ID: 952873868

View in Genome Browser
Species Human (GRCh38)
Location 3:37925451-37925473
Sequence AGCCTCCAACAAGCCCCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952873868_952873877 22 Left 952873868 3:37925451-37925473 CCCGCTGGGGCTTGTTGGAGGCT 0: 1
1: 0
2: 1
3: 20
4: 203
Right 952873877 3:37925496-37925518 CTTGCCTTCACCTATCATCTTGG 0: 1
1: 0
2: 1
3: 9
4: 168
952873868_952873873 -3 Left 952873868 3:37925451-37925473 CCCGCTGGGGCTTGTTGGAGGCT 0: 1
1: 0
2: 1
3: 20
4: 203
Right 952873873 3:37925471-37925493 GCTGTGGGGCCTGCATTCACAGG 0: 1
1: 0
2: 2
3: 19
4: 149
952873868_952873874 -2 Left 952873868 3:37925451-37925473 CCCGCTGGGGCTTGTTGGAGGCT 0: 1
1: 0
2: 1
3: 20
4: 203
Right 952873874 3:37925472-37925494 CTGTGGGGCCTGCATTCACAGGG 0: 1
1: 0
2: 6
3: 17
4: 170
952873868_952873878 23 Left 952873868 3:37925451-37925473 CCCGCTGGGGCTTGTTGGAGGCT 0: 1
1: 0
2: 1
3: 20
4: 203
Right 952873878 3:37925497-37925519 TTGCCTTCACCTATCATCTTGGG 0: 1
1: 0
2: 0
3: 14
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952873868 Original CRISPR AGCCTCCAACAAGCCCCAGC GGG (reversed) Intronic