ID: 952867208

View in Genome Browser
Species Human (GRCh38)
Location 3:37862048-37862070
Sequence CTCTCCCAGAGCGCGGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952867192_952867208 21 Left 952867192 3:37862004-37862026 CCAGCGGCGGCGGCGGCGGGAGC 0: 2
1: 7
2: 123
3: 326
4: 911
Right 952867208 3:37862048-37862070 CTCTCCCAGAGCGCGGGGCCGGG 0: 1
1: 0
2: 1
3: 21
4: 211
952867191_952867208 22 Left 952867191 3:37862003-37862025 CCCAGCGGCGGCGGCGGCGGGAG 0: 1
1: 3
2: 30
3: 201
4: 656
Right 952867208 3:37862048-37862070 CTCTCCCAGAGCGCGGGGCCGGG 0: 1
1: 0
2: 1
3: 21
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952867208 Original CRISPR CTCTCCCAGAGCGCGGGGCC GGG Intronic
900003601 1:29449-29471 CCCTCCCCGAGCGCGGCTCCAGG + Intergenic
900023319 1:199965-199987 CCCTCCCCGAGCGCGGCTCCAGG + Intergenic
901131144 1:6963007-6963029 GTCTGCCACAGGGCGGGGCCAGG - Intronic
902304722 1:15527088-15527110 CCCTCCGAGAGCCCAGGGCCCGG - Intronic
902826563 1:18978689-18978711 CTCTTCCAGAACGAGGGACCAGG + Intergenic
906307227 1:44727029-44727051 TTCTCCCAGGGGGAGGGGCCTGG + Intergenic
913144609 1:115976781-115976803 CGCTCCCAGACCGCCGGGGCCGG + Intronic
913220818 1:116658905-116658927 CTCTCCTAGAGGGCAGGGACGGG + Intronic
913343245 1:117781224-117781246 CTTCCCCAGAGAGCGGGGTCAGG - Intergenic
915629091 1:157138176-157138198 CTCACCCAGTGCGGGGGGCGGGG - Intronic
917797593 1:178542980-178543002 CCCACCCAGAGCTCTGGGCCAGG + Intronic
918311965 1:183291388-183291410 CGCTCCCAGGGCACAGGGCCTGG - Intronic
922211130 1:223487623-223487645 CTCTCCTGGAGCCTGGGGCCTGG - Intergenic
922680325 1:227589789-227589811 CACGCCCAGAGCACGGGGCCGGG + Intronic
923108021 1:230868845-230868867 CCCTCTCAGAGCGCCGGGCGCGG - Intronic
1064859882 10:19815935-19815957 CTGCCCCAGAGCGCGGGGAGAGG - Intergenic
1065367908 10:24952825-24952847 CTCCCCCTGAGCGCGGGCCCCGG + Intergenic
1065751863 10:28895110-28895132 TTCTCCCAGAGAACGGGGCAGGG - Intergenic
1065767079 10:29040210-29040232 GTCACCCAGAGCCCAGGGCCTGG + Intergenic
1065916070 10:30355902-30355924 TTCTCCCAGAGCCTGGAGCCTGG + Intronic
1067070366 10:43126427-43126449 CTCTCCAAGAGACCAGGGCCAGG - Intronic
1067437342 10:46287388-46287410 CTCTCCTGGAGCCCAGGGCCAGG - Exonic
1067575099 10:47403944-47403966 CTTCCCCAGAGTGCGGGGGCTGG + Intergenic
1067855045 10:49784773-49784795 CGCTCCCAGAGCCGGGGTCCTGG - Intergenic
1072667002 10:97400997-97401019 CTCTGGGAGAGTGCGGGGCCAGG - Intronic
1073559978 10:104488236-104488258 CTCTGACAGAGCACGGGGCAGGG + Intergenic
1074906773 10:117871223-117871245 ATGTCACAGAGCGCGGGGGCTGG + Intergenic
1075082054 10:119390929-119390951 CTCTCTCAGAGGGAGGGGACAGG - Intronic
1075247853 10:120839989-120840011 CTCTCCAAGAGCTGTGGGCCAGG - Intergenic
1076077639 10:127548380-127548402 CTCTCCCAGAACTGTGGGCCTGG + Intergenic
