGCCGCCACCCCCGG - Exonic
1118607699 14:67515404-67515426 GCCGCCGCCGCCGCCGCCGGGGG - Intronic
1118607703 14:67515407-67515429 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
1118748349 14:68789897-68789919 GCTGCCACCGCCGCTGCCACCGG - Exonic
1118849300 14:69572290-69572312 GCTCCGCCCGCTCCCGCCGCAGG + Exonic
1119377545 14:74206795-74206817 GCTCCCGCAGCAGCCTCCTCTGG + Intergenic
1119456846 14:74763543-74763565 GGTCCCACCGCCGCCGCCAGTGG + Exonic
1119802375 14:77457527-77457549 GCGCCAGCCTCCGCCGCCGCTGG + Exonic
1119821038 14:77616452-77616474 GCCGCAGCCGCAGCCGCCGCCGG - Exonic
1121050452 14:90816362-90816384 CCGCCTCCCGCCGCCGCCGCGGG + Exonic
1121711048 14:96039448-96039470 GCTGCTGCCGCTGCCGCTGCGGG - Exonic
1122130691 14:99603312-99603334 GCTGCCGCCGCTGCCCGCGCTGG + Exonic
1122130813 14:99603928-99603950 GCCGCCGCCGCCGTCGCCGCGGG + Exonic
1122183498 14:99971991-99972013 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1122418454 14:101561234-101561256 ACTCCGGCAGCCGCTGCCGCTGG - Intergenic
1122445013 14:101761777-101761799 GCCGCCGCCGCCGCCGCCCGGGG - Exonic
1122470800 14:101964702-101964724 GTCCTCGCCGCCGCCGCCCCCGG - Exonic
1122582116 14:102777541-102777563 GCGGCCGCCGCGGCTGCCGCCGG - Exonic
1122840825 14:104461792-104461814 GCTCCCGCCCCAGGCGCTGCGGG - Intergenic
1122975374 14:105168678-105168700 ACCGCCGCCGCCGTCGCCGCCGG - Exonic
1123716808 15:23039602-23039624 GCTCCTGCCGCAGTCGCCTCCGG + Exonic
1124109364 15:26772621-26772643 GCCCAGGCCGCCGCCGCCGTGGG + Intronic
1124427103 15:29571101-29571123 GCTCCCGCTCCCGCCCCAGCTGG - Intergenic
1124500728 15:30225039-30225061 CCCGCCGCCGCCGCCGCCGCAGG + Intergenic
1124584468 15:30991954-30991976 GCTGCCGCCGTGGCCCCCGCAGG - Intergenic
1124742841 15:32313628-32313650 CCCGCCGCCGCCGCCGCCGCAGG - Intergenic
1124922315 15:34038918-34038940 GCCGCCTCCGCCGCCGCCTCTGG + Exonic
1124929145 15:34101890-34101912 CCGGCCGCCACCGCCGCCGCTGG + Exonic
1125200738 15:37099013-37099035 GCCGCCGCCGGGGCCGCCGCTGG - Intronic
1125516460 15:40323833-40323855 GCCAGCGCCGCCGCCGCCGCCGG - Intergenic
1125717455 15:41827429-41827451 GGGCCCGCCCCCGCCGCCGCGGG - Exonic
1125916577 15:43493124-43493146 GCTGTCGCCACCGCCGCCACCGG + Exonic
1126150866 15:45522714-45522736 GCGCCCGCCGCGCCCGCTGCTGG + Exonic
1126436851 15:48645597-48645619 GCAGCCGCCGCCGCCTCCTCGGG - Exonic
1126626059 15:50686759-50686781 GCGCCCGCGCCCGCCTCCGCCGG + Exonic
1126626062 15:50686765-50686787 GCGCCCGCCTCCGCCGGCGACGG + Exonic
1126767006 15:52019444-52019466 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
1127515515 15:59689372-59689394 GCCCCCGCCGCCTCCACCGCCGG - Exonic
1127789916 15:62390559-62390581 GCTGCCGCCGCCGCTGGCTCCGG - Intronic
1127789918 15:62390565-62390587 TCAGCCGCTGCCGCCGCCGCTGG - Intronic
1128119233 15:65133548-65133570 GCCAGCGCCGCCTCCGCCGCGGG + Exonic
1128161018 15:65422905-65422927 GCTTCGGCCGCCGCCGCGGGGGG + Exonic
1128582753 15:68820492-68820514 GCTGCCGCCGCCGCTGCCCTTGG - Intronic
1129016720 15:72474866-72474888 GCCGCCGCCGCCGCCACCGCCGG - Exonic
1129260767 15:74365984-74366006 GGGGCCGCCGCCGCCTCCGCGGG + Intronic
1129387053 15:75202022-75202044 ACTCCCGCCGCCGCTACCCCAGG - Intronic
1129440630 15:75578774-75578796 CATCCCCCCGCCACCGCCGCCGG + Exonic
1129644692 15:77419720-77419742 GCTCCCGGGGCCGCCGCCGAGGG + Intronic
1129675977 15:77632639-77632661 GCCGCCGCCGCCTCTGCCGCTGG + Intronic
1130261135 15:82355266-82355288 GCAGCCGCTGCTGCCGCCGCCGG + Intergenic
1130280100 15:82513752-82513774 GCAGCCGCTGCTGCCGCCGCCGG - Intergenic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1130411699 15:83653723-83653745 GACGCCGCCACCGCCGCCGCCGG - Intergenic
1130471475 15:84229938-84229960 GCAGCCGCTGCTGCCGCCGCCGG - Intergenic
1130478969 15:84344509-84344531 GCAGCCGCTGCTGCCGCCGCCGG - Intergenic
1130492801 15:84443622-84443644 GCAGCCGCTGCTGCCGCCGCCGG + Intergenic
1130593769 15:85234565-85234587 GCAGCCGCTGCTGCCGCCGCCGG - Intergenic
1130908599 15:88256345-88256367 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1131431747 15:92393908-92393930 GCCGCTGCCGCTGCCGCCGCCGG + Exonic
1131635751 15:94231541-94231563 GCCCCCGCCCCCGCCGCGTCAGG + Intronic
1131825960 15:96322709-96322731 GCTCCTCCCGCCCTCGCCGCCGG + Intergenic
1131827148 15:96331074-96331096 GCTGCCGCTGCTGCCGCCGCCGG - Exonic
1131827172 15:96331169-96331191 GCCCGGGCCGCCGCTGCCGCCGG - Exonic
1132365127 15:101251566-101251588 GGCAGCGCCGCCGCCGCCGCGGG + Exonic
1132519823 16:381952-381974 GTCCCCGCCGCCGTCGCCCCGGG + Exonic
1132527720 16:425905-425927 GCGCCCGCCCGCGCCGCCGAGGG + Exonic
1132656569 16:1044047-1044069 GCCCCCGCCGCCGCCGGCCCAGG - Intergenic
1132662040 16:1065942-1065964 GGACCCGCCGCCGCGGCCGCAGG - Intergenic
1132683531 16:1153245-1153267 GCCGCCGCCGTCGCCTCCGCCGG + Exonic
1132713734 16:1280341-1280363 GCTCCCACAGCCGACGCCGAGGG + Intergenic
1132779297 16:1614165-1614187 GCTCCCTGCGCCGCCTCGGCCGG - Intronic
1132872666 16:2122706-2122728 TCTGCTGCCGCCGCAGCCGCTGG - Intronic
1132877960 16:2148665-2148687 GCCGCCGCCGCCGCCGCCAGGGG + Exonic
1133156453 16:3880137-3880159 CCGGCCGCCGCCGCCGCCGCCGG + Exonic
1133156581 16:3880501-3880523 GCTGCCGCCGCCGCCGCCGCCGG + Exonic
1133784411 16:8963567-8963589 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1134143603 16:11742754-11742776 TATACCGCCGCCGCCGCCTCGGG + Exonic
1134492129 16:14703260-14703282 GCACCTGCCTCCGCCGCCCCGGG - Intergenic
1134497510 16:14742382-14742404 GCACCTGCCTCCGCCGCCCCGGG - Intronic
1135296536 16:21283932-21283954 GCCGCCGCCTCCGCCGCTGCGGG - Intronic
1135712492 16:24729666-24729688 GCCGACACCGCCGCCGCCGCAGG - Intergenic
1135712551 16:24729911-24729933 GCCTCTGCTGCCGCCGCCGCGGG - Intronic
1135821972 16:25692705-25692727 GCCGCCCGCGCCGCCGCCGCTGG + Exonic
1135970338 16:27067472-27067494 GCTGCTGCCGCTGCCGCTGCCGG - Intergenic
1136003542 16:27313781-27313803 GCTGTCCCCGCCGCCGCCGCCGG - Intronic
1136110887 16:28063192-28063214 GCCGCCGCCGCCACCGCCTCGGG - Exonic
1136153092 16:28364960-28364982 GCACCTGCCGCGGCCGCCCCGGG + Intergenic
1136209991 16:28750313-28750335 GCACCTGCCGCGGCCGCCCCGGG - Intergenic
1136226502 16:28863897-28863919 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1136366143 16:29810094-29810116 GCTGCCGCTGCCGCCGCCATTGG - Exonic
1136414741 16:30096224-30096246 GCTGCTGCCGCCGCTGCGGCGGG + Intronic
1136540605 16:30925801-30925823 GAACCCGCTGCCGCCGCTGCCGG + Exonic
1136546530 16:30958014-30958036 GCCGCCGCCGCCACCGCTGCGGG + Intronic
1136625564 16:31459801-31459823 GCTCCCGACGCGGCCGACGAGGG - Exonic
1136641523 16:31569340-31569362 GCGCCCGCCGCCCTCGTCGCAGG - Intergenic
1136683656 16:31981959-31981981 GCCCCCGCCGCCGCCAGCCCGGG - Intergenic
1136784283 16:32925519-32925541 GCCCCCGCCGCCGCCGGCCCGGG - Intergenic
1136885501 16:33928287-33928309 GCCCCCGCCGCCGCCGGCCCGGG + Intergenic
1136927501 16:34388559-34388581 GCCCCCGCCACCTCCGCCGGTGG - Intergenic
1136977073 16:35023247-35023269 GCCCCCGCCACCTCCGCCGGTGG + Exonic
1137412932 16:48244637-48244659 GCGCCGCCCGCCGCCGCCGCGGG - Intronic
1137454783 16:48609984-48610006 GCCCCCGGCGCCGCCGCGGGAGG - Exonic
1137605785 16:49786134-49786156 GCTCCCCACGCCCCCGCCTCCGG + Intronic
1137614561 16:49838910-49838932 GGTCCCGGGGCCGCCCCCGCGGG + Intronic
1137655258 16:50153553-50153575 GCCGCCGCCGCCGCCGCCTCAGG - Intronic
1138105595 16:54285836-54285858 GCTGCGGCCGCCGCCGCCCAAGG - Exonic
1138105630 16:54285964-54285986 GCTGCCGCCGCTGCCGCCAGCGG + Exonic
1138185838 16:54976996-54977018 GCCGCCGCCGCCGCCGCCACTGG + Intergenic
1138247622 16:55479275-55479297 GCCGCCGCCGCCGCCGCCGCAGG - Exonic
1138360747 16:56425437-56425459 GCCGCCGCCGCCGCCGCGCCGGG + Exonic
1138360769 16:56425506-56425528 GCTCCCGCTGCTGCCCCTGCCGG + Exonic
1138471961 16:57245143-57245165 GCGCGCGCCGCCGACGCCGCAGG - Exonic
1138619015 16:58197523-58197545 TCTCCCGCCGACCCCTCCGCGGG - Intronic
1139361514 16:66402671-66402693 GCTTCCGGAGCCGCCGCCGCAGG - Exonic
1139528108 16:67528815-67528837 GCTGTCGCCGCCGCAGGCGCCGG - Intronic
1139528110 16:67528821-67528843 GCTGCCGCTGTCGCCGCCGCAGG - Intronic
1139615364 16:68085386-68085408 GTCGCCGCCACCGCCGCCGCGGG - Intronic
1139615419 16:68085631-68085653 GCTGCCGCCGCCGCCGCCTGAGG + Intronic
1139761455 16:69187448-69187470 GAGCCCGCCGGCGCCGCCTCGGG + Exonic
1140187424 16:72787737-72787759 ACTGCCACCGCCGCCGCCGCCGG + Exonic
1140187425 16:72787740-72787762 GCCACCGCCGCCGCCGCCGGTGG + Exonic
1140222987 16:73057859-73057881 GCTGCCGCGGCCGCCACCGCTGG - Intronic
1140223033 16:73057986-73058008 GCCCCCGCCCCCGCCGCTCCCGG - Intronic
1140223212 16:73058542-73058564 GCCGCTGCAGCCGCCGCCGCCGG - Intronic
1140442574 16:74999096-74999118 GCTCTCGCTTCAGCCGCCGCCGG - Exonic
