ID: 952869510

View in Genome Browser
Species Human (GRCh38)
Location 3:37886004-37886026
Sequence CTGTGGCAGTGGGAAATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 362}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952869510_952869516 -10 Left 952869510 3:37886004-37886026 CCCTCCATTTCCCACTGCCACAG 0: 1
1: 0
2: 0
3: 48
4: 362
Right 952869516 3:37886017-37886039 ACTGCCACAGCTTCAGGTCAAGG 0: 1
1: 0
2: 1
3: 9
4: 171
952869510_952869518 -1 Left 952869510 3:37886004-37886026 CCCTCCATTTCCCACTGCCACAG 0: 1
1: 0
2: 0
3: 48
4: 362
Right 952869518 3:37886026-37886048 GCTTCAGGTCAAGGCCACAAAGG 0: 1
1: 0
2: 0
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952869510 Original CRISPR CTGTGGCAGTGGGAAATGGA GGG (reversed) Intronic
900001730 1:18205-18227 CAGAGGCACGGGGAAATGGAGGG + Intergenic
900021450 1:188728-188750 CAGAGGCACGGGGAAATGGAGGG + Intergenic
900575818 1:3382019-3382041 CTGTGGCAGAGGAAGATGGCAGG + Intronic
900771335 1:4547265-4547287 ATGTGGGAGGGGGAAATGAATGG - Intergenic
901624869 1:10618138-10618160 TTGAGGCAGTGGGAACAGGAGGG + Intronic
901975145 1:12938536-12938558 CTCTGAAAGTGGGAAAGGGAAGG - Exonic
902125230 1:14203900-14203922 CTGTCACCGTGGGAAATGGATGG + Intergenic
902194496 1:14788320-14788342 CTGTGGCAGATGGAAAAAGATGG + Intronic
903025812 1:20429324-20429346 CTGTGGCACTGCAAAGTGGAAGG - Intergenic
903076485 1:20771838-20771860 CTGTGGCAGTACAAAATTGATGG - Intronic
904442441 1:30540535-30540557 CTGTGGCAGGGCCAAAGGGAAGG + Intergenic
906141156 1:43534345-43534367 CTGTGGCTATGGGAAAAGGATGG + Intronic
906751158 1:48262427-48262449 ATGTGCAAGTGGAAAATGGATGG - Intergenic
907066128 1:51484847-51484869 CTATGTCAGTGGGAAATTGCAGG + Intronic
907923505 1:58934592-58934614 CTGGGGCTGGGGGGAATGGAAGG + Intergenic
908037908 1:60075395-60075417 CTGACACAGTGAGAAATGGAAGG - Intergenic
908173137 1:61527679-61527701 CTGAGGAAGGGGGAAAGGGAAGG + Intergenic
908206137 1:61851785-61851807 CTGTGGCAGTGGAAATGGAAAGG + Intronic
908679733 1:66647351-66647373 TTGTGGCAGTGGGATCTGGGTGG - Intronic
908771975 1:67605780-67605802 CTGAGGCAGAGGAAACTGGAGGG + Intergenic
909926240 1:81440864-81440886 CAGTAGCAGTGGGAATTAGAAGG - Intronic
911629157 1:100163056-100163078 CTGTGGCAGTGGGATATGTGTGG + Intronic
911946964 1:104123449-104123471 CTGTGGACTTGGGAAATGAAGGG - Intergenic
913241703 1:116835485-116835507 CTCTGCCAGTGGCAAATGGCAGG + Intergenic
914218712 1:145658018-145658040 CTGAGGGAGTGGGAATTGGAGGG - Intronic
914369147 1:147006913-147006935 CTGTGGCACTGGAACATGGCAGG + Intergenic
914416795 1:147491375-147491397 CTGTGGAACTGGGAAGTGGTGGG + Intergenic
914471294 1:147980882-147980904 CTGAGGGAGTGGGAATTGGAGGG - Intronic
916368545 1:164061783-164061805 CTGTGTCAGTGGGAAAGGGGAGG - Intergenic
917739256 1:177946989-177947011 TTGAGGCAGTGGAAAATGTATGG - Intronic
919548361 1:198951680-198951702 ATGTGGCTTTGGGGAATGGAGGG - Intergenic
919657942 1:200215346-200215368 GTGTGGCAGTTGGAAAGGTAGGG + Intergenic
919832506 1:201552071-201552093 GGGTGGCTGTGGGAAGTGGATGG + Intergenic
920224275 1:204426772-204426794 TTGGGGCAGTGGGATATGGCAGG - Intronic
920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG + Intronic
921988008 1:221333724-221333746 GTGTGGGAGTGGAAAAGGGAAGG + Intergenic
922072056 1:222204340-222204362 ACGTGGCAGTGGCAAATGCATGG + Intergenic
922788676 1:228297393-228297415 CTTTGGAACTGGGTAATGGATGG - Intronic
923307067 1:232698080-232698102 GTGAGGCAGCAGGAAATGGATGG + Intergenic
924946987 1:248853180-248853202 CTGAGTCAGTGAGGAATGGATGG - Intronic
1063084414 10:2802608-2802630 CTATGGCAGAGGGACATGAATGG + Intergenic