1076373123 10:129967521-129967543 CGCTCCCAGAGCCGGGCGCCAGG - Intergenic
1076380573 10:130022328-130022350 CTCTCCCAGGGCTCTGGGGCGGG - Intergenic
1076682840 10:132183273-132183295 CTCTCCCAGAGGAGGAGGCCAGG - Exonic
1077234131 11:1471845-1471867 CTCTCCCAAAGGGTGGGGCCTGG - Intronic
1077341151 11:2026951-2026973 CTCTCCCAGAGGCCTTGGCCTGG - Intergenic
1077486466 11:2840975-2840997 GTCTCCCAGAGCCTGGAGCCTGG - Intronic
1077630612 11:3808731-3808753 GACTCCCACAGCGTGGGGCCCGG - Intronic
1079090273 11:17476087-17476109 CTCGCCCAGGGCGCGGGCCTGGG + Intronic
1081600416 11:44488721-44488743 CTCTCCCAGAGAGGAGAGCCAGG + Intergenic
1083329742 11:61891821-61891843 TCCACCCGGAGCGCGGGGCCTGG + Intronic
1084441024 11:69173462-69173484 CTTGCCCAGAGGGCTGGGCCAGG - Intergenic
1085531728 11:77195702-77195724 CTGTCCCAGAGCCCTGGGCCAGG + Intronic
1089315480 11:117588308-117588330 CTGTCCCAGAGCGAAAGGCCAGG - Intronic
1089693929 11:120204701-120204723 CTCTCCCATAGCCCAGTGCCAGG + Intergenic
1202824136 11_KI270721v1_random:82140-82162 CTCTCCCAGAGGCCTTGGCCTGG - Intergenic
1091377018 12:31503-31525 CCCTCCCCGAGCGCGGCTCCAGG + Intergenic
1091705657 12:2691445-2691467 CTCTCCCAGCTCGCAGGCCCCGG + Intronic
1092158296 12:6299542-6299564 CTCACACAGAGCCCAGGGCCAGG + Intergenic
1096355063 12:50933980-50934002 ATCTCCCAGAGCTGGGGGCTTGG - Intergenic
1100411333 12:94322546-94322568 CTCTCCCAGAGAGAGGGGCAGGG - Intronic
1103310736 12:120005401-120005423 GTCTCCCAGAGTGCGGTGGCTGG + Intronic
1104631741 12:130408489-130408511 CTCTGCCACAGATCGGGGCCTGG + Intronic
1104841713 12:131828874-131828896 CGCTCCCAGCGCACGGAGCCGGG - Intronic
1104982580 12:132580863-132580885 CCCTCCCAGGGCCCGGGCCCAGG + Intronic
1105830741 13:24161260-24161282 CGCTCCCAGCTCGCGGGGCCTGG + Intronic
1105943318 13:25170271-25170293 CTCTCCCAGACCGAGGAGCAGGG - Exonic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106208788 13:27621912-27621934 CTGTCCCATAGCGCGAGGCGCGG - Exonic
1107823590 13:44307733-44307755 CCCTCCTAGAGCACTGGGCCCGG - Intergenic
1110041481 13:70765533-70765555 GTCTCCCAGAGCTAGGGGCTGGG + Intergenic
1111979693 13:95003109-95003131 CTCTGCCACAGAGCTGGGCCTGG - Intergenic
1112503028 13:99956760-99956782 CTCTCCCCCAGCCCGCGGCCCGG - Intergenic
1113200955 13:107867225-107867247 CTCTCCCAGAGTCCGGAGCCTGG + Intergenic
1113464584 13:110504441-110504463 CTGTCCCAGGACTCGGGGCCAGG - Intronic
1118641743 14:67798889-67798911 CCCTCCCCGGGGGCGGGGCCTGG - Intronic
1118778820 14:68992477-68992499 AACTCCCAGAGCCCGGGACCTGG - Intergenic
1121559665 14:94865006-94865028 CAGTCCCGGAGCCCGGGGCCTGG + Intergenic
1121781648 14:96625831-96625853 CTCGCCCAGAGCGCTGGGGATGG + Intergenic
1122214133 14:100192465-100192487 CTGTCCCAGAACGCAGAGCCTGG - Intergenic
1123002209 14:105301484-105301506 CACTCCCAGAGCCCGGGGTTGGG - Exonic
1123029856 14:105446515-105446537 CTCACCCACAGCGCTGGGACGGG - Intronic