1141054613 16:80804012-80804034 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1141054706 16:80804385-80804407 GCCGCCGCCGCCGCTGCTGCCGG - Intergenic
1141079202 16:81035952-81035974 GGAGCCGCCGCCGCCGCCTCGGG + Exonic
1141430587 16:83968696-83968718 GCTCCGGGAGCCGCCGCAGCAGG + Exonic
1141582727 16:85011329-85011351 GTCGCCGCCGCCGCCGCCGCAGG - Exonic
1141682597 16:85553294-85553316 GCCGCCGCCGCCGCCGCTGCCGG + Intergenic
1141682599 16:85553297-85553319 GCCGCCGCCGCCGCTGCCGGCGG + Intergenic
1141830749 16:86508896-86508918 GCTCGGCCTGCCGCCGCCGCGGG - Intergenic
1141840107 16:86568526-86568548 GCAGGCGCCGCCGCCCCCGCCGG + Exonic
1142130787 16:88430656-88430678 CCGCCCGCCGCCCCAGCCGCCGG - Intronic
1142336163 16:89490573-89490595 GCTCCCGCCGCAGCCGCCGCTGG - Intergenic
1142413136 16:89926190-89926212 GCTCCCCCCTCCGCCGCTGCAGG - Intronic
1203086940 16_KI270728v1_random:1189525-1189547 GCCCCCGCCGCCGCCGGCCCGGG - Intergenic
1142586579 17:978630-978652 GCCCCCGCCTCCCCCGCCCCAGG - Intronic
1143390504 17:6556657-6556679 GCGCCCAACGCCGCCCCCGCGGG + Intergenic
1143548499 17:7614555-7614577 GCTGCTGCAGCCGCCGCCGGGGG - Exonic
1143625984 17:8110360-8110382 GAGCCCGGCGCCGCCGCCCCGGG - Intronic
1143885819 17:10064107-10064129 GCTGCAGCAGCCGCCGCTGCTGG - Intronic
1144021349 17:11241651-11241673 GCCGCCGCCACAGCCGCCGCGGG - Exonic
1144107285 17:11997436-11997458 GCGCCCGGAGCCGGCGCCGCGGG - Intronic
1144339725 17:14301581-14301603 GCCGCCGCCGCCCCCGCCGCCGG + Exonic
1144547943 17:16215274-16215296 GCTCCCGGGGCAGCAGCCGCTGG - Intronic
1144724541 17:17495260-17495282 GCCGCCGCCGCCGCCGCTGCCGG + Exonic
1144756184 17:17681838-17681860 CCTCGCGCCGCCCCCGCCCCGGG - Intronic
1144909910 17:18672509-18672531 GCTGCCACCGCCGCAGCCGGGGG - Intronic
1144910059 17:18673039-18673061 GCCGCCGCCGCCGCCGCCTGGGG + Exonic
1145058691 17:19718997-19719019 GCTCCCCCCGCCCCAGCCACAGG - Intergenic
1145306600 17:21678945-21678967 GCTCCTGCTGCAGCCGCGGCGGG + Intergenic
1145306603 17:21678948-21678970 GCCCCCGCCGCGGCTGCAGCAGG - Intergenic
1145307522 17:21683604-21683626 GCCGCCGCCGCCGCTGCAGCAGG - Intergenic
1145307753 17:21684769-21684791 GCCGCCGCCGCCGCTGCAGCAGG - Intergenic
1145380444 17:22383969-22383991 GCTGCAGCCGCGGCTGCCGCTGG - Intergenic
1145912879 17:28552586-28552608 GCTGCCGCCGCTGCCTGCGCCGG + Exonic
1145925652 17:28644947-28644969 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1145925657 17:28644956-28644978 GCCGCCGCCGCCGGCGCGGCCGG + Intronic
1146167434 17:30600838-30600860 GCCCCCGCCAACCCCGCCGCCGG + Intergenic
1146219837 17:31008725-31008747 CTGCCCGCCGCCTCCGCCGCTGG + Intergenic
1146438972 17:32877095-32877117 GCTCCTCCCGCCGCGGCTGCCGG + Exonic
1146492388 17:33292282-33292304 GCCGCCGCTGCCGCCTCCGCGGG + Exonic
1146794285 17:35770224-35770246 GGTCCCTGAGCCGCCGCCGCGGG - Exonic
1147144574 17:38477666-38477688 GCCCCCGCCGCCGCCGGCCCGGG - Exonic
1147144577 17:38477672-38477694 GCCGCAGCCCCCGCCGCCGCCGG - Exonic
1147161773 17:38572780-38572802 GCAGCCGCGGCCGCCGCCGCCGG + Intronic
1147168700 17:38606044-38606066 TCCCCCGCCCCCGCCGCCCCGGG - Intergenic
1147183653 17:38702367-38702389 GGGGCCGCCGCGGCCGCCGCCGG - Intergenic
1147200646 17:38799426-38799448 GCCGCCGCCGCCGCCGCCCCGGG - Exonic
1147285739 17:39401575-39401597 GTTGCGGCCGCCGGCGCCGCGGG - Exonic
1147307401 17:39573630-39573652 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1147486367 17:40818909-40818931 GTAGCCGCCGCCGCCGCCGCCGG + Exonic
1147486381 17:40818960-40818982 ACTGCCGCCGTGGCCGCCGCTGG + Exonic
1147486410 17:40819065-40819087 GCCGCCGCCGTGGCCGCCGCCGG + Exonic
1147943504 17:44066607-44066629 GCTGCTGCCGCCGCCGCCGCCGG - Exonic
1147967141 17:44199544-44199566 GCCGCCGTCGCCGCCGCCGGAGG - Intronic
1147967143 17:44199547-44199569 GCCGCCGCCGTCGCCGCCGCCGG - Intronic
1147971289 17:44220059-44220081 GCTGCTGCTGCTGCCGCCGCCGG + Intronic
1147994554 17:44353762-44353784 GCTCCTCCCGCCGCTGCCACGGG + Exonic
1147994790 17:44354674-44354696 GCTGGCGCGGCCGCCGTCGCTGG - Exonic
1148048645 17:44758885-44758907 GCCCGGGCCGCCGCCGCGGCAGG - Intergenic
1148060106 17:44830259-44830281 GCTCCCGCCGCCGCGACCCGCGG + Intronic
1148440411 17:47709014-47709036 GCCACCGCCGCCGCCCCCGCCGG + Exonic
1148495012 17:48048386-48048408 GGCCTCGCCGCCGCCACCGCCGG - Exonic
1148698624 17:49575651-49575673 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1148698626 17:49575654-49575676 GCCGCCGCCGCCGCCGCCGGTGG + Intergenic
1148714722 17:49707878-49707900 GCCTCCGCCGCCGCTGCTGCCGG - Exonic
1148733379 17:49851244-49851266 CCACCCGCCGCCGGGGCCGCGGG - Intergenic
1149430614 17:56593723-56593745 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
1149461541 17:56833696-56833718 GATGCCGGCGCCGCCGCCGCCGG - Exonic
1149626524 17:58083949-58083971 GCTGCCGCTGCCCCCGCCCCCGG + Intronic
1149658414 17:58322373-58322395 CCTCCAGCTGCTGCCGCCGCTGG + Exonic
1149685456 17:58532094-58532116 ACTCGCTCCGCCCCCGCCGCCGG - Intronic
1149996376 17:61408156-61408178 GCTGCCGCCGCCGCAGCCGCCGG + Exonic
1150150927 17:62808288-62808310 GCCCCCACCGCCTCCGCCCCAGG - Exonic
1150239980 17:63623019-63623041 GGTCCCGCCGCCGCTTCCCCGGG - Intronic
1150373509 17:64661885-64661907 GCCCCCGCCGCCCCCGCCGCCGG - Exonic
1150423170 17:65056600-65056622 GCCGCCGCCGCCGCCTCGGCGGG + Exonic
1150747296 17:67825949-67825971 GAAGCCGCCGCCGCCGCCGCCGG + Exonic
1150768283 17:68020077-68020099 GCGCGCGCCGCCGCCGCTGGGGG - Intergenic
1151570502 17:74923267-74923289 GCCCCCTCCGCCCCCGCCCCCGG - Intergenic
1151673884 17:75588362-75588384 GCGCCCCCCGCGGCCGCCCCTGG - Intergenic
1151746624 17:76015094-76015116 GCTCCCTCCGCTGGCGCTGCAGG + Exonic
1151854338 17:76710633-76710655 GCCTCCGCTGGCGCCGCCGCGGG + Exonic
1152049127 17:77958891-77958913 GCTCCCTCCGCCTCCGGCTCGGG - Intergenic
1152049187 17:77959097-77959119 GCCGCCGCCGCCGCCCGCGCCGG + Intergenic
1152319591 17:79601040-79601062 GCTCCCGCTGCTCCCGCCCCGGG + Intergenic
1152433107 17:80260514-80260536 GCCCTGCCCGCCGCCGCCGCCGG - Intergenic
1152433118 17:80260541-80260563 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433131 17:80260571-80260593 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433144 17:80260601-80260623 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433157 17:80260631-80260653 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433170 17:80260661-80260683 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433183 17:80260691-80260713 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433196 17:80260721-80260743 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433209 17:80260751-80260773 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433222 17:80260781-80260803 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433235 17:80260811-80260833 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152546784 17:81004212-81004234 GCTTCCCGCGCCGCCGCCCCGGG - Intronic
1152597635 17:81245750-81245772 GGTCCCGCCGTCGCCTCCGGAGG + Exonic
1152660532 17:81539967-81539989 GCTCGCGCCGCTCCCGCTGCAGG - Exonic
1152687838 17:81703431-81703453 GCTCTAGCCGCCTCGGCCGCCGG - Exonic
1152695217 17:81740846-81740868 GCTCCCCCCGCCAGCGCGGCGGG - Intergenic
1152824847 17:82458438-82458460 TTGGCCGCCGCCGCCGCCGCAGG + Intronic
1152834408 17:82519947-82519969 GCCCCCGGCCCCGCCGCCCCCGG - Exonic
1153238760 18:3012841-3012863 GCCCCTACCGCCGCCGCCGCAGG - Intronic
1153794399 18:8609486-8609508 GCCGCTGCCGCCGCCGCCGCCGG - Exonic
1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG + Intergenic
1154241453 18:12657550-12657572 GCGCCCGCGGCCGACGACGCGGG - Exonic
1154303995 18:13217796-13217818 GCTCCGCGCGCCGCCGCGGCCGG + Intronic
1155007506 18:21741524-21741546 GCCGCCGCCGCTGCCGCCGGGGG - Exonic
1155007510 18:21741527-21741549 GCCGCCGCCGCCGCTGCCGCCGG - Exonic
1155053824 18:22169043-22169065 TCCCGCGCCGCCGCCGCGGCGGG - Intergenic
1155152850 18:23136055-23136077 CCTCGCGCCGCAGGCGCCGCCGG - Exonic
1155199345 18:23503583-23503605 GCCCCCGGGGCCCCCGCCGCGGG + Exonic
1155654334 18:28177050-28177072 GCCGCCGCCGCCGCCTCCTCCGG - Exonic
1156036155 18:32770288-32770310 GCAGCAGCAGCCGCCGCCGCAGG - Exonic
1156099623 18:33578356-33578378 GCTGCCGCCGCCCCCGCCCCCGG + Intergenic
1156213838 18:34976942-34976964 GCCGCCGCCGCCGCCGCTCCGGG - Intronic
1156944715 18:42814820-42814842 TCTCCCGCCGCCACCTCCACTGG + Intronic
1157662750 18:49460267-49460289 GGTCCCTTCGCCGCCGCCCCGGG + Intronic
1157849133 18:51030705-51030727 GCCGCCGCCGCCGCCGTCGTCGG - Intronic
1158435991 18:57435823-57435845 GCCCCCGCCACTGCCGCCGCCGG - Exonic
1158570929 18:58596482-58596504 GCTGCTGCAGCAGCCGCCGCAGG + Intronic
1158954142 18:62523556-62523578 GCCGCCGCCGCCGCCGCCCGCGG + Exonic
1158954159 18:62523598-62523620 GCCGCCGCCGCCGCCGCCCCGGG + Exonic