1063281555 10:4634641-4634663 CTGTGGCAGAGAAAAAGGGAAGG + Intergenic
1063904342 10:10766932-10766954 CGTTGGCAGTGAGAAATGAACGG - Intergenic
1066681100 10:37937572-37937594 CTCTGTCAGTGGGAGAAGGAGGG - Intergenic
1069641000 10:69955527-69955549 TGGTGGCAGGGGGATATGGAGGG - Intronic
1071040017 10:81296389-81296411 GTGAGGCTATGGGAAATGGAAGG - Intergenic
1071803434 10:89090211-89090233 ATGAGGCAGAGAGAAATGGAAGG - Intergenic
1072987027 10:100149823-100149845 CTGTGGCAGAGGGGCAAGGAGGG - Intergenic
1075474737 10:122724444-122724466 CTGTGGGGGTGAGAAAAGGAGGG - Intergenic
1075855985 10:125630768-125630790 CAGTGGAAGTGGGAAGGGGAGGG - Intronic
1076566121 10:131400659-131400681 CTGTGGCAGTGCAAAGGGGAGGG + Intergenic
1077885561 11:6385061-6385083 TTTTGGCAGTAGGAAAAGGAGGG - Intergenic
1077985899 11:7350677-7350699 CTGTGGCAGTGGGCATTGAGAGG - Intronic
1078333810 11:10448174-10448196 CAGTGGCAGTGAGAGGTGGAGGG - Intronic
1079179418 11:18175963-18175985 CTATGGCATTTGGAAATCGAGGG - Intronic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1080769593 11:35328204-35328226 CTGAGTCAGTGGGAATAGGATGG - Intronic
1083267812 11:61555094-61555116 CTGTGGCTGTGGGCACTGGGTGG - Intronic
1083428954 11:62603849-62603871 CTCTGGGGATGGGAAATGGATGG - Intronic
1084268185 11:68015492-68015514 CTGGGGCAGGGGGGCATGGAGGG + Intronic
1084594233 11:70107518-70107540 CTGGGCCAGGGGGAACTGGAAGG + Intronic
1084689709 11:70718014-70718036 CTGGTACAGTGGGAAGTGGAAGG - Intronic
1084911208 11:72390881-72390903 CTGTGGCAGTGGGGAGTTGCGGG + Intronic
1085037068 11:73307238-73307260 GTTTGGCAGTGGGAAGTCGAGGG + Intergenic
1086106974 11:83157219-83157241 CTGTGGCGGCTGGAAGTGGACGG + Exonic
1086131591 11:83407458-83407480 CTGTGGCCGGGGGAGATGAAGGG + Intergenic
1086560999 11:88169102-88169124 CTATGGCAGTGGGAAAAGAGAGG + Intronic
1086831249 11:91567500-91567522 CTTTGGGAGTCGTAAATGGAAGG - Intergenic
1088477133 11:110252603-110252625 CTTTGACAGAGGGAAATGCAAGG + Intronic
1088587188 11:111369542-111369564 ATGTGGCAATGGGCAAGGGAGGG + Intronic
1089006043 11:115091531-115091553 CAGTGGCAGTGGGAAGAGTAGGG + Intergenic
1089812189 11:121141338-121141360 CTGTGGCCCTTAGAAATGGAGGG + Intronic
1090808507 11:130217679-130217701 CTGGGGCAGTGTGGACTGGAGGG + Intergenic
1090815492 11:130290494-130290516 CAGTGGCAGTGGAGAAAGGAAGG - Intronic
1091741538 12:2963365-2963387 CAGTGGCAGTTGGAAATTCAGGG + Intronic
1092051334 12:5472761-5472783 CTGTGGCAGAGGGACGTGGCAGG + Intronic
1092062723 12:5564393-5564415 GTGTGGCCTGGGGAAATGGATGG - Intronic
1092223148 12:6729157-6729179 CTAGGGCAGGGGGAAAAGGAGGG + Intronic
1093025267 12:14239994-14240016 CTGTGGCTGTGGGAAGAGAATGG + Intergenic
1093396238 12:18686131-18686153 CCGTGGCAGTAGGAAAGGAATGG - Intronic
1095496867 12:42794340-42794362 GTGTGGCAGTGGTAAATACAGGG - Intergenic
1095498600 12:42811938-42811960 CTGTGGGAGTGGAGAAGGGAGGG + Intergenic
1096901915 12:54892089-54892111 ATGTAGCAGTGTAAAATGGAAGG + Intergenic
1097094012 12:56531034-56531056 CTCTGGGGCTGGGAAATGGAGGG - Intronic
1097130348 12:56806713-56806735 CTTTTGCAGTGGGAACTGGGAGG - Intergenic
1097195392 12:57240041-57240063 CTGCGGCTGTGGGACGTGGAGGG + Intronic
1097907197 12:64932313-64932335 CAGTGGCAGGGGGAAAAGGCAGG - Intergenic
1098174562 12:67777570-67777592 ATGTGGGATTGGGAAATGTAAGG - Intergenic
1098387639 12:69935692-69935714 CTGTCGCATTGGGAGATGGAAGG - Intronic
1098807569 12:75038762-75038784 TTTTGGCAGTGGAAATTGGATGG + Intergenic
1101032789 12:100676640-100676662 CAGGGGCAGCGGGAAAGGGATGG + Intergenic
1101466320 12:104953620-104953642 CTGTTGCACCAGGAAATGGAAGG - Intronic
1101811750 12:108113402-108113424 CTGAGGCAGTGGGGAATGTGGGG + Intergenic