1125742020 15:41972124-41972146 CCCTCCCGGAGCTCGGCGCCCGG - Intronic
1125918500 15:43510429-43510451 CACTCCCAGGGCCCGGGGCAAGG + Intronic
1127257897 15:57307003-57307025 CGGTCCCAGAGCTTGGGGCCGGG - Intergenic
1129224702 15:74162185-74162207 CTCTCCCAGAGCTCAGACCCAGG + Intergenic
1129676151 15:77633182-77633204 CTCGCCCAGAGCCCCGGACCCGG - Intronic
1132240955 15:100256729-100256751 CTCACCCAGAGCACAGGCCCAGG + Intronic
1132449902 15:101961491-101961513 CCCTCCCCGAGCGCGGCTCCAGG - Intergenic
1132970019 16:2682650-2682672 CGCTGCCAGGGCGCTGGGCCAGG - Exonic
1133580859 16:7143317-7143339 CTCTCCCTGAGAGCTGGGTCGGG - Intronic
1136365931 16:29809350-29809372 CCCTCCCTGAGCCTGGGGCCTGG - Intronic
1136460599 16:30407871-30407893 CTGTGCCAGAGCGTGGGGCCGGG + Intronic
1136777621 16:32880148-32880170 CTTTCCCACAGGGCCGGGCCTGG - Intergenic
1136893003 16:33981366-33981388 CTTTCCCACAGGGCCGGGCCTGG + Intergenic
1137830438 16:51538693-51538715 CTGTCCCAGAGGCAGGGGCCTGG - Intergenic
1139597908 16:67968735-67968757 TCCTCCCAGAGCGGGGGCCCTGG + Intronic
1140917248 16:79505566-79505588 CACTCCCAGGGCGCAGGGACCGG + Intergenic
1141801371 16:86311604-86311626 CTACCCCAGAGCCCTGGGCCTGG - Intergenic
1142240383 16:88941934-88941956 CTCGCCCCCAGCGCGGCGCCTGG + Intronic
1203080036 16_KI270728v1_random:1142257-1142279 CTTTCCCACAGGGCCGGGCCTGG - Intergenic
1143740360 17:8948399-8948421 ATCTCACAGAGCTCGTGGCCAGG + Intronic
1148335141 17:46835902-46835924 CTGTCCCAGAGAGAAGGGCCGGG - Intronic
1148463549 17:47851363-47851385 CACTCCCAGGGAGAGGGGCCCGG + Intronic
1148755057 17:49969100-49969122 CTGTCCCGGGGGGCGGGGCCCGG + Intronic
1150291222 17:63983494-63983516 CTCTGCCAGCGCTTGGGGCCTGG + Intergenic
1150291687 17:63985931-63985953 CTTTCCCAGAGCGAGCGGCAGGG - Intergenic
1151703531 17:75755394-75755416 CCCTCCCAGGGGGCGGGGCTGGG + Intronic
1152133607 17:78491641-78491663 CCCTCCCAGAGAGAGAGGCCAGG - Intronic
1152324755 17:79629102-79629124 CACACCCAGGGCGCGGGGGCAGG - Intergenic
1152938667 17:83154493-83154515 CTCCCACAGAGCCCTGGGCCTGG + Intergenic
1153663630 18:7348675-7348697 CTCTGCTAGAGAGCGTGGCCAGG + Intergenic
1154214825 18:12408185-12408207 CTCGCCCAGACCGCGGTCCCGGG - Intronic
1154274690 18:12948491-12948513 CTCTCCCAGGCCGCGCTGCCGGG + Intronic
1155963940 18:32018908-32018930 CTCTGCCACCGCGCGGGCCCTGG + Exonic
1156144457 18:34159228-34159250 CCCTCGCGGAGCGCGGCGCCCGG - Intronic
1156482537 18:37445278-37445300 CTGCCCCAGAGAGCGCGGCCAGG + Intronic
1158963914 18:62607437-62607459 CTCCTCCTGAGGGCGGGGCCAGG + Intergenic
1160565055 18:79781863-79781885 CCCTGCCAGACAGCGGGGCCTGG - Intergenic
1160635354 19:71056-71078 CCCTCCCCGAGCGCGGCTCCAGG + Intergenic
1161258020 19:3320491-3320513 GTTTCCCGGAGCGCCGGGCCGGG + Intergenic
1161975869 19:7607570-7607592 CTCTCCCCAAGCTGGGGGCCTGG + Intronic