1158976505 18:62715753-62715775 GCTGCCGCAGCGGCGGCCGCCGG - Exonic
1159040288 18:63318419-63318441 GCTGCCCCCGGCGCCGCCGCGGG - Exonic
1160164129 18:76495356-76495378 GCTCGCGCCGGGGCCCCCGCGGG - Intergenic
1160242394 18:77132899-77132921 GCGGCCGCCGGCGCCGCCCCGGG + Intronic
1160453343 18:78979745-78979767 GCCCCCCCCGCCGCCGCCGCCGG - Intergenic
1160454788 18:78992799-78992821 GCCCCTGCCGCCGCCATCGCGGG + Exonic
1160577248 18:79863687-79863709 GGTCCCGCCGCCGCCGCCCGGGG - Exonic
1160680345 19:409226-409248 GCCCGCGCCCCCGCCCCCGCGGG + Intergenic
1160719131 19:589895-589917 GGAGCCGCCGCCGCCGCCGCCGG - Exonic
1160725378 19:615949-615971 GCCGCCGCCGCCGCCGCCGCAGG + Exonic
1160765671 19:806455-806477 GCAGCTGCCGCCGCCGCCGAGGG - Exonic
1160767026 19:813247-813269 GCGCGCGGGGCCGCCGCCGCTGG - Exonic
1160790457 19:920579-920601 GCCGCCCCCGCCGCCCCCGCCGG + Exonic
1160873105 19:1285890-1285912 GCCGCCGCCGCCGCACCCGCCGG - Intergenic
1160894289 19:1395487-1395509 AGCGCCGCCGCCGCCGCCGCCGG + Exonic
1160919472 19:1513071-1513093 CCTCCCACCGCGGCCTCCGCAGG + Exonic
1160923891 19:1533827-1533849 CCTCCCGCAGCCGCCGCCGCAGG - Intronic
1160930594 19:1568014-1568036 GCCCCCGCCCCCGCCGCCGTCGG + Exonic
1161022140 19:2015537-2015559 GCCGCCGCCGCCGCCGCCCCTGG - Exonic
1161069655 19:2253722-2253744 GCAGCCGCCGCCGCCGCCCCCGG - Exonic
1161101507 19:2424171-2424193 GTTCCCGGCGCCGCAGCCACAGG - Exonic
1161124205 19:2546787-2546809 GCCCCCGCCGACCCCACCGCCGG - Intronic
1161162912 19:2770566-2770588 GCCGCCCCCGCCCCCGCCGCTGG + Intronic
1161241156 19:3224699-3224721 CCGCCCGCCGCCGCCGCCGCCGG + Exonic
1161265116 19:3360215-3360237 GAGCGCGCCGCGGCCGCCGCCGG + Intronic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1161379884 19:3959313-3959335 GCTCCTGCCGTAGCCTCCGCAGG + Exonic
1161400703 19:4065458-4065480 GCCACCGCCGCCGCCGGGGCCGG - Intronic
1161400708 19:4065464-4065486 GCCGCCGCCACCGCCGCCGCCGG - Intronic
1161412418 19:4123890-4123912 GCTAGAGGCGCCGCCGCCGCCGG - Exonic
1161454132 19:4361788-4361810 GCTCCCGCCCCCAGCGCCCCTGG - Exonic
1161628761 19:5340878-5340900 AGCGCCGCCGCCGCCGCCGCCGG + Intergenic
1161703244 19:5805936-5805958 CTGCTCGCCGCCGCCGCCGCCGG + Intergenic
1161752901 19:6110426-6110448 GCAGCCGCTGCCGCCGCCGCGGG - Exonic
1161911554 19:7198189-7198211 GCTGCGGCCGCCGCAACCGCCGG - Intronic
1162007200 19:7788405-7788427 GCTCCCGCCGCACACGCCCCGGG - Intergenic
1162021158 19:7869234-7869256 GCCCCCGCCGCTGCCGCCCGCGG + Exonic
1162030917 19:7916921-7916943 GCCGCCGCCGCCGCCATCGCGGG + Exonic
1162033205 19:7926051-7926073 CGGGCCGCCGCCGCCGCCGCCGG - Exonic
1162128243 19:8510877-8510899 GCCCCCGCGGCCCCCGCGGCCGG - Exonic
1162311989 19:9913403-9913425 GCTGCCGCCGCCGCAGCCCCCGG - Intronic
1162440088 19:10687382-10687404 GCCCCCGCCGCCACCGCCACTGG - Exonic
1162535827 19:11262449-11262471 CGTCCCGCCGCCGCCGCCCCGGG + Exonic
1162731422 19:12721217-12721239 GGCCCCGCCGCCGCCGCCTGTGG - Intronic
1162795989 19:13088030-13088052 GCTACCGCCGCCGCCTCCAGTGG + Intronic
1163121941 19:15223540-15223562 TCTTCCGCCTCCGCGGCCGCCGG - Intergenic
1163154473 19:15432491-15432513 GCCACCGCCACCGCCGCCGCGGG - Intronic
1163158123 19:15449867-15449889 GCTACCGCCGCTGCCGCTCCCGG + Exonic
1163158906 19:15453334-15453356 GCACCGGCCGGGGCCGCCGCAGG + Exonic
1163262174 19:16197977-16197999 GCTGCCGCCGCCACCGCCCTCGG + Exonic
1163451414 19:17379465-17379487 GCAGCCGCCGACGACGCCGCTGG - Intergenic
1163478300 19:17539722-17539744 GCGCCCGCTGCCGCAGCAGCTGG - Exonic
1163551170 19:17967152-17967174 GCGCCTGCCGCCGCCGCCCCCGG + Intronic
1163551175 19:17967167-17967189 GCCCCCGGCCCCGCCGCCCCCGG + Intronic
1163583709 19:18153201-18153223 GCCACCGTCGCCGCAGCCGCGGG - Exonic
1163586950 19:18169342-18169364 GCTCCCGCCGCCGCAGCCTCCGG - Exonic
1163606949 19:18280913-18280935 GCTTCGGGCGCGGCCGCCGCCGG + Exonic
1163606978 19:18280982-18281004 GCCGCCGCCGCCGCCGCCGGGGG - Exonic
1163606982 19:18280985-18281007 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1163743880 19:19033458-19033480 GCCACCCCCGCCGCCGCCTCAGG + Intronic
1163807251 19:19406449-19406471 GCCGCCGCCGCCGCCGCCGCGGG - Intronic
1163851112 19:19664044-19664066 GCTCCCGACCCCGCCTCCGCAGG - Intergenic
1164594850 19:29526118-29526140 GCTCCCGCAGCCGCCCCCGCCGG - Intergenic
1164834534 19:31349244-31349266 GCCGCCGCCGCCGCCGCTGCCGG + Exonic
1164990079 19:32676578-32676600 GCACGCGCCGCGGCGGCCGCTGG + Exonic
1165080113 19:33302103-33302125 GCCGCCGCCGCCGCCGCCCGTGG + Exonic
1165129170 19:33621693-33621715 GCTCCCACCCCCGCGGCCGCCGG + Intergenic
1165243054 19:34482261-34482283 GCCGCCACCGCCGCCGCCGTCGG - Exonic
1165351691 19:35279273-35279295 GCAGCCGCCGCCGCCCACGCCGG + Exonic
1165424949 19:35740428-35740450 GGTCACGGCTCCGCCGCCGCAGG + Exonic
1165429943 19:35766862-35766884 GCTTCCGCCGCTGCCGCCACTGG - Exonic
1165476351 19:36032912-36032934 GGTCCCTCCTCCCCCGCCGCCGG - Intronic
1165493945 19:36141118-36141140 GCCGCCGCCGCCGCCGCCCCCGG - Exonic
1165541807 19:36498099-36498121 CCTCCCGCTGCTGGCGCCGCTGG - Intergenic
1165772090 19:38385881-38385903 GCTCCAGCCAACGCCGCTGCCGG - Exonic
1165928697 19:39342687-39342709 CCGCCCGCCGCCGCCGCCCGCGG - Intronic
1165961613 19:39539775-39539797 TCCCTGGCCGCCGCCGCCGCCGG + Exonic
1165961640 19:39539850-39539872 GCTCCCCTGGCTGCCGCCGCCGG + Exonic
1166055423 19:40285285-40285307 GCCGCCGCCGCTGCCGCTGCCGG - Exonic
1166078103 19:40425624-40425646 GCCCCCGCCGCCGCCGCTTCGGG - Intronic
1166329278 19:42069355-42069377 GCCCCCTCCCCCGCCGCCGGTGG + Intronic
1166358576 19:42242238-42242260 GCCTCCTCCGCCGCTGCCGCCGG + Exonic
1166358625 19:42242370-42242392 GCCTCCTCCGCCTCCGCCGCCGG + Exonic
1166361250 19:42253866-42253888 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1166361254 19:42253869-42253891 GCCGCCGCCGCCGCCGCCGGGGG + Intronic
1166873796 19:45885492-45885514 GCCCCAGCTGCCGCCCCCGCAGG - Exonic
1166883070 19:45940590-45940612 GCGTCGGCCGCCGCCGCCTCCGG - Exonic
1166902663 19:46077670-46077692 GCTCCCGCAGGCGCTCCCGCGGG - Intergenic
1166975122 19:46601370-46601392 GCTGCAGCTGCTGCCGCCGCCGG + Exonic
1167019097 19:46861100-46861122 GCCGCCGCCTCAGCCGCCGCTGG + Intergenic
1167268957 19:48497682-48497704 GCTTCCGGGGCCGCCGCCGGGGG + Exonic
1167311262 19:48739195-48739217 GCTCTCGCCGGGGCCACCGCCGG + Exonic
1167613316 19:50517658-50517680 GCCCCCGCAGCCCCCGCCGCTGG + Exonic
1167798115 19:51724024-51724046 GCTCCCGCCCCCGCCTGCGCTGG - Intergenic
1168064058 19:53909425-53909447 CCGGCCGCCGCCGCCGCCACCGG - Exonic
1168072830 19:53962313-53962335 GCCCGCGCCGCCTCCGCCCCAGG - Intergenic
1168076325 19:53982545-53982567 GGCGCCGCCGCCGCCGCCGCCGG - Exonic
1168076348 19:53982599-53982621 GCCGCCTCCGCCGCCGCCCCCGG - Exonic
1168095833 19:54114501-54114523 GCTGGCGCCGCCGCCGACCCCGG + Exonic
1168146011 19:54420519-54420541 GCTCCCGCCCCCTCCACTGCGGG + Intronic
1168247005 19:55117491-55117513 GCAGCCGCCGCCGCCGCCCCCGG + Exonic
1168293005 19:55366123-55366145 GGACCCGCCGGCGCCCCCGCTGG - Exonic
1168305537 19:55433276-55433298 GCCCCCGCCCCCGCCGGCGTCGG + Exonic
1168692714 19:58386546-58386568 GCTCCCGCCGCCGCAACCCCGGG + Intronic
1168721770 19:58558394-58558416 GCCGCCGCTGCCGCCGCCGCGGG + Exonic
925013427 2:503468-503490 GCTGGCGCCGCCTCCCCCGCTGG - Intergenic
925610424 2:5696924-5696946 GGTCGCGCCCGCGCCGCCGCCGG - Exonic
926131011 2:10303104-10303126 GGGCCCGCTGCAGCCGCCGCCGG + Intronic
926217103 2:10912359-10912381 GCCGCCGCCGCCGCTGCCGCTGG - Exonic
926305411 2:11634363-11634385 GCTGCCGCCGCCTCTGCCCCAGG - Intronic
926914264 2:17878257-17878279 GCCCCAGCCGCCGGGGCCGCGGG + Intronic
927606593 2:24491584-24491606 TCACCTGCCGCCGCCGCCTCTGG - Intergenic
928511766 2:32010084-32010106 TCCCCGCCCGCCGCCGCCGCGGG + Intronic
928518268 2:32063919-32063941 GCCCCCGCCCCTCCCGCCGCCGG + Exonic
928606357 2:32947621-32947643 ACCGCCGCCGCCGCCGCCGCCGG + Exonic
928983218 2:37156918-37156940 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
929188786 2:39120983-39121005 GCCGCCGCCACCGCCGCCGCCGG + Exonic
929701946 2:44169472-44169494 TCCCCGGCCGCCGCCTCCGCTGG + Intronic
930358223 2:50346884-50346906 GCCGCCGCCGCCGCCGCCCCCGG + Intronic
930762377 2:55050324-55050346 GCAGCTGCTGCCGCCGCCGCCGG + Exonic
930847764 2:55923796-55923818 CCTGCCGCCGCGGCCGCTGCCGG - Exonic
931253507 2:60552418-60552440 GCCGCCGCCGCCGCCGCCGAAGG - Intronic
931254109 2:60555284-60555306 GCAGCCGCCGCCGCCGCCGCCGG + Intergenic
931517830 2:63059937-63059959 GTTCCCGCCGCCGCTGCCCAGGG - Intergenic
931671739 2:64653941-64653963 GCTCCGGGCCCCGGCGCCGCAGG + Intronic
931694232 2:64859896-64859918 CCTCTCGGCGCCGCCCCCGCTGG - Intergenic
932567356 2:72918150-72918172 GCGCCCGCGGCGGCCGCGGCAGG - Exonic
932607674 2:73175833-73175855 GCGCCCGCCCCCGCCGCCGCGGG - Intergenic
