ID: 952867243

View in Genome Browser
Species Human (GRCh38)
Location 3:37862142-37862164
Sequence CCCGCGCGCTTGGCTTGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952867224_952867243 11 Left 952867224 3:37862108-37862130 CCGCGCCGCGCCCCCGCGCCCCC 0: 1
1: 2
2: 32
3: 391
4: 2395
Right 952867243 3:37862142-37862164 CCCGCGCGCTTGGCTTGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
952867230_952867243 -7 Left 952867230 3:37862126-37862148 CCCCCCGCGCCGCGCCCCCGCGC 0: 2
1: 1
2: 28
3: 241
4: 1353
Right 952867243 3:37862142-37862164 CCCGCGCGCTTGGCTTGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
952867233_952867243 -10 Left 952867233 3:37862129-37862151 CCCGCGCCGCGCCCCCGCGCGCT 0: 1
1: 3
2: 6
3: 86
4: 546
Right 952867243 3:37862142-37862164 CCCGCGCGCTTGGCTTGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
952867223_952867243 12 Left 952867223 3:37862107-37862129 CCCGCGCCGCGCCCCCGCGCCCC 0: 1
1: 1
2: 32
3: 243
4: 1926
Right 952867243 3:37862142-37862164 CCCGCGCGCTTGGCTTGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
952867219_952867243 16 Left 952867219 3:37862103-37862125 CCCCCCCGCGCCGCGCCCCCGCG 0: 1
1: 0
2: 21
3: 215
4: 1642
Right 952867243 3:37862142-37862164 CCCGCGCGCTTGGCTTGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
952867225_952867243 6 Left 952867225 3:37862113-37862135 CCGCGCCCCCGCGCCCCCCGCGC 0: 1
1: 8
2: 56
3: 441
4: 2602
Right 952867243 3:37862142-37862164 CCCGCGCGCTTGGCTTGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
952867226_952867243 1 Left 952867226 3:37862118-37862140 CCCCCGCGCCCCCCGCGCCGCGC 0: 1
1: 2
2: 41
3: 284
4: 1479
Right 952867243 3:37862142-37862164 CCCGCGCGCTTGGCTTGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
952867228_952867243 -1 Left 952867228 3:37862120-37862142 CCCGCGCCCCCCGCGCCGCGCCC 0: 1
1: 3
2: 72
3: 403
4: 1851
Right 952867243 3:37862142-37862164 CCCGCGCGCTTGGCTTGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
952867222_952867243 13 Left 952867222 3:37862106-37862128 CCCCGCGCCGCGCCCCCGCGCCC 0: 1
1: 4
2: 36
3: 272
4: 1761
Right 952867243 3:37862142-37862164 CCCGCGCGCTTGGCTTGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
952867229_952867243 -2 Left 952867229 3:37862121-37862143 CCGCGCCCCCCGCGCCGCGCCCC 0: 2
1: 2
2: 116
3: 543
4: 3001
Right 952867243 3:37862142-37862164 CCCGCGCGCTTGGCTTGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
952867227_952867243 0 Left 952867227 3:37862119-37862141 CCCCGCGCCCCCCGCGCCGCGCC 0: 1
1: 2
2: 52
3: 354
4: 1654
Right 952867243 3:37862142-37862164 CCCGCGCGCTTGGCTTGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
952867220_952867243 15 Left 952867220 3:37862104-37862126 CCCCCCGCGCCGCGCCCCCGCGC 0: 2
1: 1
2: 28
3: 241
4: 1353
Right 952867243 3:37862142-37862164 CCCGCGCGCTTGGCTTGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
952867231_952867243 -8 Left 952867231 3:37862127-37862149 CCCCCGCGCCGCGCCCCCGCGCG 0: 1
1: 1
2: 10
3: 142
4: 987
Right 952867243 3:37862142-37862164 CCCGCGCGCTTGGCTTGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
952867221_952867243 14 Left 952867221 3:37862105-37862127 CCCCCGCGCCGCGCCCCCGCGCC 0: 1
1: 1
2: 25
3: 280
4: 1612
Right 952867243 3:37862142-37862164 CCCGCGCGCTTGGCTTGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
952867232_952867243 -9 Left 952867232 3:37862128-37862150 CCCCGCGCCGCGCCCCCGCGCGC 0: 1
1: 2
2: 19
3: 178
4: 1046
Right 952867243 3:37862142-37862164 CCCGCGCGCTTGGCTTGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952867243 Original CRISPR CCCGCGCGCTTGGCTTGCGG GGG Intronic
901021849 1:6260074-6260096 CCCGCCCGCATGTCTTGCGGAGG - Intronic
902348431 1:15835921-15835943 CGCGCGCGCTCGCCGTGCGGGGG + Intergenic
902809404 1:18879801-18879823 CCTGGGCGCTGGGCTTGGGGGGG - Intronic