1162765920 19:12919358-12919380 TTCTCAAAGAGGGCGGGGCCGGG - Intergenic
1162932244 19:13962955-13962977 CCCACCCAGGGCGCGGGTCCCGG - Intronic
1162951072 19:14072539-14072561 GCCCCCCAGAGAGCGGGGCCGGG + Exonic
1163392199 19:17037490-17037512 CACTCCCAGGGCCCGGGGTCTGG + Intergenic
1163690269 19:18734933-18734955 TTCTCCCAGAGGCCGGGGCTGGG - Intronic
1166688291 19:44808938-44808960 ACCTCCCAGTGCACGGGGCCAGG - Intergenic
1167045205 19:47045559-47045581 GCCTCCGGGAGCGCGGGGCCCGG - Exonic
1167158978 19:47755531-47755553 CTCTCCCAGAACCCCCGGCCTGG - Intronic
1167503088 19:49858156-49858178 CTCTTCCAGAGGGCGGGGCTGGG + Intronic
1167618944 19:50550929-50550951 CTGGCCCAAAGCGCAGGGCCTGG + Exonic
1168336564 19:55600463-55600485 CGCTCCGGGAGCGCGCGGCCCGG - Intronic
925610568 2:5697491-5697513 CTCGCCCAGAGCGGGAGGCTGGG - Exonic
927542762 2:23927287-23927309 CTCTCCCCGACCGCAGGGCTGGG + Intronic
931671584 2:64653407-64653429 GGGTCCGAGAGCGCGGGGCCCGG + Intronic
932599497 2:73113511-73113533 CTCTCCCGGCGCAGGGGGCCGGG + Intronic
932692026 2:73921388-73921410 AGCTCCCAGTGGGCGGGGCCAGG - Intergenic
934129283 2:88931900-88931922 CTCTCCCAGAGGGATGGGCAGGG + Intergenic
934708714 2:96501984-96502006 CTCTAGCAGAGCCCAGGGCCAGG + Intronic
934714666 2:96536752-96536774 ATCTCAGAGAGCGCGGGGTCCGG + Exonic
934836126 2:97590644-97590666 CACGCCCAGAGCGCAGGACCTGG + Intergenic
936040989 2:109149267-109149289 ATCTCCCAGAGAACGGGTCCCGG - Intronic
936566128 2:113583991-113584013 CCCTCCCCGAGCGCGGCTCCAGG - Intergenic
937044236 2:118842860-118842882 TTCTCCCCCAGCGAGGGGCCGGG + Exonic
937201189 2:120205499-120205521 CTCTCCCAGACTTCGGGGCAGGG - Intergenic
941987473 2:171522948-171522970 ATCGCCGCGAGCGCGGGGCCGGG + Intronic
942446813 2:176083585-176083607 TTCTCCCAGAGCGCTGTGCAGGG + Exonic
943624194 2:190180704-190180726 CGCTCCCAGAGGGCGCGCCCTGG + Intronic
945983721 2:216338285-216338307 CTCTCCCAGAGCACTGACCCCGG + Intronic
946249945 2:218405814-218405836 CTCCCCCAGAGCGGGTGGGCGGG + Exonic
946541426 2:220688416-220688438 CTCTCCCAGAGGGCAGAACCAGG - Intergenic
947551733 2:231051316-231051338 CTGTCCCAGAGCAAGGGGCTGGG - Intergenic
947860652 2:233354921-233354943 CCCGCCCAGCGCGCGGCGCCCGG - Intronic
948846796 2:240687184-240687206 CAGTCCCAGAGCGCAAGGCCTGG - Intergenic
1168753699 20:301162-301184 CTCTCACAGAGCTGGAGGCCAGG + Intergenic
1168803949 20:662152-662174 CTCTCCCGGACAGAGGGGCCGGG - Exonic
1168975928 20:1965916-1965938 CCTGCCCAGAGGGCGGGGCCGGG + Intergenic
1173171389 20:40727126-40727148 CTCTCCCAGAGCCAGGGAACTGG - Intergenic
1173464018 20:43267209-43267231 CTTTCCCAGTGGGCTGGGCCTGG + Intergenic
1173633266 20:44532144-44532166 CTCTCCCTGAACGCGGGGCGGGG - Intronic
1173645324 20:44629675-44629697 CTCTCCCAGTGCGCTGGGCTGGG - Intronic
1174105091 20:48156267-48156289 CTCTTCCAGAGGGCAGGGTCAGG + Intergenic