932621865 2:73269443-73269465 GCCGCCGCCGCCGCTGCCTCGGG - Exonic
932624154 2:73284542-73284564 GGTCCCGGCGCAGCCGCTGCTGG - Intergenic
932699848 2:73985057-73985079 GCCGCCGCCGCCGCCGCCTGGGG - Intergenic
932700018 2:73985511-73985533 GCGCCCGCCGCGCCCGCCGCCGG - Intergenic
932773194 2:74513207-74513229 CCACCCGCCACCGCCACCGCAGG + Intergenic
932773959 2:74516060-74516082 GCTGCGGCCGCCGCTGCCCCCGG + Exonic
933666861 2:84971284-84971306 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
933902903 2:86861991-86862013 ACTCCCGCCGCCACCGCGCCCGG - Intergenic
934079113 2:88452453-88452475 GCCGCCACCGCCGCCGCCCCGGG - Exonic
934257790 2:91442619-91442641 CTTCCTGCCCCCGCCGCCGCGGG + Intergenic
934736234 2:96691262-96691284 ACTCGTGCCGCCGCCGGCGCTGG + Intergenic
934966854 2:98731106-98731128 GCCGCTGCCGCCGCCGCTGCGGG + Intronic
935196642 2:100820238-100820260 GCCGCCGCCGCCGCGGCTGCGGG - Exonic
935301614 2:101697926-101697948 GAGCCCGCCGCCGCCGCCCGCGG + Intronic
935592438 2:104855285-104855307 GCCGCCGCCGCCGCGGCCCCCGG - Intergenic
935592639 2:104855924-104855946 GCCGCCGCCGCCACCGCCGCAGG + Exonic
935592736 2:104856229-104856251 CGCGCCGCCGCCGCCGCCGCCGG - Exonic
935634881 2:105242593-105242615 GCTGCCGCTGCAGGCGCCGCAGG - Exonic
935692616 2:105744882-105744904 GCCGCCGCCGCCGCTGCCGCGGG + Exonic
936122699 2:109760437-109760459 GCCGCCGCCGCCGCCGCCCCCGG - Intergenic
936221994 2:110611036-110611058 GCCGCCGCCGCCACCGCCCCCGG + Intergenic
936278668 2:111120582-111120604 GCGCACGCCGCGGCCGCCGCCGG + Intronic
936279152 2:111122661-111122683 GCTGCCCCGGCCGCAGCCGCCGG - Intronic
937044990 2:118846554-118846576 GCCGCCGCCGCCGCCGCAGCCGG + Exonic
937221478 2:120345222-120345244 GACCTCGCCGCCGCCGCGGCAGG + Intergenic
938058337 2:128233396-128233418 GGTCGCGCGGCCGTCGCCGCCGG - Intergenic
938273022 2:129992528-129992550 GCTGCCGCCGCCGCCGGCGCTGG - Intergenic
938443202 2:131353578-131353600 GCTGCCGCCGCCGCCGGCGCTGG + Intronic
938727295 2:134120151-134120173 GCTCCCGCGGCGGCGGCCCCGGG + Intronic
938727296 2:134120154-134120176 GCGCCCGGGGCCGCCGCCGCGGG - Intronic
938875918 2:135531490-135531512 GCTCCAGCGGCAGCCGCGGCTGG - Intronic
939432658 2:142130785-142130807 CCTGCCGCCGCCGCCGCCGCCGG - Exonic
939629750 2:144517130-144517152 CCTCCCTCCGCGGCCGGCGCCGG - Intronic
939900614 2:147845242-147845264 GCAGCGGCCGCCGCGGCCGCAGG - Intronic
941029314 2:160493444-160493466 GCCGCCGCTGCCGCCGCCGCCGG - Exonic
941104846 2:161341013-161341035 GCCTCCGCTGGCGCCGCCGCGGG + Intronic
941119112 2:161507856-161507878 CCCGCCGCCGCCGCCGCCGCGGG + Intronic
941951382 2:171160459-171160481 GTTGCCGCCGCTGCCGTCGCAGG - Exonic
941951523 2:171160961-171160983 GCCGCCGCCGCCGCCGCTACCGG - Intronic
942241114 2:173964681-173964703 GCCGCCGCCGCCGCCGCCGGGGG - Intronic
942241118 2:173964684-173964706 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
942454781 2:176130242-176130264 GCTCTCGCCGCCGGGACCGCCGG - Exonic
943060532 2:183038106-183038128 GCTGGTGCCGCCGCCGCCGCCGG + Exonic
943571507 2:189580772-189580794 GCCGCCGCCGCCGCCGCCGTGGG + Exonic
943645905 2:190408109-190408131 GCATCCGCCGCCGCCGCAGGAGG + Intergenic
944273087 2:197804958-197804980 GCCGCCGCCACTGCCGCCGCTGG + Exonic
944412443 2:199457722-199457744 GCCGCCGCCGCCGCCGCCTCCGG - Exonic
944412848 2:199459316-199459338 ACTCCCGCGGCCGCGGCCGCCGG + Intronic
944743729 2:202635607-202635629 GCCGCCGCCGCCGCCGCTGCTGG + Exonic
944831218 2:203535341-203535363 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
945225826 2:207530329-207530351 GCTGCCGCCCCGGCCGCCGCTGG - Intronic
945241581 2:207681533-207681555 CCTCCCTGCGCCGCCGCCTCCGG - Intergenic
945988345 2:216372168-216372190 GCACCCGCCGCTGCCCCCACTGG + Intergenic
946248567 2:218400232-218400254 GGAGCCGCCGCCGCCGCCCCGGG + Intronic
946404410 2:219484755-219484777 GCTCTCTCCGTCCCCGCCGCGGG - Exonic
946412627 2:219522728-219522750 GCCCCCTCCCCGGCCGCCGCGGG + Intronic
946431021 2:219627527-219627549 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
947418482 2:229921706-229921728 GGCCCCGCCGCCGCCGGCGCCGG + Intronic
947418486 2:229921710-229921732 GCTCCCGGCGCCGGCGGCGGCGG - Intronic
947860529 2:233354563-233354585 GCCTCCGCCGCCGCCGCCCGAGG + Exonic
948470188 2:238172562-238172584 TCTCCAGCAGCCGCCGCCTCTGG - Intronic
948801583 2:240435737-240435759 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
948884018 2:240874123-240874145 GCTCCCGCCCCTCCCGCCTCGGG - Intronic
948953991 2:241272897-241272919 GCGCCCGCCCGCCCCGCCGCTGG + Intronic
1168795832 20:609765-609787 GTCCCCGCCGCCGCCGACGGCGG - Exonic
1169065564 20:2692799-2692821 GCCGCCGCCGCCGCCGCTCCCGG - Intergenic
1169093165 20:2873619-2873641 GAGGCCGCCGCCGCCGCCGCGGG + Intronic
1169164123 20:3407693-3407715 GCCCCCGCCCCCGCCCCCGCCGG - Intergenic
1169214728 20:3786511-3786533 GGCGCCGCCGCCGCCGCCCCGGG + Exonic
1169278485 20:4248868-4248890 GCCCCCGCCGCCGCCCGCGCTGG + Exonic
1169557620 20:6767689-6767711 GCCGCCGCCGTCGCCGCCGCCGG + Exonic
1170756916 20:19212877-19212899 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1170756918 20:19212880-19212902 GCCGCCGCCGCCGCCGCCGGAGG + Exonic
1170889971 20:20368423-20368445 GCTGCCGCCGCCGCCGCCCGCGG + Exonic
1171847140 20:30284071-30284093 GCTGCCGCCGCGGCGGCGGCTGG - Intergenic
1172015530 20:31870543-31870565 GCTGCCACCGCCGCCGCCGCAGG + Exonic
1172037310 20:32019123-32019145 GCTGCCGCCGCCGCCTCCCCCGG - Exonic
1172083174 20:32358520-32358542 GCAGCCGCCGCTGCCGCCGTGGG + Exonic
1172143965 20:32743453-32743475 GCTGCCGCTGCCACCGCTGCCGG + Exonic
1172284601 20:33731993-33732015 GCCGCCGCCGTCGCCGCCACAGG - Exonic
1172331164 20:34077058-34077080 ACCACCACCGCCGCCGCCGCCGG - Exonic
1172367909 20:34363724-34363746 GCCCGCGCCGGCCCCGCCGCCGG - Intronic
1172474491 20:35226777-35226799 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1172587265 20:36093469-36093491 GGTCCAGGCGCCGCCGCCGCTGG + Intronic
1172640192 20:36436113-36436135 GCTCCACTCGCCGCCGCCGCCGG - Exonic
1172654365 20:36527998-36528020 CCACCCAGCGCCGCCGCCGCTGG + Exonic
1173243434 20:41317604-41317626 GCCGCCGCCGCCGCCTCTGCGGG - Intronic
1173736161 20:45363171-45363193 GCTCCTGCCGCCGTGGTCGCTGG + Exonic
1173790119 20:45823037-45823059 GCACTCGCAGCCGCCGCCTCGGG + Intergenic
1173822698 20:46029409-46029431 GCCCCCTCCCCCGCCGCCCCCGG - Intronic
1173855996 20:46251195-46251217 GCCGCCGCCGCCGACGCTGCTGG - Exonic
1173982934 20:47238976-47238998 GCCCCGGCCCCCGCCGCCACAGG - Exonic
1174017672 20:47501948-47501970 GCTCAGCCCGCAGCCGCCGCCGG - Exonic
1174258798 20:49278264-49278286 GAGCCCGCCGGCTCCGCCGCCGG - Intronic
1174287770 20:49484197-49484219 GCCGCCGCCGCCGCCGCCGCGGG - Intergenic
1174305900 20:49614106-49614128 GCTCCTGCCGCCCCCGACCCTGG - Intergenic
1174357822 20:50010100-50010122 GCCGCCGCCGCCGCCGCTGCCGG - Intergenic
1174380713 20:50153736-50153758 GCCCGCGCCGCCGCCGCGCCCGG - Intergenic
1174386499 20:50190913-50190935 GCTGCTGCTGCCGCCGCTGCCGG - Exonic
1174386803 20:50192142-50192164 GCCCCCGCCCCCGGCGGCGCCGG + Exonic
1174494667 20:50931112-50931134 GCGGCCGCCGCCGCCCGCGCCGG - Exonic
1174494731 20:50931312-50931334 GTTGCCGCCGCCGCCTCCGCCGG - Intergenic
1174607044 20:51768469-51768491 GCTGCCGCCGCCTCCTCCCCCGG - Exonic
1174611660 20:51802284-51802306 TCCCCCGCCGCGGGCGCCGCTGG + Exonic
1175267061 20:57709536-57709558 AGCACCGCCGCCGCCGCCGCCGG - Exonic
1175429266 20:58890974-58890996 CCTCCCGCGGGCGCCGCCGAGGG - Intronic
1175429538 20:58891709-58891731 GCCGCCGCCGCCGCCGCCATGGG + Intronic
1175764238 20:61581888-61581910 GCTCCCGCCGTCTCCCCAGCCGG + Intronic
1175847032 20:62064849-62064871 GCCCCCGCCCCGGCCGCCGGGGG - Exonic
1175847235 20:62065365-62065387 GCCGCCGCCGCCGTCGCCGCGGG - Exonic
1176061578 20:63175067-63175089 CCTCCCGCTCCCGCCCCCGCCGG + Intergenic
1176207110 20:63895198-63895220 GCCGCCGCCGCCGCCGCCCGGGG + Exonic
1176281530 20:64316481-64316503 GCTCCTGCCGCCGCCAGCCCGGG - Intergenic
1176550023 21:8217026-8217048 GGCCCCGCGGCGGCCGCCGCCGG - Intergenic
1177011054 21:15730367-15730389 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1178334668 21:31732277-31732299 GCGGCCGCCGCCGCCGCCGGCGG - Intergenic
1178334670 21:31732280-31732302 GCCGCGGCCGCCGCCGCCGCCGG - Intergenic
1178453709 21:32727978-32728000 GCAGCCGCCGCCACAGCCGCCGG + Exonic
1178555774 21:33588744-33588766 GGCCCCGCCTCCGCCCCCGCCGG + Intronic
1178961912 21:37073289-37073311 GCCGCCGCCGCCGCCACCTCCGG - Intronic
1179511823 21:41878816-41878838 GGCCCCGCGGCCCCCGCCGCCGG - Exonic
1179561592 21:42219237-42219259 GCCGCCGCCGCCGCCGCCCCCGG + Exonic
1180151576 21:45950841-45950863 CCTCCCGCAGCGGCCGCCTCCGG + Intergenic
1180649957 22:17369506-17369528 GCGGCCGCCGCCGCAGCCGCGGG + Exonic
1180908335 22:19431477-19431499 TGTTCGGCCGCCGCCGCCGCCGG + Exonic