1102177293 12:110885584-110885606 CAGTGGCGGAGGGAAATGCATGG - Intronic
1103291948 12:119853941-119853963 CTTTGGGAGGGGGAGATGGAAGG + Intronic
1104513263 12:129401049-129401071 GTGTGGGAAAGGGAAATGGATGG - Intronic
1106230316 13:27816432-27816454 CTGTGGCAATGTGAAGTGGGTGG + Intergenic
1106301268 13:28468507-28468529 CTGGGACTGTGAGAAATGGAAGG - Intronic
1108111072 13:47073438-47073460 CAGTGGCAGTGGGCAGTGGCAGG - Intergenic
1108580917 13:51827560-51827582 CTCTGACAGTGGGAACTGGGGGG - Intergenic
1108788145 13:53932223-53932245 CAGTGGCAGTGGTAAAGGGCAGG - Intergenic
1110542455 13:76721274-76721296 CTCTGACAGTGGGAAAGGGTTGG + Intergenic
1111523320 13:89433482-89433504 TGGTGGCTGTGAGAAATGGAAGG + Intergenic
1113118415 13:106899527-106899549 CTGTGGAAGTGAGAATTTGAAGG - Intergenic
1113149901 13:107252035-107252057 CTCTGGCAGTGGGAGAGGGCAGG + Intronic
1113435158 13:110285772-110285794 CTGTGGAACTGGGAAAGCGATGG - Intronic
1113444664 13:110356187-110356209 GTGAGTCAGTGGGAAATGGAGGG - Intronic
1114308513 14:21444971-21444993 ATGTGGTAGTGGGATAGGGATGG - Intronic
1114482436 14:23044146-23044168 CTGTGCCAGTGGGAACTGTCTGG + Exonic
1115264869 14:31490879-31490901 CTGTGGCAGAGTGCAATGGGCGG + Intronic
1115813233 14:37133454-37133476 CAGTGGCAGTGGGAAAGAGAAGG - Intronic
1116782425 14:49250918-49250940 GTGTGCCAGTGGGGAATGGGAGG - Intergenic
1117060210 14:51954632-51954654 CAGTGGAAGTGAGAACTGGAAGG + Intronic
1117201119 14:53391131-53391153 ATGTGGGAGTGCGAACTGGAAGG + Intergenic
1117225591 14:53655057-53655079 CTTGGGCAGTTGGAAGTGGAAGG + Intergenic
1117302286 14:54441400-54441422 CTGTGGCCGGGGGAAGTGAATGG - Exonic
1118469598 14:66062998-66063020 TTGTGGAAGTGGGCATTGGAAGG + Intergenic
1118681754 14:68248927-68248949 GTGTGGCAGTGGGTCATGAAGGG + Intronic
1118874457 14:69771561-69771583 CTGTGGGGGTGGGATTTGGAAGG + Exonic
1119185351 14:72637551-72637573 GTGTGGCAGTTGTAAATTGAGGG - Intronic
1119416771 14:74476165-74476187 TTGTGGCAGAGGCATATGGATGG + Intergenic
1119905607 14:78299001-78299023 CTGTGGAAGTGGGCAGTCGAGGG + Intronic
1120408794 14:84123999-84124021 CTACGGCAGTGGGAGAAGGATGG - Intergenic
1121710825 14:96038353-96038375 CTGTGGCACAGGGAGATGGAGGG - Intergenic
1122208744 14:100161239-100161261 CTGGGGCAGAGGGAACTGGCAGG - Intergenic
1124615193 15:31236559-31236581 CTGGAGCAGTGGGAGATGGGTGG + Intergenic
1125299937 15:38244678-38244700 ATGTTGCAGTGGGAAGAGGAGGG + Intergenic
1125759081 15:42084925-42084947 CTGTGGCTGTGGGTCTTGGAGGG - Intronic
1126094473 15:45078216-45078238 CTGTGGCAGTGGGAATGGATAGG - Intergenic
1127640154 15:60908697-60908719 CTGGGGCAGTGGTGAAGGGAGGG - Intronic
1128519548 15:68366439-68366461 CGGTGGCAGTGGGAACTAGAGGG + Intronic
1129005526 15:72369919-72369941 CTGGGGTAGAAGGAAATGGAAGG + Intronic
1129162910 15:73757083-73757105 TAGTGGCAGTGGGATAGGGATGG - Intergenic
1129364143 15:75044040-75044062 CCGGGGCAGTGAGAAATGGAGGG - Intronic
1130070953 15:80646518-80646540 ATGTGACAGAGGGGAATGGAGGG - Intergenic
1130129998 15:81133107-81133129 CTGTGAGAATGGGAATTGGATGG - Intronic
1130795390 15:87203251-87203273 CTGTGGAAGTGGGGAAAGGTGGG + Intergenic
1131832235 15:96361282-96361304 CTGTGACAGTGGCACCTGGAAGG - Intergenic
1131937130 15:97519095-97519117 CAGTGGGAGTGGGGAATAGATGG + Intergenic
1132451781 15:101972735-101972757 CAGAGGCACGGGGAAATGGAGGG - Intergenic
1133523722 16:6583316-6583338 GTCTGACAGTGGGAAATGGGTGG + Intronic
1133628411 16:7593763-7593785 CTGTGGGACTTGGAAATGCAAGG + Intronic
1134021352 16:10923563-10923585 CTGAGGCTGTGGGATGTGGATGG - Intronic
1134327407 16:13219647-13219669 CTGGGGCATGGGGAAGTGGAGGG + Intronic