1174475875 20:50795263-50795285 CGCTCCCGGAGTGGGGGGCCCGG + Intronic
1176100955 20:63364320-63364342 CTCTCCCGGAGCCAGGGGCCAGG + Intronic
1178432602 21:32529684-32529706 CTCTCCCAGTTCTGGGGGCCAGG - Intergenic
1179719965 21:43309771-43309793 CTCTGCCAGTGCGCAGCGCCCGG - Intergenic
1179881904 21:44296507-44296529 CTCCCCCAGAGTGGGGAGCCTGG - Intronic
1179890254 21:44331576-44331598 CTGTGCCAGGGCACGGGGCCTGG + Intronic
1180068520 21:45424653-45424675 CTGGACCAGAGCGCTGGGCCAGG + Intronic
1181161300 22:20961524-20961546 CTATCCCAGAGCCTGGGGACAGG + Intergenic
1183484179 22:38080663-38080685 CTCACCCAGAGCGGGCGGTCCGG + Intronic
1183484243 22:38080888-38080910 CTTCCCCAGTGCGCTGGGCCTGG - Exonic
1184608036 22:45585637-45585659 CTTTCCCAGGGTGCTGGGCCCGG + Intronic
1184821731 22:46914740-46914762 CACTCCCACAGCACAGGGCCAGG - Intronic
1185169574 22:49284990-49285012 CTCTCCCAGAGCTCGGGGCAGGG + Intergenic
1185228081 22:49664473-49664495 CTCTGCCAGATGGCTGGGCCTGG - Intergenic
1185259328 22:49853243-49853265 CTCTGGGCGAGCGCGGGGCCGGG - Intergenic
950708254 3:14797089-14797111 CTCTACCTGAGCCAGGGGCCAGG + Intergenic
950901377 3:16500862-16500884 ATCTCCCTGAGGGCAGGGCCTGG - Intronic
952867208 3:37862048-37862070 CTCTCCCAGAGCGCGGGGCCGGG + Intronic
953863636 3:46565576-46565598 CTCTCCCAGAACTCAGGGACTGG - Intronic
956452286 3:69386329-69386351 CTTCCCCAGGGCGCGGGGCAGGG + Intronic
960950116 3:122993740-122993762 CCCTCCCAGAGCGGGTGGCAAGG - Intronic
960955461 3:123027734-123027756 CTCTCTCCGAGCGCCGGGTCGGG - Intronic
961081866 3:124034093-124034115 TTCTCCCAGAGCGCGGGGATGGG + Intergenic
962340317 3:134576775-134576797 GTCTCCCAGACCCCGAGGCCAGG - Intergenic
962733192 3:138301604-138301626 CTCTTCCAGAGCACGTGACCAGG - Intronic
967924119 3:194633175-194633197 CAGTCCCAGAGCGCGGGCGCGGG + Exonic
968225249 3:196968923-196968945 CGCTCCGGGACCGCGGGGCCAGG - Intronic
968286042 3:197509457-197509479 CTTTACCAGAGTGCGTGGCCGGG - Intergenic
968506864 4:974732-974754 CTGTCCCAGAGCGCAGCTCCTGG - Intronic
968596990 4:1490802-1490824 CTCTCCCAGGACGCTGGGCTTGG + Intergenic
968915874 4:3496880-3496902 GTCCCCCAGAGCTCGGGGACAGG + Intronic
968923100 4:3532684-3532706 CTCACCCAGAGCCCGGAGCCTGG + Intergenic
969292105 4:6246374-6246396 CTCTTCCAGAGCCCGGACCCTGG + Intergenic
972312133 4:37891315-37891337 CGCGCTCAGAGCCCGGGGCCGGG - Exonic
974556278 4:63452730-63452752 TTCTCCCAGAGAGAGGGGTCTGG - Intergenic
976431295 4:84966164-84966186 CTCTCCGGGAGCGCGGGGGGCGG + Intronic
982068014 4:151671782-151671804 GTCTTCCAGAGCGCTGGGTCGGG + Intronic
982202692 4:152975190-152975212 CTTCCCCAGAGCTCGGCGCCAGG + Exonic
983077453 4:163343766-163343788 CTCTTCCAAAGCCGGGGGCCGGG - Intronic
984973277 4:185209474-185209496 CCCACCCACAGCGCGGGGGCGGG - Intronic
985538585 5:477521-477543 AGCGCCCAGAGCTCGGGGCCCGG + Intronic