1180950667 22:19719144-19719166 GCTGCCGCCGCCCCCGCGGCTGG + Intronic
1181026854 22:20131826-20131848 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1181498145 22:23299815-23299837 GCTCCCGCCCCAGCCACCCCTGG - Intronic
1181509452 22:23382517-23382539 GCTCCCGCCTCCCCCTCCCCTGG + Intergenic
1181521163 22:23449442-23449464 GCTCCTGCAGCCGCAGCCGGAGG - Intergenic
1181572029 22:23772939-23772961 GCTCCAGCCGCCGCCGCTGCTGG + Exonic
1182236911 22:28883500-28883522 GCCTCCGCAGCCGCCGCCGTGGG - Intergenic
1182237088 22:28884125-28884147 GCGCCCGCCGACCCCGCCGCGGG + Intronic
1182257765 22:29050544-29050566 GCTGCCCCCTCCGCCCCCGCGGG - Exonic
1182532303 22:30969627-30969649 GCTGCCGCCGCCGCCTCCCCCGG - Intergenic
1182567684 22:31212309-31212331 GCTCCTGCCGCCGCCGCCTCAGG - Intronic
1182903974 22:33920814-33920836 GCGGCCGCTGCAGCCGCCGCGGG + Intronic
1183535708 22:38399175-38399197 GCCCCCCCCGCCCCCCCCGCCGG - Intergenic
1183574910 22:38681982-38682004 GCTGCCGCCGTCGCTGCTGCCGG + Exonic
1183715783 22:39532705-39532727 GCTCCAGGCCCCGCCGCAGCAGG + Exonic
1184280307 22:43433654-43433676 GCTCCATCCGCCGCAGCCGGAGG - Intronic
1184698019 22:46150540-46150562 CCGCCCGCTGCCCCCGCCGCGGG - Intronic
1184759690 22:46537443-46537465 GGAGCCGCCGCCGCCGCCGCAGG - Intergenic
1185037935 22:48489464-48489486 GCCGCCGCCGCCGCCGCGCCCGG - Exonic
1185055264 22:48575864-48575886 GCCGCCACCGCCGCCGCGGCGGG - Intronic
1185173222 22:49305355-49305377 GCTGCTGCCGCCTCTGCCGCCGG + Intergenic
1185313766 22:50170317-50170339 GATCCCGCCGCCGCCCCCGCCGG + Intergenic
1185373527 22:50471623-50471645 GCTCCCTCGGCCGCAGCAGCAGG + Intronic
1185397592 22:50600781-50600803 GCACCCCCCGCCGCAGTCGCGGG + Exonic
1185409411 22:50674361-50674383 CCCCCCGCCGCCCCCGCCCCCGG + Intergenic
1185417948 22:50720344-50720366 CTTCTCGCCGCCGCCCCCGCCGG + Intergenic
1203238464 22_KI270732v1_random:30911-30933 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1203254913 22_KI270733v1_random:133352-133374 GGCCCCGCGGCGGCCGCCGCCGG - Intergenic
1203262969 22_KI270733v1_random:178431-178453 GGCCCCGCGGCGGCCGCCGCCGG - Intergenic
949414383 3:3799850-3799872 GCTGCCGCCGCCGCCGCCGTGGG + Exonic
949970239 3:9397670-9397692 GCCGCCGCCGCCGCCGCTGCCGG + Intronic
949970243 3:9397673-9397695 GCCGCCGCCGCCGCTGCCGGGGG + Intronic
949987522 3:9552697-9552719 CCGCCAGCCGCCGCCGCCGCCGG - Exonic
950153815 3:10707951-10707973 GCTGCCGCCGCCGCTGCCGCTGG + Intronic
950487806 3:13283114-13283136 GCCTCCGCCGGCGCCGCCCCCGG + Intergenic
951080301 3:18444721-18444743 CCTGCCGCCGCCGCCGCCGCCGG + Intronic
951208321 3:19947260-19947282 GCCGCCGCCGCCGCCGGCGCTGG - Exonic
951208324 3:19947266-19947288 TCCGCCGCCGCCGCCGCCGCCGG - Exonic
951217750 3:20040570-20040592 GCTTCCGCCCGCGCCCCCGCAGG + Exonic
951485286 3:23203233-23203255 GCCGCCGCTGCCGCCGCCCCCGG - Intronic
951543654 3:23806168-23806190 ACTCGCGCCGCCGGGGCCGCCGG + Intronic
951613947 3:24521816-24521838 GGCTCCGCCGCCGCAGCCGCTGG + Intergenic
951981969 3:28575977-28575999 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
952451740 3:33439973-33439995 GCTCTCGTCCCGGCCGCCGCTGG - Exonic
952867192 3:37862004-37862026 GCTCCCGCCGCCGCCGCCGCTGG - Intronic
953027531 3:39153564-39153586 CCCGCCGCCGCCGCCGCTGCCGG - Exonic
953705207 3:45225816-45225838 GCCGCCGCCGCCGCCTCCTCCGG + Exonic
953909283 3:46883508-46883530 GCAGCCGCCGCCGCCGGCCCTGG - Exonic
953947771 3:47164007-47164029 GCCGCCGCCGCCGCCGCGGTCGG - Intergenic
954304484 3:49718209-49718231 GTGCCTGCCGCTGCCGCCGCTGG - Exonic
954615554 3:51967340-51967362 GCCGCCGCCGCCGCCGCCGCAGG - Exonic
954687455 3:52378540-52378562 GCTCCCTCTGCCGCCTCTGCAGG - Intronic
954838952 3:53494708-53494730 GCCGCCGCCCGCGCCGCCGCTGG - Intronic
954912783 3:54122671-54122693 GCTCTCGTCGCCGCCGCAGCGGG + Exonic
955387610 3:58492063-58492085 GCCGCCGCCGCCGCCGTCGCCGG + Intergenic
955556849 3:60147470-60147492 GCTCCCACCTCCGCCACCGTGGG + Intronic
955911574 3:63863959-63863981 GCCGCCGCCGCCGCCGCCGCGGG + Intergenic
955911598 3:63864011-63864033 GCGCCGGCCGCGGCCGCCCCCGG - Intergenic
955911611 3:63864056-63864078 GCTGCAGCCGGGGCCGCCGCCGG - Intergenic
956658970 3:71581589-71581611 GCTGCCGGCGCCTCCTCCGCGGG - Intronic
956659485 3:71583797-71583819 GCCGCCGCCGCCACCGGCGCTGG - Intronic
956659488 3:71583803-71583825 GCCGCCGCCGCCGCCGCCACCGG - Intronic
956978948 3:74614515-74614537 GCGTAAGCCGCCGCCGCCGCAGG + Intergenic
957350636 3:79018944-79018966 GCTATCGCCGCCGCCGCGGGTGG - Intronic
957350637 3:79018947-79018969 GCTGCTATCGCCGCCGCCGCGGG - Intronic
959591896 3:108090924-108090946 GGGGTCGCCGCCGCCGCCGCAGG + Exonic
960602123 3:119468975-119468997 GCTTCCGCCAGCGCCGCAGCGGG + Exonic
962793990 3:138835005-138835027 GCCGCCGCCGCCGCCACCGCGGG - Intergenic
963038510 3:141051893-141051915 GCTGCCGCCGCCGCCCACTCAGG - Exonic
963236737 3:142963695-142963717 GCCTCCGCCGCCGCCGCCCCCGG + Intergenic
963253093 3:143120069-143120091 GCAGCCGCCGCCGCCGCTGCGGG + Exonic
963602553 3:147390832-147390854 GCTGCTGCCGCCGCCGCCTCCGG - Intronic
963904452 3:150762655-150762677 GCCGGCCCCGCCGCCGCCGCCGG + Exonic
963939793 3:151086657-151086679 AGTCCCTCCGCCGCCGCCACCGG + Intronic
964201452 3:154122397-154122419 GCCTGCGCCGCCGCCGCCGCCGG + Exonic
964570785 3:158105827-158105849 TCCTCCGCCGCCGCCTCCGCCGG + Exonic
964720622 3:159764765-159764787 GCCCCCGCCGCCGCCGCTGCGGG - Exonic
965648415 3:170908606-170908628 GCGGCCGCCACCGCCGCTGCCGG - Exonic
966182199 3:177197561-177197583 GCCGCCGCCGCCGCCGCCGCGGG - Intergenic
966355168 3:179071891-179071913 GCTACCGCTGCCACCGCTGCCGG - Exonic
966362780 3:179148394-179148416 GCTGCTGCTGCCGCGGCCGCTGG + Intronic
966911420 3:184562256-184562278 GCCGCCGCCGTCGCCGCCGCCGG + Exonic
966913006 3:184569620-184569642 CCTCCCGCTGCCGCAGCCCCTGG - Intronic
967849439 3:194071058-194071080 CCTCCCGCCGCCTGCTCCGCGGG + Intergenic
967858259 3:194134283-194134305 GGAGTCGCCGCCGCCGCCGCCGG - Intergenic
967916715 3:194583886-194583908 GCAGCCGCCGCCGCAGCCGAAGG - Intergenic
968225216 3:196968834-196968856 GGGGCCGCCGCCGCCGGCGCAGG + Intronic
968433817 4:575186-575208 GCTGCAGCCGCCGCCCCCGCCGG + Intergenic
968562223 4:1290068-1290090 GCTCCCGCCGCCCTCGCCGCTGG - Intronic
968674716 4:1871348-1871370 CCCGCCGCCGCCGCCGCAGCCGG - Intergenic
968701300 4:2059401-2059423 GCCGCCGCCGCCGCCGCCGCGGG + Intergenic
968835794 4:2963579-2963601 GCGCCCCTCGCCGCCGCGGCCGG - Intergenic
968835882 4:2963878-2963900 GCCGCCGCCGCCGCCTCCGCAGG - Exonic
968835922 4:2964046-2964068 CCTGGCGCCGCCGCCGCCGGCGG - Exonic
968835924 4:2964049-2964071 TGTCCTGGCGCCGCCGCCGCCGG - Exonic
968850569 4:3074975-3074997 GCTTCCTCAGCCGCCGCCGCAGG + Exonic
969330821 4:6472630-6472652 GCCGCCGCCGCCGCTGTCGCAGG + Intronic
969715876 4:8867850-8867872 CCCCCGGCCGCAGCCGCCGCTGG - Exonic
970195212 4:13544910-13544932 GCTACCGCCGCCGCCGCCGGGGG - Exonic
970195215 4:13544913-13544935 GCGGCTACCGCCGCCGCCGCCGG - Exonic
970202885 4:13627497-13627519 GCAGCCACCGCCGCCGCCGCCGG - Exonic
970332791 4:15002876-15002898 GCTGCCCGCGCCGCCGCCGAGGG - Exonic
971327432 4:25655739-25655761 CCGCCTGCCGCAGCCGCCGCCGG - Intronic
971406008 4:26321156-26321178 GCACGCGACGCCGCCCCCGCGGG - Intronic
971757562 4:30721979-30722001 GCCGCCGCTGCCGCCGCCTCCGG - Exonic
972321550 4:37977358-37977380 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
972686915 4:41360777-41360799 GCCGCCGCCGTCGCCGCCGCAGG - Exonic
972725774 4:41745776-41745798 GCCGCCGCCGCCGCCGCCGCAGG + Exonic
972960648 4:44448420-44448442 GCGTCGGCCGCCGCCGCCCCGGG - Exonic
973613596 4:52659014-52659036 GCCCCCGCCGCCCCAGCCACCGG + Intronic
974385652 4:61200512-61200534 GCCGCCGCCGCCGCTGCTGCTGG + Intergenic
975342592 4:73258628-73258650 GCAGCCGTCGCCGCCGCCACCGG + Exonic
975689527 4:76950032-76950054 ACAGCCGTCGCCGCCGCCGCGGG - Intronic
975779055 4:77819917-77819939 GGCCCCGCGGCCGCGGCCGCCGG + Intergenic
975779057 4:77819920-77819942 GCGCCGGCGGCCGCGGCCGCGGG - Intergenic
975973754 4:80072683-80072705 GGTCCCGCTGCCGCAGGCGCCGG - Intronic
975973771 4:80072761-80072783 GCCACCGCCGCAGCTGCCGCCGG + Intronic
976199148 4:82561950-82561972 GCCGCCGCCGCCACCGCAGCAGG - Intronic
976246815 4:83012842-83012864 GCCGCCGCCGCCGCTGCTGCTGG - Intronic
976389364 4:84493328-84493350 GCCGCCGCCGCCGCCGCTGCTGG + Exonic
976765360 4:88592698-88592720 GCCCCCGCCGCCGGAGCCACGGG - Intronic
976830340 4:89307868-89307890 GACGCCGCCGCCGCCCCCGCCGG + Exonic
977257545 4:94757911-94757933 GCCGCCGCCGCCGCCACCGCGGG - Intergenic
978072534 4:104491317-104491339 GCCGCCGCCGCCGCCACCGCCGG + Exonic
978072536 4:104491320-104491342 GCCGCCGCCGCCACCGCCGGCGG + Exonic
978617932 4:110614368-110614390 GATGCCCCCGCCGCCGTCGCCGG - Intergenic
978777206 4:112516022-112516044 CGGGCCGCCGCCGCCGCCGCCGG - Exonic