1134420883 16:14088039-14088061 CTTTGGGAGGTGGAAATGGATGG + Intronic
1137386792 16:48049445-48049467 CAGTAGCAGTGAGAATTGGAGGG - Intergenic
1137468823 16:48736172-48736194 CTGTGGCAGAGGAAAAGGCATGG + Intergenic
1137788593 16:51155615-51155637 CGGGGGCAGAGGGAAAAGGAAGG + Intergenic
1138138514 16:54545841-54545863 AAGTGTCAGTGGGAAATGAAAGG - Intergenic
1139279295 16:65756021-65756043 CTGTGACAGTGTGAAACGGTGGG - Intergenic
1139372927 16:66479772-66479794 CAGTGGCAGTGGGAAGAGAAAGG + Intronic
1140137472 16:72220075-72220097 GTATGGCAGTTGGAAATGAACGG + Intergenic
1141277904 16:82604764-82604786 CAATGGCAGGGGGAAATGGTGGG - Intergenic
1141663988 16:85456470-85456492 TCGTGGCAGTGTGAAATGGTGGG - Intergenic
1141781289 16:86163319-86163341 GTGTGGCAGTGGGCAAGGAATGG - Intergenic
1141845349 16:86604624-86604646 CTGCGCCAGTGGGAAATAGCTGG - Intergenic
1141910958 16:87058025-87058047 CGGTGGCCCTGGGAAATGGCCGG - Intergenic
1142577588 17:919926-919948 CTGAGGCAGAGAGAGATGGAAGG - Intronic
1142774267 17:2123920-2123942 CTGGGGCAGTGTTAAATGGAGGG - Intronic
1143530999 17:7503362-7503384 CTGAGAGAGGGGGAAATGGAGGG - Intronic
1144812608 17:18010233-18010255 CTGTGGCAGAGGAGAATGCAGGG + Intronic
1145246002 17:21269956-21269978 CTGTGGGAATGTGAAATGGTAGG - Intergenic
1146547119 17:33749235-33749257 CTGGGGTAGGGGGAAAGGGAGGG - Intronic
1146595978 17:34169003-34169025 TTGGGGCATTGGAAAATGGAAGG + Intronic
1147909207 17:43844717-43844739 GTGTGGGGCTGGGAAATGGAGGG + Intergenic
1148156499 17:45427823-45427845 CAGTTGCAGTGGCATATGGAGGG - Intronic
1148508969 17:48152542-48152564 TACTGGCGGTGGGAAATGGAGGG + Intronic
1148697047 17:49567016-49567038 CTCTGGCTGTGGGATAAGGAGGG + Intergenic
1148738417 17:49878175-49878197 CTGTGGCACTGGGCAAGGTATGG + Intergenic
1151635491 17:75344947-75344969 CTGAGGCAGTGGGAAGTGAGTGG - Intronic
1151948558 17:77333056-77333078 TGGTGGGAGTGTGAAATGGAAGG - Intronic
1152642078 17:81453554-81453576 GTGTGGCTGTGGGCAGTGGAGGG + Intronic
1152797593 17:82315760-82315782 GTGTGGCCGTGGGAAGGGGAGGG - Intronic
1154063272 18:11083469-11083491 CTGTGGCTTGGGGAAATGGAGGG + Intronic
1154145358 18:11862136-11862158 CTGTGGCAGTGGAGAAGAGAGGG + Intronic
1155022780 18:21911779-21911801 CTGTGGCAGACGGTAGTGGAAGG - Intergenic
1156512509 18:37652224-37652246 CTGTTGCAGTGGGCAAAGGATGG + Intergenic
1157554746 18:48606197-48606219 CTGAGGAAGGGGGAAAGGGACGG - Intronic
1158816445 18:61103323-61103345 CTGGGTCATTAGGAAATGGAAGG + Intergenic
1160431413 18:78815519-78815541 CTCTGGCAGTGGGATATTGCGGG + Intergenic
1161570038 19:5025488-5025510 CTCTGGCTGTGGGAAGTGGATGG - Intronic
1162112052 19:8404639-8404661 CTGTGGCAGGGAGGGATGGAAGG + Intronic
1162945255 19:14039528-14039550 CTGTGGCAGTGGCAGCCGGACGG + Exonic
1165343937 19:35231872-35231894 CTGTGGCATTGGGACAAGGATGG + Intergenic
1166566742 19:43770169-43770191 TTGTGGGAGTGGGAGAAGGATGG - Intronic
1166993157 19:46705154-46705176 TTGTTGCAGTGGGAAAAGGTGGG - Intronic
925893229 2:8452732-8452754 CTGTTGGAGGGGGTAATGGAGGG - Intergenic
925981023 2:9177553-9177575 CTGAAGCAATGGGAAATGGATGG + Intergenic
928100048 2:28431645-28431667 CTGTGGCAGAGAGAGATGGTGGG - Intergenic
928626986 2:33149831-33149853 CTATGGCTGTTGGAAAAGGAGGG + Intronic
929908208 2:46064886-46064908 CTGGGGCAGTGGGAAAGGGGAGG + Intronic
930111715 2:47684590-47684612 CAGGGGCTGTGGGAAATGGAGGG - Intergenic
930231905 2:48851848-48851870 AGGTGGAAGAGGGAAATGGAAGG - Intergenic
930741736 2:54838601-54838623 CTGTAGCAGAGGGAATTGGAAGG + Intronic
931333320 2:61311875-61311897 CTGAGACAGTGGCAAATTGAAGG - Exonic
931906982 2:66853191-66853213 CTGTGACAATGGGAAGCGGAAGG - Intergenic