904353818 1:29925788-29925810 CCCTCGAGCTTGGCTTGCATCGG + Intergenic
908581966 1:65525728-65525750 CGCGCGCGCTCGGCTGGCCGTGG - Intronic
916416049 1:164592803-164592825 CCCACGCGCTGGCCTTGCTGAGG + Intronic
920029197 1:203026494-203026516 GCCGCGCGCTTGGGCGGCGGAGG + Intronic
924198984 1:241640264-241640286 CCGGCGCGCCTGGCGGGCGGAGG + Exonic
1090199392 11:124843409-124843431 CCCCCGCCCCTGGCTTGAGGCGG - Intergenic
1105031567 12:132887649-132887671 GCCCCGCGATTGGCTGGCGGCGG + Intronic
1123964081 15:25438498-25438520 CCCCCGCGCCTGGGCTGCGGCGG + Exonic
1124500681 15:30224745-30224767 CCCGCACGCTCGCCATGCGGTGG - Intergenic
1124742889 15:32313922-32313944 CCCGCACGCTCGCCATGCGGTGG + Intergenic
1125504266 15:40257924-40257946 CCCACAGGCTTGGCTTGAGGAGG - Intronic
1136628450 16:31476042-31476064 CCCGAGCACTTCGTTTGCGGAGG + Exonic
1142157631 16:88539860-88539882 CCCGAGGGGTCGGCTTGCGGGGG - Intergenic
1142591166 17:1006738-1006760 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591186 17:1006803-1006825 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591206 17:1006868-1006890 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591226 17:1006933-1006955 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591246 17:1006998-1007020 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591266 17:1007063-1007085 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591286 17:1007128-1007150 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1143223657 17:5282408-5282430 CCCGCGGGCTCAGCTGGCGGAGG - Exonic
1155221464 18:23689671-23689693 CCCGCGCGGCTGGATGGCGGCGG + Exonic
1158579912 18:58671865-58671887 CCCGCGCGCCCGGCCTGCCGCGG - Intronic
1160724980 19:613874-613896 CCCGCACGCTCGCCGTGCGGCGG - Exonic
1161156351 19:2733652-2733674 CCACCGCGCTTGGCTGGTGGTGG - Intronic
1163535469 19:17874024-17874046 CGGGCGCGGTTGGCTTCCGGAGG + Intronic
926198574 2:10777944-10777966 CCCGGGCGCCTGGCTGGAGGTGG + Intronic
930752589 2:54947508-54947530 CCTGCTCGAATGGCTTGCGGGGG - Intronic
931579894 2:63760982-63761004 CCTGCCCACTTGGCTTGGGGTGG + Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
946923139 2:224599820-224599842 CCCTCGTGCTTGGTTTGCGGTGG + Intergenic
1168830055 20:841039-841061 CCCGCGCGCCAGGTGTGCGGTGG + Intronic
1176412897 21:6458357-6458379 CCCACGAGCTGGGCTTGTGGCGG + Intergenic
1177011024 21:15730249-15730271 CCTTCGCGCCTGGCTGGCGGGGG + Exonic
1179688390 21:43066679-43066701 CCCACGAGCTGGGCTTGTGGCGG + Intronic
1184649029 22:45911233-45911255 CCGGCGCCCTCGGCTTGCGGCGG - Intergenic
952867243 3:37862142-37862164 CCCGCGCGCTTGGCTTGCGGGGG + Intronic
954375965 3:50194288-50194310 ACCGCGCGCTGGGCTGGGGGAGG + Intronic
964474804 3:157088955-157088977 CCCGCGCGCTGGACGTGCCGGGG - Intergenic
968551943 4:1228386-1228408 CCCTCGGGCTTGGCCTTCGGGGG + Intronic
968556595 4:1249003-1249025 CCCACGCGCCGGGCTCGCGGCGG - Exonic
971406002 4:26321133-26321155 GCGGCGCGCTTGGCGTTCGGGGG + Intronic
973613535 4:52658836-52658858 CCCCCGCCCTCGGGTTGCGGTGG - Intronic
976790258 4:88870481-88870503 ACCCCGCGCCTGGCTTGGGGGGG + Intronic
996379017 5:122845452-122845474 CCCGCGCCCTGGGCGTGCCGGGG - Exonic
1002691324 5:181052859-181052881 CCCAGGGGCTTGGCTGGCGGCGG - Intronic
1003176829 6:3758133-3758155 CCGGCTCCCTCGGCTTGCGGGGG + Intergenic
1006547482 6:34791997-34792019 CCCGCCGGCCTTGCTTGCGGCGG - Intronic
1006932811 6:37697761-37697783 CCGGCGGCCTTGGCCTGCGGGGG + Exonic
1024474162 7:49792730-49792752 CCCTCGGGCTTGGCTGGAGGAGG + Intronic
1029712645 7:102308098-102308120 CCCGTGCTGTTGGCTTCCGGTGG - Intronic
1062596497 9:137302145-137302167 GGCGCGCGCTCGGCTCGCGGGGG + Exonic
1189323160 X:40098087-40098109 CCCGAGCGCTGCGCCTGCGGGGG - Intronic
1189325189 X:40107409-40107431 CGCGCGCGCTTGGGTGGGGGCGG - Intronic
1201901156 Y:19046959-19046981 CCGGCTCCCTCGGCTTGCGGGGG - Intergenic