979278086 4:118835810-118835832 CCTCCCGCCGCCACTGCCTCAGG + Intronic
979674683 4:123398349-123398371 TCCCCCGCCCCCGCCGCCACCGG - Intronic
980130065 4:128809970-128809992 GCCGCCGCCGTCGCCGCCGCGGG - Intronic
981270747 4:142845728-142845750 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
981300912 4:143185114-143185136 GCTCCCGCCGACGCCGCTGGGGG + Exonic
981550601 4:145937743-145937765 GCCGCCGCCGCCGCTGCCGCCGG + Intronic
981550603 4:145937746-145937768 GCCGCCGCCGCTGCCGCCGGCGG + Intronic
982042368 4:151409034-151409056 GGCCCCGCCCCCGCCGCCGCCGG - Intergenic
982712252 4:158769132-158769154 GCCACCGCGGCCGCCGCCCCCGG + Exonic
983537967 4:168878152-168878174 GCCCCCGCCCCCGCCACCCCCGG + Intronic
983538020 4:168878329-168878351 GCTGCCCTCGCAGCCGCCGCCGG + Intronic
983538021 4:168878332-168878354 GCCCTCGCAGCCGCCGCCGGCGG + Intronic
983923433 4:173371258-173371280 GCGGCCGCCGCCGCCTCGGCGGG + Exonic
983940284 4:173529557-173529579 GCCGCCGCCGCCGCCGCCTCCGG + Exonic
984462994 4:180059163-180059185 GGAGCCGCCGCCGCCGCGGCCGG - Intergenic
984778665 4:183505123-183505145 GCACCGGCCGCGGCCGCCGCGGG - Exonic
984889018 4:184474812-184474834 GCTCCCGCCGCCGCGACCTGGGG - Intergenic
984917011 4:184734035-184734057 GCGGCCGCCGCCGCCCCCGCGGG + Exonic
985472247 5:53531-53553 CCTCCCGCCGCCGATGCCGCTGG - Intergenic
985520997 5:373841-373863 GCTCCCGCCCCCGCCCGCCCGGG - Intronic
985894265 5:2739620-2739642 ACCCCCGCCGCCGTCGCCGCCGG + Intergenic
985896184 5:2751181-2751203 GACGCCGCCGCCGCCGCCGCCGG - Exonic
986297082 5:6448723-6448745 GCCGCCGCCGCCGCAGCCGCCGG - Exonic
986297120 5:6448810-6448832 CCCGCCGCCGCCGCCACCGCCGG - Exonic
986330464 5:6713471-6713493 GCCGCCGCCGCCGCCGCCGCAGG + Intergenic
986330585 5:6713851-6713873 GCCGCCGCCGCCGCCGCCACCGG + Intergenic
986813659 5:11385160-11385182 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
987193242 5:15500354-15500376 GCTCACCGCGCCGCCGCCGCCGG - Exonic
987258264 5:16179467-16179489 GCCGCCGCCGACGCCGCCGCCGG - Exonic
988437528 5:31193800-31193822 GCCGCCGCCGCCGCGGTCGCCGG - Exonic
988825299 5:34929659-34929681 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
989744311 5:44809430-44809452 GCACGCGCCGCCTGCGCCGCAGG - Exonic
989812670 5:45696208-45696230 GCCGCCGCCGCCGCCGCGACGGG - Intergenic
990607146 5:57422571-57422593 TCCCCCGCCGCCGACACCGCGGG - Intergenic
990955145 5:61332804-61332826 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
991435907 5:66596841-66596863 GCCGCCGCCGCCGCCGCCGTTGG + Exonic
991676557 5:69094287-69094309 GCCGCCGCCGCCGCCGGGGCCGG - Exonic
992067462 5:73120719-73120741 CGACCCGCCGCCGCCGGCGCAGG - Intronic
992105725 5:73448042-73448064 GCCGCCGCCGCCGCCCCCACCGG + Exonic
992528079 5:77630563-77630585 GCTGCCTCTGCCGCCGGCGCTGG - Exonic
992550152 5:77852022-77852044 CCTCCTCGCGCCGCCGCCGCGGG + Intronic
992663732 5:78985396-78985418 GCCCCCGCCGCCTCCGACCCGGG + Exonic
993900507 5:93581272-93581294 GCCGCCGCTGCCGCCGCCGGGGG - Intergenic
993901218 5:93585112-93585134 GGCGCCGCCGCCGCCGCCGCGGG - Exonic
994353874 5:98774022-98774044 GCCCGCGCCGCCGCCCTCGCCGG + Exonic
995106245 5:108381032-108381054 GCAGCCCCCGCCGCCGCAGCGGG + Exonic
995571697 5:113488355-113488377 GCCGCCGCCGCCGCCGCTGCTGG + Exonic
996404174 5:123090170-123090192 GCCGCCGCCGCCCCCGCCCCCGG + Exonic
996404296 5:123090644-123090666 GCGCCCGCCGGCGCCGGCGCCGG - Intronic
996404299 5:123090650-123090672 GCACCCGCGCCCGCCGGCGCCGG - Intronic
996442951 5:123512481-123512503 GCCGCCGCCGCTGCCCCCGCCGG + Intronic
996862880 5:128084514-128084536 CCCACTGCCGCCGCCGCCGCCGG - Exonic
996900403 5:128537465-128537487 GCCCCAGCCGCCGCCGCAACAGG - Exonic
996978452 5:129461334-129461356 GCTCCGGCCCCCGCCGCCGTCGG + Exonic
997013338 5:129904387-129904409 CCTCCCGCTCCCCCCGCCGCCGG - Intergenic
997013381 5:129904559-129904581 GCTGCCGCCACCGCCGCCGCCGG + Exonic
997297527 5:132777270-132777292 TCTCCCGCCGCCGCCGCCAAGGG - Exonic
997319160 5:132963582-132963604 GCTGCCGTCGCCGCCGCCAGCGG - Exonic
997568194 5:134905280-134905302 GGTCCCTCAGCCGACGCCGCCGG - Intronic
997675189 5:135707509-135707531 ACTCCCGCCGCCCCCGCCCTTGG + Intergenic
997965480 5:138352880-138352902 CCGCTCGCCGCTGCCGCCGCGGG - Exonic
998130867 5:139650468-139650490 GCCCCCGCCGGAGCCGCCCCAGG + Intronic
998199415 5:140107826-140107848 GCCGCCGCCGCCGCCGCAGACGG - Intronic
998406653 5:141878192-141878214 GCTGCTGCCTCCACCGCCGCCGG + Intronic
999727239 5:154446653-154446675 GCCCCAGCTGCCGCCGCCCCGGG + Exonic
999868628 5:155728278-155728300 GCTGCCGCTGCTGCCGCTGCCGG + Intergenic
1000319026 5:160119160-160119182 GCCGCCACCGCCGCCGCCGGGGG - Exonic
1000319030 5:160119163-160119185 CCCGCCGCCACCGCCGCCGCCGG - Exonic
1000463529 5:161548845-161548867 ACTCCACCCGCAGCCGCCGCGGG - Intronic
1001094848 5:168768114-168768136 GCCACCGCCGCCACCACCGCTGG - Intronic
1002591075 5:180291982-180292004 GCCGCCGCCGCCGCCGCAGTGGG + Exonic
1002591099 5:180292058-180292080 GCTGCCGCCGCCGCGGCGCCCGG + Exonic
1002666773 5:180831185-180831207 CCCGCCGCCGCCGCCGCCTCGGG + Intergenic
1002888205 6:1313543-1313565 CCTTCCGCAGCCGCCGCCTCAGG + Exonic
1002898159 6:1390846-1390868 GTCGCCGCCGCCGCCGCCCCCGG - Exonic
1002991873 6:2245756-2245778 CCTGCCGCCGCCACCGCCTCAGG + Intergenic
1003603808 6:7542007-7542029 GCTGGTGCCCCCGCCGCCGCTGG - Exonic
1003624091 6:7727052-7727074 GCTGCCGCGGCCGCCGCCGCCGG + Exonic
1003624094 6:7727055-7727077 GCCGCGGCCGCCGCCGCCGGGGG + Exonic
1004174560 6:13328512-13328534 GCTGCCGCTGCCGCCGCCGCCGG + Intronic
1004193975 6:13487713-13487735 GCCCCCGCCGCCGCCAGCTCCGG + Intergenic
1004216792 6:13711274-13711296 CCCTCCGCCGCCGCCGCCCCCGG - Exonic
1004216840 6:13711430-13711452 GCTGTCGCCGCCACCGCCGGCGG - Exonic
1004395894 6:15246048-15246070 GCCGCCGCCGCCGCCGCCGCTGG + Intergenic
1004663343 6:17729028-17729050 ACCCCCGCCGCCACCACCGCCGG + Intergenic
1004924053 6:20402374-20402396 GCCGCCGCTGCCGCCGCCCCGGG + Exonic
1005682343 6:28218972-28218994 GCTCCCCCCGCCCCCCCCACGGG - Intergenic
1005743452 6:28814286-28814308 GCCTTTGCCGCCGCCGCCGCAGG - Intergenic
1006071047 6:31498242-31498264 GCACCCCCGGCAGCCGCCGCTGG + Exonic
1006302353 6:33200322-33200344 GCCGCCGCCGCCGCCGCTGCGGG + Exonic
1006421253 6:33935533-33935555 GCTCCCGCCCCTGCAGCCACTGG - Intergenic
1006472624 6:34237218-34237240 GGCTCCGCCGCGGCCGCCGCTGG - Exonic
1006472660 6:34237335-34237357 CCCTCCGCCGCCGCCGCCGCGGG - Intronic
1006671434 6:35731939-35731961 ACTCCCGCCGCGCCCGGCGCCGG - Intergenic
1006725401 6:36196503-36196525 GGCGCCGCCGCCGCCGCCACGGG - Intergenic
1006725409 6:36196546-36196568 GCCCCGGCCGCCGCCGCGCCAGG + Intergenic
1007444513 6:41895020-41895042 CCTCCCGCCGCCCCCGCCCCGGG + Intronic
1007625341 6:43243506-43243528 GCTGCCGCCGCCGTCGCCCAAGG + Intergenic
1007784201 6:44270777-44270799 ACCGCCGCCGCCGCCGCCGGCGG - Exonic
1007784203 6:44270780-44270802 GCCACCGCCGCCGCCGCCGCCGG - Exonic
1008013324 6:46491194-46491216 GCCTCCGCCTCCGCCTCCGCCGG - Exonic
1009905641 6:69867385-69867407 GCAGCCACCGCCGCCGCCGCCGG + Intronic
1010044078 6:71420442-71420464 GCGCCCGCCGGTGCCACCGCCGG - Intergenic
1010141881 6:72622137-72622159 GCTGCCCCCGCCGCAGGCGCTGG + Exonic
1010187156 6:73157427-73157449 GCTCCCACCGCCCCCGCCCCCGG - Intronic
1011515058 6:88144825-88144847 ACTCCCGCAGCCTCCGCTGCAGG - Exonic
1012399997 6:98835070-98835092 GCCCCCGCCGCCGCCGCCGTGGG - Exonic
1012400119 6:98835590-98835612 GCCGCCCCCGCCGCCCCCGCAGG + Exonic
1012401190 6:98843840-98843862 GCTCCCGCCGCACCCGCCCGCGG + Intergenic
1012475903 6:99614277-99614299 CCTCCCGCCGCCGCGACGGCCGG - Exonic
1012475914 6:99614302-99614324 GCCTCCGCTGCCGCCGCCCCCGG - Exonic
1012939654 6:105403131-105403153 CTTGCCGCCGCCGCCGCCGCTGG - Intergenic
1013117469 6:107114442-107114464 CTCCCGGCCGCCGCCGCCGCGGG + Intronic
1013117807 6:107115542-107115564 GCGGCCGCCGCCCCCGCCCCGGG - Intergenic
1013155803 6:107490254-107490276 GCTCCCGCCGCCGCCGCCGCCGG - Exonic
1013155878 6:107490561-107490583 GCTGCTGCCGCCGCCGGCGGTGG - Exonic
1013272849 6:108559560-108559582 GCTCCCGCTGCTGTCCCCGCTGG - Intergenic
1013273404 6:108561604-108561626 GCTGCCACCGCCGCAGCCGGGGG + Exonic
1013575832 6:111483055-111483077 GCTGCTGCCGCCGCCTCCTCAGG + Exonic
1013619281 6:111872872-111872894 GCGCACGCCGCCCCCGCCGCAGG - Intronic
1013793611 6:113860181-113860203 GCTGCGGCCGCCGCCGAGGCGGG + Exonic
1014137540 6:117907190-117907212 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1015148928 6:130018509-130018531 GCCGCCGCCGCCGCCGCTGCCGG - Exonic
1015965459 6:138692697-138692719 GCCCCGGCCCCCGCCGCCTCGGG + Intergenic
1016328238 6:142927056-142927078 GCTCCCGGCGCCTCCGTCCCCGG + Intronic
1016738970 6:147508626-147508648 GCCGCCGACGCTGCCGCCGCGGG - Intergenic