931954062 2:67397877-67397899 CTGTGGCGGAGGCAAATGGATGG - Intronic
932216506 2:69969640-69969662 CTGGGGCAGTGGGGAGAGGATGG - Intergenic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934557846 2:95296875-95296897 CTGTGGAAGTGGAAAAGGAAGGG - Intergenic
935708012 2:105873048-105873070 CTGGGGGTGTGGGATATGGAAGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936281754 2:111147391-111147413 CTCTGGCAGGGAGAAATGGCGGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936520939 2:113211836-113211858 CTGAGGCAGCGGGAAAGGGTCGG - Intergenic
936567992 2:113595202-113595224 CAGAGGCACGGGGAAATGGAGGG - Intergenic
937212728 2:120286747-120286769 CTGTGACAGGGGACAATGGAGGG - Intronic
937248979 2:120511479-120511501 CTGGGGCAAGGGGAAATGGGGGG - Intergenic
938577428 2:132618057-132618079 TTCTTGGAGTGGGAAATGGAGGG - Intronic
940777804 2:157902921-157902943 CTGGGGCAGTGGCAAATTGTAGG - Intronic
940795456 2:158072238-158072260 CTCTGCCAGTGGAAAAGGGAGGG + Intronic
941140416 2:161773966-161773988 CAGTGGCAGTGGGAATGGAAGGG - Intronic
941707385 2:168674335-168674357 CTGTGGAAGAGGAAAAGGGATGG - Intronic
943482553 2:188439197-188439219 CTGTTGGAGTTGGAAAGGGATGG + Intronic
946089237 2:217206181-217206203 CAGGGGCAGGGGGAAATGGATGG + Intergenic
946243131 2:218368846-218368868 CTGTGTCAGTGGGAACCGGGAGG - Intergenic
946666650 2:222057490-222057512 ATTTGGGGGTGGGAAATGGAGGG - Intergenic
947124937 2:226858825-226858847 TTGTGGCAGAGAGAAATGGAAGG - Intronic
947129416 2:226905781-226905803 TTGTGGCAGTAGGAATGGGAAGG + Intronic
947859100 2:233346207-233346229 CTGTTCCAGTGGGAAAGGCAGGG + Intronic
947968884 2:234305246-234305268 GTGTGGCACTGGGGAAGGGAGGG - Intergenic
948474020 2:238204786-238204808 CTCTGGCTGTAGGACATGGAGGG + Intergenic
948476945 2:238226535-238226557 CCCTGGCAGTTGGAACTGGAAGG - Intronic
948650353 2:239439892-239439914 CTGTGGCACTGGGGCATGGCGGG + Intergenic
1169840667 20:9933271-9933293 CTGTGGCAGAGTGGAGTGGACGG + Intergenic
1170156139 20:13271358-13271380 ATGAAGCAGTGGGAAATGGGAGG + Intronic
1170180738 20:13527106-13527128 CTGGGGCTGTGGGCAATGGGAGG + Intronic
1170714596 20:18820745-18820767 GTGGGGCAGTGGGACAGGGAGGG + Intronic
1170949239 20:20921134-20921156 TTGGGCCAGTGGGATATGGATGG + Intergenic
1171304770 20:24095822-24095844 CAGAGCCAGTGGGAAAGGGAGGG - Intergenic
1171953432 20:31441265-31441287 CTGTGGCAGTGGGAAACCAGGGG + Intronic
1172481442 20:35274197-35274219 CTGGGGCAGTGTGAAAAGGAGGG - Intronic
1173748670 20:45458472-45458494 CTGTAGCATGGGAAAATGGAGGG - Intergenic
1174707785 20:52674788-52674810 CTGTGGCCAGGGGAAATGGTAGG + Intergenic
1175421174 20:58834669-58834691 CTGTGGCAGAGGGAGAGAGAGGG + Intergenic
1175719867 20:61279505-61279527 GGGTGACTGTGGGAAATGGAAGG - Intronic
1175724608 20:61309276-61309298 CTGTGGCACTGAGACATGGATGG + Intronic
1176715150 21:10343633-10343655 CAGCGGCCCTGGGAAATGGATGG - Intergenic
1177797776 21:25797198-25797220 CTGTCCCATTTGGAAATGGATGG - Intergenic
1179403890 21:41109595-41109617 CTGTGGCAGTGGGGAAGTGAAGG + Intergenic
1180757784 22:18174837-18174859 CTTTGGCAGGCTGAAATGGATGG - Intronic
1181047319 22:20221620-20221642 CTGTGGCAGTTGGCCAGGGAAGG + Intergenic
1182645434 22:31805162-31805184 CTGTGGGAGTTGGGAATAGAAGG - Intronic
1182821530 22:33220952-33220974 CTGTGGGAGTGAGAAAGAGAGGG - Intronic
1183387330 22:37522434-37522456 GTGGGGCAGTGGGAAGTGGGAGG - Intergenic
1183466204 22:37981565-37981587 CCTTGGCAATGGGAGATGGAGGG + Intronic
1183501247 22:38181059-38181081 CTGTGGGTGTGGGACAGGGAGGG - Intronic
1183786316 22:40031034-40031056 CTCTGGCAGTGGGGAGGGGAAGG + Exonic
1184296833 22:43530326-43530348 CTCTGGGGGTGGGACATGGAGGG + Intronic