985549208 5:524612-524634 CTCCCCCGGAGCCCGCGGCCTGG + Intergenic
985629944 5:1009017-1009039 CTGCACCTGAGCGCGGGGCCCGG + Exonic
988796238 5:34656133-34656155 CCCGGCCAGAGCCCGGGGCCGGG + Intergenic
997577955 5:134997260-134997282 GGCTCCCAGAGTGTGGGGCCAGG - Intronic
998083195 5:139293748-139293770 CTCTCCCAGCGAGCGGGACGCGG - Intronic
1001383097 5:171316648-171316670 CTATTCCAGAGCGCCTGGCCCGG - Intergenic
1007423671 6:41734308-41734330 CTCACCCGGGGCGCGGGGCTGGG + Intronic
1008923482 6:56867130-56867152 CTCTGCCAGACTGCAGGGCCAGG - Intronic
1010585254 6:77650613-77650635 CCCTCCCTCAGCGCGAGGCCTGG + Intergenic
1011507963 6:88068402-88068424 CTCTCCCAGAAGGAGGGGGCAGG - Intergenic
1013588191 6:111597889-111597911 CTCTACCAGAGGGCGGTGCCTGG + Intronic
1020211263 7:6159650-6159672 CTGTCCCCAAGCGCGTGGCCTGG - Intronic
1020653588 7:10904177-10904199 CTCTCTCAGAGGGTGGAGCCAGG - Intergenic
1021717010 7:23469831-23469853 CTCCCCCAGCGCGCCGGGCCTGG + Intronic
1023151947 7:37209724-37209746 CTCTGCCAGAGCGATGGTCCAGG - Intronic
1024639116 7:51316049-51316071 CCTTCCGAGAACGCGGGGCCCGG + Intronic
1032321978 7:130894222-130894244 CCCTCCCAGACCGAGGGGCCAGG + Intergenic
1032455797 7:132072632-132072654 CTCTCCCAGGCCGTGGGGCAGGG - Intergenic
1034950023 7:155290784-155290806 CTCTCACAGGGAGCAGGGCCTGG - Intergenic
1037819583 8:22129192-22129214 CTCTCCCAGAGGGGGGTCCCTGG + Exonic
1038319410 8:26513881-26513903 CACTTCCGGAGCGCGGGGCTAGG + Exonic
1039064910 8:33599499-33599521 CTCCCTCCGCGCGCGGGGCCCGG - Intronic
1041117504 8:54554442-54554464 CTTTCCCATAGGGCCGGGCCAGG - Intergenic
1042189988 8:66177064-66177086 CTCTCGCGGAGCGCGGCGCTAGG - Exonic
1049042823 8:140125178-140125200 CCCACCCAGAGCTCGGGGGCGGG + Intronic
1049324756 8:142016130-142016152 CTCTCCCTGCGTGCTGGGCCTGG + Intergenic
1049658977 8:143811322-143811344 CTTTCCCAGGGAGCGGGGCAGGG + Exonic
1049718268 8:144103860-144103882 CGCGCCCAGAGCGTCGGGCCTGG + Exonic
1053153306 9:35756638-35756660 CTTTCCCAGAGAGGGGGTCCAGG + Exonic
1056751369 9:89353795-89353817 CTCTGCCAGAGCATGGGGCTAGG + Intronic
1057264109 9:93602910-93602932 CTCTCCCAGAGCCCGAGGCTGGG + Intronic
1057303306 9:93898837-93898859 CCCACCCAGAGCGGGGGCCCTGG + Intergenic
1057432142 9:95004686-95004708 CGCTCGCAGGGCGCGGAGCCGGG + Intronic
1060468778 9:123930281-123930303 GTCTCCCAGGGCGCGGGCCCCGG + Intergenic
1060817088 9:126640688-126640710 CTGTCCCAGAGCTCGGTTCCAGG + Intronic
1062296195 9:135828465-135828487 CTCTCCTACAGCCAGGGGCCAGG + Intronic
1062428390 9:136516456-136516478 CTGTCCCAGAGCTGGGGGCCGGG - Intronic
1062435915 9:136546487-136546509 CTCTCCCAGAGCCCTGCCCCGGG - Intergenic
1187412486 X:19063261-19063283 ATCTCCCAGAGCCCCGGGTCGGG + Intronic
1192584401 X:72307883-72307905 CTCTCCCGGACCGTGGGGCCAGG + Intergenic
1200102225 X:153693894-153693916 CTTTCCCACAGGGCCGGGCCTGG + Exonic