1016863962 6:148747769-148747791 CCGCGCGCCGCCGCCGCCCCGGG + Intronic
1016923474 6:149317889-149317911 GCCAGCGCCGCCGCCGCCTCCGG - Intronic
1017446346 6:154510334-154510356 CCTCCTTCCCCCGCCGCCGCCGG + Exonic
1017672044 6:156777942-156777964 GCGGGCGCCGCGGCCGCCGCCGG + Exonic
1017672239 6:156778731-156778753 TCCGCCTCCGCCGCCGCCGCCGG + Exonic
1017672281 6:156778840-156778862 GCCGCCGCCGCCGCCCGCGCCGG - Exonic
1017672353 6:156779074-156779096 GCTCGCGGCCCCGCCGCCCCCGG - Exonic
1017793625 6:157823034-157823056 GCCGCCGCCGCCGCCGCCCCCGG - Intronic
1018400331 6:163414610-163414632 GCCGCTGCTGCCGCCGCCGCTGG + Intronic
1018400494 6:163415143-163415165 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1019253770 7:35468-35490 GCTGCTGCCGCCGCCGCCGCCGG + Intergenic
1019279505 7:192862-192884 GCGCTCGCAGCCGCCGGCGCGGG - Intergenic
1019298497 7:291161-291183 CGCGCCGCCGCCGCCGCCGCCGG - Intergenic
1019343660 7:519754-519776 GCCTCCGCCGCAGCCGCCGCCGG + Intronic
1019474247 7:1236432-1236454 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1019539953 7:1547006-1547028 GCTCCCGCCGGAGCCGCCGCTGG + Exonic
1019590175 7:1827036-1827058 GCTCCTGCAGCCGCAGCCGGAGG + Intronic
1019989560 7:4682263-4682285 GCCGCTGCAGCCGCCGCCGCCGG + Intergenic
1019989562 7:4682266-4682288 GCTGCAGCCGCCGCCGCCGGAGG + Intergenic
1020204547 7:6104910-6104932 GGCACCGCCGCCGCCGCCTCCGG - Exonic
1020238447 7:6374413-6374435 GCTCCCGCCCGCGCCGCTCCCGG - Intergenic
1020274460 7:6615907-6615929 CCTCCCGCCCCAGCCCCCGCCGG + Exonic
1020418205 7:7969441-7969463 CCGCCCGCCGTCGCCGCCGCCGG + Exonic
1020727336 7:11832140-11832162 GCCGCCGCCGCCGCCGCCTCTGG + Exonic
1021451254 7:20785340-20785362 GCCGCCGCCGCCGCTGCCCCCGG + Exonic
1021992595 7:26152436-26152458 GGTCCCGGCGCCCCAGCCGCCGG - Exonic
1022097900 7:27152218-27152240 TCTCCCACCGCTACCGCCGCCGG + Intronic
1022106264 7:27199875-27199897 CCCCCTGCCGCCGCAGCCGCCGG + Exonic
1022207524 7:28179572-28179594 TCTCCAGCGGGCGCCGCCGCAGG + Intronic
1022230531 7:28409143-28409165 GCCCCCGCCGCTGCCGCTCCCGG + Intronic
1022375282 7:29806607-29806629 GTCTCCGCCGCCGCCGCCTCCGG - Exonic
1022528625 7:31053423-31053445 CCGCCCCCCGCAGCCGCCGCAGG - Intronic
1022739726 7:33109417-33109439 GCCGCCGCCGCCGCCGCCGCCGG - Intergenic
1023773689 7:43583336-43583358 CCGGCCGCCGCCGCCGCCCCAGG + Exonic
1023944890 7:44795823-44795845 GCTCCTACCGCCCCCGCCTCGGG - Intergenic
1024082421 7:45866155-45866177 GCTGCCGCTGCCGCTGCCGCTGG + Intergenic
1026360566 7:69598484-69598506 GCTCCCGCTGCAGCCGCCCGGGG + Intergenic
1026732647 7:72925128-72925150 GCTCCAGCCGCCGCAGCCGCCGG - Intronic
1026822273 7:73557571-73557593 GCTCCCGCCGCCGCCATGTCGGG - Exonic
1027001604 7:74658093-74658115 GCGCCCCCCGCCCCCGCCTCGGG + Intronic
1027111417 7:75442691-75442713 GCTCCAGCCGCCGCAGCCGCCGG + Intronic
1027283646 7:76627224-76627246 GCTCCAGCCGCCGCAGCCGCCGG + Exonic
1027374541 7:77537199-77537221 GCCGCCGCCGCCGCCGCCTCAGG - Intergenic
1027421156 7:78019492-78019514 GCTGCCGCCGCCGCCCGGGCCGG + Exonic
1027421282 7:78019934-78019956 TCTCCCGCTGCCGCCGCCCCAGG - Exonic
1028621485 7:92833563-92833585 GTCGCCGCCGCCGCCGCCGCCGG + Exonic
1028621486 7:92833566-92833588 GCCGCCGCCGCCGCCGCCGGAGG + Exonic
1028922341 7:96322038-96322060 GCCCCCACCGCCGCCGCCGCCGG - Exonic
1029276555 7:99408556-99408578 GCCGCCGCCGCCGCAGCCGCCGG - Exonic
1029281561 7:99438949-99438971 GCCGCCGCCGCCGCCGCCCGAGG - Intronic
1029390750 7:100272320-100272342 GCTGCTGCTGCTGCCGCCGCCGG + Intergenic
1029640413 7:101816428-101816450 GCCGCCGCCGTTGCCGCCGCGGG + Intronic
1029640537 7:101816753-101816775 GCCGCCGCCGCCGCCGCCGGTGG - Intronic
1029640538 7:101816756-101816778 CGCGCCGCCGCCGCCGCCGCCGG - Intronic
1031604144 7:123748695-123748717 GCAGCCGCCGCCGCCGCGGAGGG - Exonic
1031604229 7:123749033-123749055 GCGGCCGCCGCCGCCGCTGCGGG - Exonic
1031899309 7:127392377-127392399 GCTGCCGCCGCCACCACCGAAGG + Exonic
1031966578 7:128031733-128031755 GCTGCGGCCGCCGCCGCCGCCGG - Intronic
1032194369 7:129780818-129780840 GCCACCGCTGCCGCCGCCGCCGG + Intergenic
1033159053 7:138981141-138981163 GCGCCCGCCGCCGCCGCCCGGGG - Exonic
1033186571 7:139231835-139231857 GCAGCCGCCGCGGCCGCCGAGGG + Exonic
1034147255 7:148884210-148884232 CGCGCCGCCGCCGCCGCCGCCGG + Exonic
1034251267 7:149692736-149692758 GCTCCCGCCGCCGCCCACCGAGG + Intergenic
1034342733 7:150368721-150368743 GCTCCCGCGGCCGCGGCCTGGGG - Intronic
1034441077 7:151086406-151086428 GCACGCACCGCCGCCCCCGCCGG - Intronic
1034455501 7:151167815-151167837 CCGCCCGCCGCCGCCGCGCCCGG + Intronic
1034522624 7:151632319-151632341 GAGGCCGCCGCCGCCGCCGCAGG + Intronic
1034522625 7:151632322-151632344 GCCGCCGCCGCCGCCGCAGGTGG + Intronic
1034977915 7:155458676-155458698 GCTCGCGCCGCCTTCGCCGCCGG - Exonic
1035169537 7:157009944-157009966 GCCGCCGCCGCCGCCGCTGGGGG - Exonic
1035169541 7:157009947-157009969 GCCGCCGCCGCCGCCGCCGCTGG - Exonic
1035169608 7:157010207-157010229 GCCGCCGCCGCCGCCACCTCCGG + Exonic
1035224584 7:157426384-157426406 GCTCCCGTCGCCTCCTCTGCGGG + Intergenic
1035310055 7:157961897-157961919 GGTCCCGGTGCGGCCGCCGCCGG - Intronic
1035581041 8:738993-739015 GACGCCGCCGCCGCCGCCGCCGG + Intergenic
1036723697 8:11200976-11200998 GCCGGAGCCGCCGCCGCCGCAGG - Exonic
1036723717 8:11201029-11201051 CCTCCCGCGGCCCCCGGCGCCGG - Exonic
1036789545 8:11708835-11708857 GCAGCCGCCGCCGCCTCCGCCGG + Exonic
1036910648 8:12754944-12754966 GCGCCCGCTGCCGCCTCTGCCGG - Exonic
1037273726 8:17156504-17156526 GCCGCCGCCTCCGCCTCCGCCGG + Exonic
1037535227 8:19817436-19817458 GCCGCCGCCGCCGCCACCGCGGG - Exonic
1037769271 8:21789355-21789377 GCCCCCGCCCCCTGCGCCGCTGG + Intronic
1038727615 8:30095462-30095484 GCTGCTGCCGCCGCCGCCTCGGG + Exonic
1038972069 8:32647249-32647271 GCCGCCGCCGCCACCGCCGCTGG + Intronic
1039311418 8:36321652-36321674 GCGCCCGCCGCCACCACCCCTGG - Intergenic
1039453883 8:37695805-37695827 GCCGCCGCCGCCACCGCCGCTGG - Exonic
1039921460 8:41896784-41896806 TTCGCCGCCGCCGCCGCCGCAGG - Intergenic
1040038833 8:42896740-42896762 GCCGCCGCCGCCGCTGCCGCCGG - Intronic
1040065451 8:43140811-43140833 GCCCCCTCCCCCGCCTCCGCGGG - Intronic
1040481426 8:47831285-47831307 GCGCCAGCCGCCGCCGCCACAGG - Intronic
1041059500 8:54022274-54022296 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1041502393 8:58553266-58553288 CCGCTCGCCGCCGCCGCCTCCGG - Exonic
1041552680 8:59119259-59119281 GCCGCCGCTGCCGCCGCCGCCGG + Intergenic
1041673634 8:60516913-60516935 GCGGCCGCCGGCGCCGCCGGAGG - Exonic
1041673635 8:60516916-60516938 TCTGCGGCCGCCGGCGCCGCCGG - Exonic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1042155691 8:65841973-65841995 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1042532864 8:69833000-69833022 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
1043388245 8:79768285-79768307 GCCGCCGCCGTCGCCGTCGCCGG - Intergenic
1043769714 8:84183304-84183326 GCTGCCGCTGCTGCCGCCACTGG + Intronic
1043847275 8:85177486-85177508 GCCGCCGCCGCAGCCTCCGCAGG + Exonic
1045516294 8:102863626-102863648 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1045516298 8:102863629-102863651 GCCGCCGCCGCCGCCGCCGGGGG + Intronic
1045738014 8:105318843-105318865 GCCGCCGCCGCCGCCGCCGCTGG - Exonic
1046654212 8:116874720-116874742 GCTCCCGCCGCCGCCACAGCCGG + Exonic
1047097708 8:121641732-121641754 GCTCCCACCTCCGCCGCCAGAGG - Intergenic
1047961801 8:130016498-130016520 GCTGCTGCTGCCGCCGCGGCGGG - Intronic
1048072801 8:131039959-131039981 GCCCCCGCCTCCGCTGCCGCTGG + Exonic
1048244141 8:132775396-132775418 GCCGCCGCCGCCTCCGCCGCCGG - Exonic
1049145970 8:141001239-141001261 CGCGCCGCCGCCGCCGCCGCCGG - Intronic
1049218365 8:141417889-141417911 GCTGCCGCCACCGCCGCCTGCGG - Intronic
1049405406 8:142449964-142449986 CCTCCAGCCGCCGCCGCCCCCGG - Exonic
1049509076 8:143018704-143018726 TCTCCCGCCCCGGCCCCCGCAGG - Intronic
1049585301 8:143430161-143430183 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1049639333 8:143707569-143707591 GCTGACGGCGCCCCCGCCGCAGG - Exonic
1049661703 8:143822451-143822473 GCTCCCCCCACCGTCCCCGCAGG + Intronic
1049662159 8:143824344-143824366 ACCACTGCCGCCGCCGCCGCCGG + Exonic
1049682172 8:143924282-143924304 GCTCCTCCAGCCGCCGCCGCTGG + Exonic
1049762201 8:144336655-144336677 GGGCCCGGCGCCGCCGCCCCCGG - Intergenic
1049784656 8:144444573-144444595 GCGCCCGCCGCCGCCGTCGAGGG - Intergenic
1049796952 8:144501273-144501295 GCTCAGGCCGCCGCCCCCGGAGG + Exonic
1049828614 8:144685814-144685836 GCGTCCTCCGCCGCCGCCGCCGG + Intergenic
1050151287 9:2621794-2621816 TCTCCGGCCGCCGCCGGTGCGGG + Intergenic
1050455772 9:5832845-5832867 GCTCGCGCCGCCGCTACCCCCGG + Exonic
1051170173 9:14313779-14313801 GCCGAGGCCGCCGCCGCCGCCGG + Intronic
1051170304 9:14314287-14314309 GCAGCCGCCGCCGCCCGCGCCGG + Intronic