1184421375 22:44384628-44384650 CGGTGGCAGGGAGAAATGGCAGG + Intergenic
1184805992 22:46795235-46795257 CTGTGGCAGTCGGAGTTGGCAGG + Intronic
1184829017 22:46972183-46972205 CAGTGGCATGGGGAAATGGATGG - Intronic
1184844441 22:47072571-47072593 CAGTGGCCCTGGGAAATGGCAGG - Intronic
1185195433 22:49466511-49466533 CTGCGGCAGTGAGAGGTGGAAGG + Intronic
950466408 3:13157776-13157798 CTGTGGCAGAGGGAGAAGAAAGG + Intergenic
950917879 3:16664084-16664106 GTGTGGCATTAGGAGATGGATGG + Intronic
951274678 3:20671030-20671052 CTGTGGAAGTGGCAGATGGTAGG + Intergenic
951811516 3:26705805-26705827 CAGTGGCTGTTGGAAAAGGAAGG - Intronic
952869510 3:37886004-37886026 CTGTGGCAGTGGGAAATGGAGGG - Intronic
953405204 3:42656519-42656541 CTGGGACAGAGGGAGATGGATGG + Intronic
953911669 3:46896402-46896424 CAGAGGCAGTGGGACAAGGAGGG + Intronic
955559257 3:60171075-60171097 TTGTGGTAATAGGAAATGGAGGG - Intronic
955842605 3:63128271-63128293 CACAGGCAGTGGCAAATGGAAGG + Intergenic
956041838 3:65152905-65152927 GGGTGGGAGTGGGAAATGGGTGG + Intergenic
956250735 3:67231351-67231373 CTGTGGGACATGGAAATGGAGGG - Intergenic
956279963 3:67545885-67545907 CTGTGGGAGAGTGTAATGGAGGG - Intronic
956843503 3:73161074-73161096 CTGGGTCTATGGGAAATGGAGGG + Intergenic
956979243 3:74616510-74616532 TTGTGGCAATTGGAAATGCAGGG - Intergenic
957859879 3:85933131-85933153 ATGTGCCAAAGGGAAATGGAAGG - Intronic
959360720 3:105387718-105387740 CAGTGGCAGAGGGATATGAAAGG + Intronic
959802622 3:110512966-110512988 CTGTGAAAGTGGGAAAAGGAGGG - Intergenic
959943814 3:112106732-112106754 CTGTGGCAGTGACACATGGCAGG - Intronic
961223815 3:125220944-125220966 CTGTGGTAGTAGTAAAGGGAGGG + Intergenic
961326333 3:126111608-126111630 CGGAAGCAGTGGGAAAAGGAAGG - Intronic
961511830 3:127408156-127408178 GTGGGGCAGTGAGAAATGGTTGG + Intergenic
961676851 3:128572859-128572881 GGGTGGCAGAGGGAAAAGGAGGG - Exonic
962057239 3:131885471-131885493 CTGTTGCAGTGGGCAAAGGATGG + Intronic
962159392 3:132982868-132982890 CTGAGGCATGGGAAAATGGAAGG + Intergenic
962345937 3:134619088-134619110 CTGTGGAAGAGGGAGAGGGATGG + Intronic
962580585 3:136794402-136794424 TTGGGGAAGTGGGAGATGGAAGG - Intergenic
962710482 3:138081654-138081676 CTGGGGGAGAGGGAAAAGGAGGG + Intronic
963219194 3:142788223-142788245 CTGTGGCAGGAGTAGATGGAGGG + Intronic
971740560 4:30515192-30515214 CTGTGGTAGTGGGATAGCGATGG - Intergenic
974109906 4:57512925-57512947 CTGTCACAGAGAGAAATGGAAGG - Intergenic
974295141 4:59988474-59988496 CTGTGGGAGTGGGACAAGGAAGG + Intergenic
975286834 4:72631197-72631219 CAGTGGCTGGGGGATATGGATGG + Intergenic
977202171 4:94130202-94130224 CTGTGACATTGGGAATGGGAGGG + Intergenic
978165692 4:105603787-105603809 CTGTGGCAGTAGGAAAGTGATGG - Intronic
980733996 4:136859072-136859094 CTGTGGCAAAGTGAAATGGGAGG - Intergenic
980985750 4:139692518-139692540 CTGTGGCAGAGGGAGATTAAGGG + Intronic
984844646 4:184099184-184099206 CTCTGGCAGTGTGGAGTGGAAGG - Intronic
984915322 4:184718387-184718409 CTGAGGCAGTTAGGAATGGAAGG - Intronic
985578364 5:684128-684150 CTGTGGCCGTGGGACATTGGAGG - Intronic
985593294 5:776268-776290 CTGTGGCCGTGGGACATTGGAGG - Intergenic
986251166 5:6059725-6059747 CACTGGCACTGGGAAATGGATGG + Intergenic
987257726 5:16173716-16173738 CTGTGGCAGTGAGCAAGTGAAGG + Intronic
987372126 5:17202979-17203001 GTGAAGCAGTGGGAATTGGAGGG + Intronic
988320008 5:29682928-29682950 CTGTGGCAGTGGGTAACAGTTGG - Intergenic
988493262 5:31722976-31722998 CTGTGGCAGTGGGCCAGGCACGG - Intronic
988999258 5:36744152-36744174 TTGTGGGAGAGGGAGATGGAAGG - Intergenic
989170975 5:38469967-38469989 CTTTGGGGGTGGGGAATGGAGGG + Intergenic
989641986 5:43591697-43591719 CTGTTTCACTGAGAAATGGAAGG + Intergenic
991524138 5:67537603-67537625 TTGTGCAAGTGGGAAATGAAGGG + Intergenic
992894716 5:81236006-81236028 CTGTGCCAGTGTGAAGAGGAAGG - Intronic
993379319 5:87188000-87188022 TGTTGGCAGTGGGAAGTGGAGGG - Intergenic
995608755 5:113887445-113887467 CCGTGGCAGTGAGATATGAATGG - Intergenic
998152782 5:139766487-139766509 CTGTGTATGGGGGAAATGGATGG + Intergenic
998383531 5:141742699-141742721 CCTTGGCAGTGGGAAGTGGGAGG + Intergenic
998480372 5:142458289-142458311 CTGTGACAGTGGAAAGGGGAGGG - Intergenic
998508784 5:142694333-142694355 CTGTGGCAGTGTGAAAGAGCTGG - Intronic
998668357 5:144324920-144324942 CTGTGGCAGGGGTGAAGGGAGGG + Intronic
998959739 5:147472158-147472180 GTGAGGCAGTGTGTAATGGATGG - Intronic
999133848 5:149304558-149304580 CTGGGGCAGAAGGAAAGGGAGGG + Intronic
999145111 5:149387370-149387392 TTATGGCTGTGGGAGATGGAAGG + Intronic
1000490645 5:161908903-161908925 GGGTGGCAGTGGGAACTGGTTGG + Intergenic
1000671263 5:164066122-164066144 CTGTTGCAGAGGGAAGTCGAAGG - Intergenic
1001132278 5:169074096-169074118 CTGGGGCAGTGGTGGATGGAGGG + Intronic
1001753090 5:174146451-174146473 GTGTTGCAGTGGACAATGGATGG - Intronic
1001960354 5:175876722-175876744 AGGTGGCAGTGGGAGATGCAGGG - Intronic
1004282733 6:14294659-14294681 CTGTGCCTGTGGGAAGTAGAGGG - Intergenic
1005319921 6:24642949-24642971 CTTTGGGAGTCCGAAATGGACGG - Intronic
1005839727 6:29734815-29734837 TGGTGGCAGGAGGAAATGGAGGG - Intronic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1006575841 6:35045004-35045026 CTATGGCCCTGGGAAATGGCAGG + Intronic
1007215458 6:40234238-40234260 CTGTCGCAGAGCAAAATGGAAGG + Intergenic
1007303056 6:40882931-40882953 CTGTGGTGTTTGGAAATGGAAGG - Intergenic
1007335659 6:41153545-41153567 GTGTGGAAGGGGGAAAGGGATGG + Intronic
1007476194 6:42121619-42121641 CTGGGCCAGTGGGCAATGCATGG + Intronic
1007684569 6:43657749-43657771 CTGAGGCACAGGGAAATGGAGGG - Intronic
1008373052 6:50758401-50758423 GTGGGACATTGGGAAATGGAAGG - Intronic
1009863719 6:69369374-69369396 ATGGGGCATTGGGAAATTGATGG - Intronic
1009908509 6:69897232-69897254 TTGATTCAGTGGGAAATGGATGG - Intronic
1009951695 6:70404169-70404191 CTTTGGCAGAGGGAAATAAAGGG - Intergenic
1010121906 6:72386485-72386507 CTGTGGCAGAGGGGAAGGGGAGG - Intronic
1010613579 6:77985490-77985512 CTGTGGTAGTGGTTACTGGAGGG - Intergenic
1010707788 6:79135212-79135234 CTGTTGCAGGGGGGAATGGTGGG - Intergenic
1010791627 6:80071570-80071592 CTATGGCAGTGGATAAGGGATGG + Intergenic
1010851375 6:80782037-80782059 CAGTGGCAGTGGGAGCTGGTAGG + Intergenic
1011150924 6:84272421-84272443 GTGTGGCAGGAGGAAAGGGAGGG + Intergenic
1012548699 6:100448679-100448701 CTGAGGCAGAGGGATAGGGAGGG + Intronic
1012993014 6:105945701-105945723 CTGTTGCAGTGGGAGATATAAGG + Intergenic
1013029001 6:106312163-106312185 CTGTAGCAGTGGGGGATGAAAGG + Intronic
1013281190 6:108638626-108638648 CTGGGGCAGTGGGAGAAGGCTGG - Intronic
1013723623 6:113064002-113064024 CTGGGGCAGGGGTAAAAGGAGGG - Intergenic
1014553878 6:122821974-122821996 CTGTGCCAGTGGCAGATAGAGGG + Intergenic
1015407429 6:132853704-132853726 GGGTTGCAGTGGGACATGGAAGG - Intergenic
1016996014 6:149962961-149962983 CTGAGGCTGTGGGAAAGGGGAGG - Intergenic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1018391767 6:163346459-163346481 CTGAGGGAGCGGGAACTGGACGG - Intergenic
1020575810 7:9925918-9925940 CAGAGACTGTGGGAAATGGAAGG - Intergenic
1020830704 7:13091263-13091285 CTGTTGGAATGGGAAGTGGAAGG + Intergenic
1021586170 7:22211170-22211192 CTTTTGCAGTGGGAAGTGGGTGG - Intronic
1022896943 7:34759761-34759783 CTGGGGCATTTGGAAATGGTGGG + Intronic