1051351048 9:16198159-16198181 GCTGCCGCCGCCGCTGCCCTGGG + Intergenic
1051585059 9:18718633-18718655 GCTGCCGCCGCCGCTCCAGCTGG + Intronic
1052192790 9:25678178-25678200 CACGCCGCCGCCGCCGCCGCTGG + Exonic
1052295450 9:26892500-26892522 GCTGCCGCCGCTCCCACCGCCGG + Exonic
1052362157 9:27573213-27573235 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1052362213 9:27573443-27573465 GCCTGCGCCTCCGCCGCCGCGGG + Intronic
1052362215 9:27573449-27573471 GCCTCCGCCGCCGCGGGCGCAGG + Intronic
1053114608 9:35490118-35490140 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1053410749 9:37914705-37914727 ACCCCCGCCCCCGCCTCCGCAGG - Intronic
1053946038 9:43311278-43311300 TTTCCCCCCGCCGTCGCCGCGGG + Intergenic
1054172815 9:61856454-61856476 GCTGCCGCCGCGGCGGCGGCTGG - Intergenic
1054664725 9:67724347-67724369 GCTGCCGCCGCGGCGGCGGCTGG + Intergenic
1054775656 9:69121691-69121713 GCGGCCGCCGCCGCGGCCGGCGG - Intronic
1054781993 9:69174195-69174217 GCTGACGCCGCCGCCGCCGCGGG + Intronic
1054835570 9:69672286-69672308 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1054835654 9:69672553-69672575 GGTGCCGCCGCCGCCGCCGCGGG - Intergenic
1055090997 9:72364836-72364858 GGTGGCGCCGCCGCCGCCGCGGG + Intronic
1055091117 9:72365283-72365305 CCCGCCGCCGCCGCCGCCGCCGG - Intergenic
1055514165 9:77020161-77020183 GCCCCCGCCGCCGCCGCACATGG + Exonic
1055514278 9:77020633-77020655 GCGGCCGCCGCAGCCGCAGCCGG + Exonic
1055612032 9:78032441-78032463 GCTCCCTGCGGCGCCGGCGCTGG + Intergenic
1056773941 9:89498043-89498065 CCAGCCGCCGCTGCCGCCGCCGG - Intronic
1057313375 9:93954986-93955008 GCAGCCGCCGCTGCCGCGGCGGG - Exonic
1057489145 9:95508368-95508390 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1057489190 9:95508557-95508579 GCTGCGGCCGCGGCCGCTGCCGG + Exonic
1057758318 9:97853932-97853954 GCCGCCGCCGCCGCAGCCGGAGG + Exonic
1057881527 9:98796301-98796323 GCCCCCGCCGCTGCGGCCCCGGG + Exonic
1057922000 9:99105183-99105205 GGTCCCGCCGCCACCGCCTGTGG - Exonic
1058467562 9:105244657-105244679 GTAGCCGCCGTCGCCGCCGCCGG + Exonic
1058467565 9:105244660-105244682 GCCGCCGTCGCCGCCGCCGGGGG + Exonic
1058885942 9:109321021-109321043 GCCGCCGCCGCCGCTGCCGCCGG + Intergenic
1059145547 9:111896673-111896695 GCTCTCGCCGGCGCCGCAGCGGG + Intergenic
1059470933 9:114504715-114504737 GCCCCCGCCGCCGCCCGCCCCGG + Exonic
1059483711 9:114611526-114611548 GCCGCCGCCGCCGCCACCCCGGG - Exonic
1059633937 9:116154346-116154368 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1059633959 9:116154397-116154419 CCTCCCGCTGCTGCCGCCGCCGG - Exonic
1059769832 9:117414794-117414816 GCTGCCGCCGCCGCCGCTGCTGG - Exonic
1059769873 9:117414925-117414947 CCTCCCGCCATGGCCGCCGCCGG - Exonic
1060109203 9:120894555-120894577 CCTCCCGCCGCGGCCTTCGCGGG - Intronic
1060200890 9:121651416-121651438 GCTCCCACCCCCGCCCCCGAGGG - Intronic
1060389890 9:123268525-123268547 GCCGCCGCAGCCGCCGCCGCTGG - Intronic
1060700482 9:125746560-125746582 GCGCCTCCCGCCGCCGCCGCCGG - Intergenic
1060700546 9:125746770-125746792 GAAGTCGCCGCCGCCGCCGCCGG - Intergenic
1060770110 9:126326611-126326633 GCCCGCGCCGCCGCCCCGGCCGG - Intergenic
1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG + Intergenic
1060977097 9:127771230-127771252 GCTTCCCCCGCTGTCGCCGCCGG + Intronic
1060979647 9:127785178-127785200 GCCCCCGCCTCCGCCTCCCCCGG - Intergenic
1061038731 9:128127718-128127740 GTTCGCTCCGCCGGCGCCGCGGG + Exonic
1061365790 9:130172100-130172122 GCTCCGGCCCCCGCCGCGGCGGG - Intergenic
1061541080 9:131278038-131278060 GCCGCCGCCGCCGCCGCCTGCGG - Intergenic
1061559673 9:131394344-131394366 TCTCCCGCGGCCGCCGCCGGGGG + Intronic
1061727421 9:132589465-132589487 GCCCCCGCCGCTGCCCCCCCTGG + Exonic
1061961632 9:133991840-133991862 GGTCGCGCCGCCGCCGCCCGCGG - Intronic
1062008086 9:134251559-134251581 GCTCCCGGCCCCGGGGCCGCTGG + Intergenic
1062022595 9:134326513-134326535 GCCGCCGCCACCGCAGCCGCCGG + Intronic
1062403715 9:136383632-136383654 GGGCCCTCCGCCGCCGCCTCCGG + Exonic
1062411401 9:136426989-136427011 GCCCTCCCCACCGCCGCCGCCGG + Intergenic
1062444307 9:136587280-136587302 GCTCCTGCCGGCCCCGCCCCCGG - Intergenic
1062491676 9:136807982-136808004 GCTCCGGCCCCCGCGGCCTCCGG - Exonic
1062560407 9:137139195-137139217 GGAGCCGCCGCCGCCGCCGCCGG + Intronic
1062579206 9:137222093-137222115 GCGGCCGCCGCCGGAGCCGCCGG - Intergenic
1062592238 9:137279496-137279518 GCTCATGCCGCGGCCGCTGCTGG + Exonic
1062626038 9:137441841-137441863 GGTCCCGGGGCCGCCGCCGTCGG + Intergenic
1062630773 9:137462142-137462164 CCGCCCGCCTCCGCCGCCGCGGG + Intronic
1062659136 9:137619185-137619207 GCCGCCGCTGCCGCCGCCTCAGG + Intronic
1062746626 9:138217075-138217097 GCTGCTGCTGCCGCCGCTGCCGG - Intergenic
1203770878 EBV:49522-49544 GCTCAGGCCGCCGCATCCGCTGG + Intergenic
1203586673 Un_KI270747v1:9952-9974 GCCCCCCCCCCCGCCGCCTCGGG - Intergenic
1203589173 Un_KI270747v1:39858-39880 TTTCCCCCCGCCGTCGCCGCGGG + Intergenic
1185641541 X:1591726-1591748 TCCCAGGCCGCCGCCGCCGCTGG - Exonic
1186107842 X:6226467-6226489 GCTCCCGCCCCCGCCGCTCCGGG + Intronic
1186496375 X:10015309-10015331 GCCGCCGCCGCCGCCGCTGCCGG - Intergenic
1186496467 X:10015599-10015621 GCTGTCCCCGCCGTCGCCGCCGG - Exonic
1187067462 X:15854722-15854744 TTCGCCGCCGCCGCCGCCGCCGG - Exonic
1187281539 X:17861234-17861256 GCTGTCGCCGCCGCCGCTGCTGG + Exonic
1187518154 X:19990952-19990974 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1187547312 X:20266715-20266737 GCCGCCGCCGCCGCTGCCGTGGG - Exonic
1187826178 X:23334758-23334780 GCCGCCGTCGCCGCCGCCGCGGG + Exonic
1188003526 X:25002647-25002669 CGCCACGCCGCCGCCGCCGCCGG - Intergenic
1189137119 X:38561513-38561535 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1189407113 X:40735350-40735372 GCTGCCCCCGCCGCCGCCTCCGG + Exonic
1189988458 X:46573940-46573962 ACTCTCGGCGTCGCCGCCGCCGG - Exonic
1190108274 X:47574026-47574048 CCACCCGCCACCGCCGCTGCAGG - Exonic
1190337193 X:49269819-49269841 GCCCCCGCCGGTCCCGCCGCCGG + Intergenic
1190337199 X:49269828-49269850 GGTCCCGCCGCCGGTGCCGTCGG + Intronic
1190542864 X:51496501-51496523 GCCGCTGCCGCTGCCGCCGCCGG + Exonic
1190881621 X:54495925-54495947 CCTCCCGCCGCAGCCGAGGCCGG + Exonic
1192361754 X:70445113-70445135 ACCACCGCCGCCGCCGCCGCCGG - Exonic
1192925022 X:75747168-75747190 GCCGCCGCCGCCGCCACCTCCGG + Intergenic
1193117144 X:77786143-77786165 GCTACCACTGCCACCGCCGCAGG + Exonic
1194325874 X:92515501-92515523 GCTGTAGCCGCCGCCGCCGCGGG + Intronic
1194666821 X:96685068-96685090 GCTCCCGACGCCGCCGCCCCGGG - Exonic
1194977594 X:100409721-100409743 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1194977596 X:100409724-100409746 GCCGCCGCCGCCGCCGCGGGAGG + Exonic
1195520307 X:105822270-105822292 GCCCCTGCCCCCGCCCCCGCTGG - Intergenic
1195803260 X:108735674-108735696 GCTGCCGCCGCCAGCGCGGCCGG + Exonic
1196684023 X:118495703-118495725 GCTGCCGCCGCCGACGCCGTGGG + Intergenic
1196684067 X:118495881-118495903 GCAGCGGCCGCGGCCGCCGCGGG + Intronic
1197415269 X:126165982-126166004 CCACGCGCCGCCACCGCCGCCGG - Intergenic
1197753420 X:129980435-129980457 CCTCCCCCCGCCCCCGCCGCAGG - Intergenic
1197754469 X:129984227-129984249 GCCGCCGCCGCCGCCGCTTCTGG + Intronic
1197962868 X:132024092-132024114 GCCGCCGCCGCCGCCACCCCTGG - Intergenic
1198158511 X:133985356-133985378 GCAGCCCCCGCCGCCGCCGCCGG - Exonic
1198214850 X:134546254-134546276 GCTCCCGGGGCCGACACCGCAGG + Intergenic
1198276332 X:135098371-135098393 TCCGCGGCCGCCGCCGCCGCCGG + Intergenic
1198310177 X:135422372-135422394 GCCTTCGCCGCCGCCGCCGCCGG - Intergenic
1198807171 X:140504066-140504088 GCCGCGGCCGCCGCCGCCTCGGG - Exonic
1199136591 X:144261049-144261071 GCCGCCGTCGCCGTCGCCGCCGG + Intergenic
1199500389 X:148500732-148500754 CCCGCCGCCGCTGCCGCCGCCGG + Exonic
1199736866 X:150693540-150693562 CCCGCCGCCGCCGCCGCCGCCGG - Exonic
1199772739 X:150984398-150984420 GCTGTCGCCGCCGCCCGCGCCGG + Intronic
1200000217 X:153056316-153056338 GCTCTCGCCGCCGCCCCTGGGGG - Intergenic
1200079261 X:153567493-153567515 ACTCCTGCCGCCGCAGCCGAAGG + Intronic
1200092948 X:153644279-153644301 GCCCCCGCACCCGCCCCCGCCGG - Intronic
1200100650 X:153687984-153688006 GCGGCTGCAGCCGCCGCCGCCGG + Intronic
1200155580 X:153972934-153972956 GCCGCCGCCGCCGCCGCGCCCGG - Intronic
1200173702 X:154097452-154097474 CCTCCCCCTCCCGCCGCCGCCGG - Intronic
1200277860 X:154751159-154751181 CCTCCGGCCGCCGCGGCCCCCGG + Intronic
1200292661 X:154887037-154887059 ACTGCCGCCGCCCCCGCCGCCGG + Exonic
1200306069 X:155027084-155027106 GCGCGCGCGGCCGGCGCCGCGGG + Intronic
1200339505 X:155382777-155382799 ACTGCCGCCGCCCCCGCCGCCGG + Exonic
1200346965 X:155457916-155457938 ACTGCCGCCGCCCCCGCCGCCGG - Exonic
1200634596 Y:5634659-5634681 GCTGTAGCCGCCGCCGCCGCGGG + Intronic