1023133813 7:37031070-37031092 CAGTGGCAGTGGGAAAGGAAAGG - Intronic
1023168707 7:37369208-37369230 CAGTGGCTGGGGGAGATGGAAGG + Intronic
1023307128 7:38842236-38842258 CTACAGCAGTGGGAAAAGGATGG - Intronic
1024117828 7:46209854-46209876 CTGTGGCAGTGGGAGAGAAAGGG - Intergenic
1024774536 7:52767423-52767445 CTTTAGCAGAGTGAAATGGAAGG + Intergenic
1025755386 7:64333401-64333423 CTGTGGCTGTCGAACATGGAAGG + Intronic
1028487114 7:91372182-91372204 CGGTGGCTGTGGGAACTGCAAGG - Intergenic
1029275238 7:99400026-99400048 CTCTGGAAGAGGGGAATGGAGGG + Intronic
1030122707 7:106125766-106125788 GTGAAGCAGTGGAAAATGGATGG + Intergenic
1031589380 7:123570786-123570808 CAGTGGTAATGGGAAATGGATGG - Intronic
1033209923 7:139453162-139453184 CAGTGGCAGTGGGACTTGGCAGG - Exonic
1034099343 7:148437713-148437735 ATATGGAAGTGGGGAATGGAAGG - Intergenic
1034906813 7:154956349-154956371 TTCTGGAAGTGGGGAATGGAAGG + Intronic
1035421211 7:158730145-158730167 CTGAGGCAGTGGGAGGTGGCTGG + Intergenic
1035683002 8:1502492-1502514 CAGTTGCAGTGGATAATGGACGG - Intronic
1036065898 8:5380958-5380980 CTGTGGCTGTGGGAGACGCAGGG + Intergenic
1036243365 8:7096972-7096994 GTGTGTAAGTGGGAAATGGTGGG + Intergenic
1039238385 8:35527955-35527977 ATTTGGCAGTGGGAAGGGGAAGG + Intronic
1039771870 8:40695379-40695401 CAGTGACAGAGGGGAATGGATGG + Intronic
1041370484 8:57154616-57154638 ATGGGGCAGTGGGATAAGGAGGG - Intergenic
1042254317 8:66787862-66787884 CTTGGGCAGTGGCTAATGGATGG - Intronic
1044392660 8:91670105-91670127 CTGTAGCATAGGTAAATGGAAGG + Intergenic
1044760169 8:95509688-95509710 CAGTGGCAGTGGGAAATGTGAGG + Intergenic
1045576430 8:103426074-103426096 GTGAAGCAGTGGAAAATGGATGG + Exonic
1047101409 8:121680312-121680334 CAATGGCAGTGGGAAAAGGAAGG - Intergenic
1047850213 8:128848816-128848838 CTGTGGCAATGTTACATGGAGGG + Intergenic
1048233020 8:132662442-132662464 TAGTGGCAGTGGGAAATGCCTGG - Intronic
1048426979 8:134332154-134332176 CTTTGGCAGTGGAAAGTGGGTGG - Intergenic
1048591204 8:135822226-135822248 CTGTGGCTGTGGGAAAGGGGTGG + Intergenic
1049515262 8:143051135-143051157 CAGTGACATTGGGAAATGCAAGG + Intronic
1049884538 9:18318-18340 CAGAGGCACGGGGAAATGGAGGG + Intergenic
1053459947 9:38260551-38260573 CGGGAGCAGTGGGAATTGGATGG + Intergenic
1055488240 9:76777971-76777993 CTATAGCAGTGGGAGGTGGAAGG + Intronic
1056186876 9:84143587-84143609 CTGTGTGTGTGGGAAATGGCAGG + Intergenic
1057270052 9:93645503-93645525 CTGTGGCTGTGGGAGGTGGGTGG + Intronic
1058205410 9:102100016-102100038 CTGTGGCAGTTGGCAACAGAGGG + Intergenic
1060553684 9:124497680-124497702 CTTGGGCAGTGGGTGATGGATGG - Intronic
1062068088 9:134539768-134539790 CTGTGGCCGAGGGAGAAGGATGG + Intergenic
1062095565 9:134701498-134701520 TTGTGGCTTTCGGAAATGGAGGG + Intronic
1062180427 9:135188479-135188501 CTGTGGCAGAGAGGAAAGGAGGG + Intergenic
1186962348 X:14750195-14750217 TTTAGGCAGGGGGAAATGGAGGG + Intergenic
1189398459 X:40644367-40644389 CTGTAGCAGAAGGAAATAGATGG + Intronic
1189528948 X:41858253-41858275 CCGTGGCAGTGGAAAACTGATGG - Intronic
1189898580 X:45682407-45682429 CTATTAGAGTGGGAAATGGAAGG - Intergenic
1196808457 X:119609402-119609424 CTGTGGCTGTGAGAAAGGAATGG - Intergenic
1198708138 X:139471921-139471943 CTCTGCAAGTGGGAAATGCAAGG - Intergenic
1199684819 X:150256512-150256534 CAGTGCCAGTGGGAATTGGAAGG + Intergenic
1200057086 X:153467315-153467337 CTGTGGCAGATGGATTTGGAGGG - Intronic
1200136907 X:153879670-153879692 TTGTGGCACTGGGCAAGGGACGG + Intronic
1200401268 X:156021833-156021855 CAGAGGCATGGGGAAATGGAGGG - Intergenic
1201316525 Y:12652733-12652755 GTGTGGCAGTGGCATAAGGATGG - Intergenic
1201489397 Y:14524606-14524628 CCGTGGCAGTGGGGAGGGGACGG - Intronic